저자는 세균성 긴장 응답 및 지 속성 (BASP) Novo Nordisk 기초, Lundbeck 재단 그리고 센터를 통해 덴마크 국립 연구 재단 (DNRF120)에서 교부 금에 의해 투자 되었다.

1. Transposon 도서관의 컬렉션 참고: 염색체 DARS2 로커 스 미니 테네시 10으로 복제 했다-transposon, NKBOR (pNKBOR)에 21, 결과 기반으로 NKBOR:: DARS2 (pJFM1). pNKBOR 온라인 22 얻어질 수 있다. pNKBOR 복제 23 시작자 단백질 π를 필요로 하는 R6K 기반 자살 벡터 이다. 플라스 미드 pJFM1는 따라서 pir 유전자의 염색체 복사본을 포함 하는 E. 콜라이 긴장 (예를 들어, Dh5α λ pir)에 복제할 수 있습니다. 그러나, pJFM1은 Pir 불충분 한 wildtype MG1655로 변형 때 pJFM1 복제할 수 없습니다, NKBOR의 임의 삽입에 의해 생성 된 대 저항 클론의 선택에 지도:: 세균성 염색체로 DARS2. 편의상,이 DARS2 삽입 라고 하. 그림 1 방법론의 도식 프레 젠 테이 션을 참조 하십시오.
<ol><li>준비 electrocompetent MG1655 Δ 적극적으로 성장에서 DARS2 Lysogeny 국물 (파운드)에서 37 ° C 24 성장 세포.</li>
	<li>Electroporate pJFM1 electrocompetent MG1655 Δ로 DARS2, 곤잘레스 외. 따라 24 electrocompetent 대장균 MG1655 Δ의 <ol><li>40 (물 1 µ L)에서 pJFM1의 추가 1 µ g µ L DARS2 미리 냉장, 무 균 0.2 cm 간격 베트에이 혼합물을 전송. Electroporation 챔버에는 베트를 삽입 합니다. 18 Electroporate kV, 500 Ω 및 25 µ F; 시간 상수 ~5.0 ms, 그리고 아무 아크가 발생 한다.</li>
		<li>신속 하 게 미리 데워 파운드 국물과 15 mL 테스트 튜브에 1 mL에 resuspending에 의해 세균성 정지 복구.</li>
		<li>셀 항생제 선택 없이 30 분 동안 37 ° C에서 화난된 성장 조건 하에서 배양 하 여 복구 하자. 50µg/mL 대 보충 파운드 한 천 배지 위에 박테리아 접시 하 고 37 ° C에서 밤새 품 어.</li>
	</ol></li> <li>는 electroporation에서 식민지를 계산: 한 식민지는 것으로 간주 한 염색체 transposon 삽입. 
	참고: 식민지는 식민지 카운터 또는 눈으로 계산 될 수 있습니다. 식민지의 수는 각 클론의 염색체에 위치한 transposons 분리 평균 거리에 반비례 한다.</li>
	<li>추가 1 mL 각 파운드 국물의 접시와 모든 식민지를 씻어; 파운드 국물의 1 mL ~ 100000 식민지 씻어 충분 해야 한다. 다시 파운드 국물 세균 농도 증가 동일한 1 mL를 사용 하 여. 같은 50 mL 튜브에 모든 식민지 수영장.</li>
	<li>소용돌이 튜브 및 동결 시작 물자 (t = 0). 그것을 고정, 얼음에 50% 글리세롤의 1 mL와 함께 셀 서 스 펜 션의 1 mL를 혼합 한다. 10 분 동안 얼음 건조 튜브를 전송 합니다. 일단 문화, 냉동-80 ° C 냉동 고에 그들을 전송. 
	참고:이 단계에서 50000 CFU/mL의 최소의 셀 농도으로 예상 된다.</li>
</ol> 2. 파운드에 경쟁 실험 <ol><li>녹여 얼음에-80 ° C에서 transposon 라이브러리. Pipetting으로 믹스.</li>
	<li>Transposon 라이브러리 15 mL 테스트 튜브에 파운드의 10 mL를의 전송 100 µ L.</li>
	<li>고정 단계를 37 ° C에서 8 h에 대 한 연속 진동 (250rpm) 의해 화난 세포 성장 (즉, OD 600 ~ 4.0 =). 원하는 대로 다른 성장 조건에 이러한 매개 변수를 조정.</li>
	<li>신선한 prewarmed 매체에 연속 전송에 의해 세균성 인구 모든 ~ 10 세대를 전파합니다. 이렇게 신선한 파운드의 10 mL를 이전 고정 단계 문화 10 µ L를 전송 하 고 다른 8 h에 대 한 성장 하는 고정 단계로 (즉, OD 600 ~ 4.0 =). 
	참고: 시작 및 끝 광학 밀도 동일 인으로 빌드하기 희석에 해당 ~ 10 세대의 성장 (2 10 = 1024). 세균성 인구 중 신선한 prewarmed 매체에 직접 전파 하거나 저장할 수 0-4 ° C (얼음)에 다음 날을 전파 하 고. 파운드는 여기 많은 휴대폰 doublings에 짧은 가능한 (22 분 가까이 두 배로 시간) 시간을 보장 하기 위해 사용 되었다.</li>
	<li>경쟁의 각 100 세대, 이후 저장-80 ° C에서 5 1 mL 샘플 (단계 3.3에서에서 설명).</li>
	<li>개별 transposon 삽입을 포함 하는 셀 간의 체력 차이 작은 것으로 예상 된다, 만약 계속 경쟁의 기간 긴, 여기, 700 세대 (t = 700) 사용 되었다.</li>
</ol> 3. 감시 하는 경쟁 실험 동안 남쪽 오 점 분석 <ol><li>특정 뇌관을 사용 하 여 중 합 효소 연쇄 반응 (PCR) 증폭을 수행 하 여 오 (1-kb 섹션에서 NKBOR의) 남부에 대 한 조사를 준비: NKBOR_Probe_FW : gatgttggacgagtcggaat 및 NKBOR_Probe_RV: cgttacatccctggcttgtt.
	<li>품 30 98 ° C에 <ol>초기 변성에 대 한 s. 그런 다음 10 98 ° C에서 35 주기를 수행 s, 60 ° C 30에 대 한 s, 그리고 45 72 ° C s. 마지막 확장에 대 일 분을 위한 72 ° C 사용 
		참고: PCR 반응에 대 한 서식 파일은 순화 pNKBOR 플라스 미드 21.</li>
		<li>스미스 25에 따라 결과 PCR 파편 [α-32 P] dATP 임의의 뇌관 시스템을 사용 하 여 레이블.</li>
	</ol></li> <li>T Løbner Olesen 및 폰 Freiesleben 26에 따르면 총 세포질 DNA 준비 = 0 및 선택한 시간 포인트 t까지 700 세대 경쟁의 추정 =.</li>
	<li>소화 Pvu을 인하 하지 지역에만 한 번 관심 영역을 포함 하는 NKBOR 나 프로브에 의해 보호와 총 세포질 DNA; 1 단위의 Pvu 나 기판 DNA의 완전히 다이제스트 1 µ g를 사용할 수 있습니다. 
	참고: 프로브 삽입 사이트에 따라 다양 한 길이의 염색체 DNA 함께 transposon의 일부가 들어 있는 조각 인식 합니다.</li>
	<li>Løbner Olesen 및 폰 Freiesleben 26에 따라 0.7 %agarose 젤을 사용 하 여 남쪽 오 점 수행.</li>
</ol> 4. 적자 클론의 식별 <ol><li>사용 쉬운 유전자 걷기, 해리슨 그 외 여러분에 의해 설명 된 대로 27, 700 예상된 세대 경쟁; 후 단일 클론 (파운드 플레이트에 고립 된)에서 DARS2 삽입 사이트를 식별 하 더 밴드 남쪽 오 점에 더 격리 하는 데 필요한 모든 transposon 삽입 커버.
	<ol><li>격리 PCR 템플릿 genomic DNA 50 µ g/mL 대를 포함 하는 파운드 한 천 격판덮개에 박테리아를 확산 하 고 37 ° C에서 밤새 품 어. 37 ° C에서 파운드 국물에서 숙박 한 식민지를 성장 한 이후에 압력가 증류수 200 µ L로 20 µ L을 전송 (또는 DNA 정화 단계 3.2에서 사용).
		<li>혼합 소용돌이 <ol>입니다. 위한 10 분 및 5 분에 대 한 최대 속도 원심 분리기 저장 세포 lysate 미래 사용을 위한-20 ° C에서 100 ° C에서 혼합 열.</li>
		</ol></li> <li>선택의 transposon 내 anneal를 3 중첩 된 뇌관 디자인 (PCR 전략의 그래픽 표현에 대 한 그림 2 참조). 
		참고: 중첩 된 뇌관 3 알려진된 5에 가장 가까운 거짓말 확인 해야 중첩 된 뇌관 디자인 &#39; transposon DNA, 중첩 프라이 머 2와 1의 끝. 중첩 된 뇌관 3와 5 사이 간격 &#39; 알려진된 t의 끝ransposon DNA (사이트를 찾을 수 있는 특정 염색체 transposon 삽입) 알 수 없는 DNA에 알려진된 DNA에서 시퀀스 read-through에 대 한 충분 해야 한다. NKBOR에 대 한 다음 중첩 된 뇌관을 사용 되었다: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg, 및 pNKBOR_Nested1_RV: actttctggctggatgatgg. 알려진된 제한 효소의 인식 사이트를 포함 하는 임의의 뇌관도 사용 됩니다. 결과 보장 하기 위해, 하나는 적어도 두 개의 다른 무작위 뇌관을 사용 해야 합니다. 제한 효소 (e.g.,Sau 3AI 및 힌 dIII)에 대 한 제한 사이트 있어야 3 &#39; 끝과 앞 10 임의의 기지 그래서 그 5 &#39;-NNNNNNNNNNGATC-3 &#39; 5 &#39;-NNNNNNNNNNAAGCTT-3 &#39;는 뇌관 포함 된 Sau 3AI 사이트 (GATC) 힌 dIII 사이트 (AAGCTT), 각각, 어디 N = A, T, G, 또는 C.</li>
		<li>20에서 게놈 DNA의 사용 200 ng µ L PCR 반응. 30에 대 한 98 ° C에 품 어 초기 변성에 대 한 s. 30에 대 한 98 ° C에서 25 주기를 수행 15 50 ° C s s, 그리고 4 분 동안 72 ° C. 마지막 확장에 대 한 사용 하 여 72 ° C 10 분 사용 뇌관 쌍 구성 된 중첩 된 뇌관 1 무작위 뇌관 중 하나.</li>
		<li>뇌관 쌍 뇌관 2 중첩 및 두 번째 증폭에서 동일한 무작위 뇌관의 구성 된 그것의 이전 반응의 1 µ L를 사용 하 여 서식 파일로 사용.</li>
		<li>반복 단계 4.1.4 뇌관 3 중첩 된 동일한 임의의 뇌관의 구성 된 뇌관 쌍.</li>
		<li>는 1.5 %agarose 젤에 ethidium 평범한 사람으로 얼룩 최종 PCR 반응에서 제품을 실행합니다. 100-800 bp 범위에서 밴드를 잘라 하 고 어떤 상업적인 DNA 젤 추출 키트 제조 업체에 따르면를 사용 하 여 DNA를 분리 &#39; s 방향. 물 15 µ L에서 DNA resuspend. 
		참고: 주의. Ethidium 평범한 사람 독성 그리고 관리와 처리 해야 합니다.</li>
		<li>생어를 사용 하 여 시퀀싱 뇌관으로 뇌관 3 중첩 (4.1.6 단계) 이전 단계에서 격리 하는 밴드 순서는 상업적인 공급자에서 시퀀싱.</li>
	</ol></li> <li>WGS 수행.
	<ol><li>Frimodt 몰 러 외 4에 설명 된 대로 수행 WGS DNA에서 추출한 총에 경쟁 실험 기간 동안 수집 된 샘플을 선택.</li>
	</ol></li> <li>시퀀싱 분석 수행.
	<ol><li>맞춤 짝 간 150을 읽고 NKBOR, AF310136.1 1,904 인접 Ns &#8230; 2,204 씨앗 부분 문자열 (S, 1, 1.15)와의 모호한 문자 (L, 0, 0.9) 최대 수 사이 간격 Bowtie2 28을 사용 하 여.</li>
		<li>정렬 된 읽기를 선택 하 고 다음 다시 두 MG1655 ref를 정렬 | NC_000913.3 및 NKBOR 기가바이트 | AF310136 blastN 29를 사용 하 여</li> <li>할당 전위 접합 MG1655 NKBOR에서 삽입 위치.</li>
	</ol></li></ol> 5. Flow Cytometry <ol><li>cytometry에 대 한 샘플을 수집.
	적어도 10 세대를 위한 지 수 성장 단계에 그것을 유지 하 여 <ol><li>균형 각 문화. OD 600을 확인 하 고 그것은 결코 0.3 초과 확인.</li>
		<li>두 가지 유형의 흐름 샘플을 수집합니다.
		<ol><li>RIF runout에 대 한 RIF-CEF (300 µ g/mL 리 팜 피신과 36 µ g/mL 세 팔 렉 신 12.5 m m NaOH에에서 녹아 있는)의 30 µ L을 포함 하는 15 mL 튜브에 문화의 1 mL을 전송. 동요의 4 h의 최소 37 ° C에서 그것을 두고. 
			참고: 리 팜 피신 직접 차단 하지 복제에의 지속적인 라운드 종료를 계속 하면서 염색체 복제의 개시 합니다. 세 팔 렉 신 세포 분열, 복제 runout (RIF runout)에 완전히 복제 된 염색체를 가진 세포의 축적을 방지 합니다. 리 팜 피신 및 세 팔 렉 신 20 치료 시 완전히 복제 된 염색체의 수는 근원의 수.</li>
			<li>특급-샘플, 전송의 기 하 급수적으로 성장 하는 얼음에 1.5 mL 튜브에 문화 1 mL</li>
		</ol></li></ol></li> <li>셀을 다음과 같이 수정. 4에서 5 분 동안 15000 x g에서 원심 분리 하 여 세포를 수확 ° C. 얼음 10 mM Tris pH 7.5의 100 µ L에 펠 릿을 Resuspend 하 고 차가운 77% 에탄올의 1 mL을 추가. 사용 될 때까지 4 ° C에서 샘플 저장.</li>
	<li>셀 다음과 같이 얼룩. 상쾌한 15 분 제거에 대 한 15000 x g에서 원심 분리 하 여 고정된 셀의 100-300 µ L를 수확 하 고 펠 릿의 130 µ L에서 resuspend &#34; DNA 얼룩이 솔루션 &#34; (90 µ g/mL mithramycin, 20 µ g/mL ethidium 평범한 사람, 10 m m MgCl 2 그리고 10 mM Tris pH 7.5). 얼음에 샘플을 넣어 하 어두운; 샘플에 대 한 준비가 흐름 cytometry 분석 10 분 후 
	참고: 다른 DNA ethidium 평범한 사람 보다 얼룩과 mithramycin 사용된 30 , 31 수.</li>
	<li>흐름 cytometry 분석 셀, 상대 셀 질량 및 상대 DNA 콘텐츠 원본 결정.
	<li>수행 cytometry, 32에서 설명한 대로 <ol>. RIF runout 및 EXP-샘플 교류 cytometer 제조 업체를 사용 하 여 실행 &#39; s 지침 . Mithramycin-및 ethidium 평범한 사람 얼룩이 진 셀 여기 파장 395 및 440 nm을 사용 하 고 565 위 형광 수집 nm.
		<li>셀 번호 히스토그램 대 단일 매개 변수 앞으로 빛 분산형 및 30000 이벤트의 최소 셀 번호 히스토그램 대 형광 강도 특급 샘플 실행 상대 셀 질량과 상대 DNA 콘텐츠를 결정 하려면 <ol> 해당 셀 신호 하.</li>
			<li>사용 앞으로 흩어져 빛 단일 매개 변수 분포를 평균 상대 측정 셀 미사 
			참고: 앞으로 흩어져 빛은 평균 셀 대량 20.</li>
			<li>평균 DNA를 측정 하기 위해 사용 형광 강도 단일 매개 변수 배포판 콘텐츠 20.</li>
			<li>평균 DNA 콘텐츠 평균 셀 대량 20의 비율으로 DNA 농도 얻을.</li>
		</ol></li> <li>셀 당 근원의 수를 결정.
		<ol><li>대 단일 매개 변수 형광 강도를 실행 RIF runout 샘플 셀 셀 신호에 해당 하는 30000 이벤트의 최소 숫자 히스토그램.</li>
			<li>각 염색체의 수를 확인 하려면 사용 하 여 형광 강도 단일 매개 변수 배포판 셀 20.</li>
		</ol></li></ol></li> <li>계산 비동기 인덱스 (Ai).
	<li>계산 Ai, Løbner Olesen 외에 설명 된 대로 <ol> 32, RIF runout 샘플 및 수식 Ai의 형광 강도 단일 매개 변수 배포판을 사용 하 여 = (f3 + f5 + f6 + f7) / (f2 f4 + f8), fx가 x 완전히 복제 된 염색체의 수와 분수 셀. 식 이라고 때 비동기 고려 A &#62; 0.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frimodt-Moller, J., Charbon, G., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+bacterial+chromosome+replication+by+non-coding+regions+outside+the+origin.">Control of bacterial chromosome replication by non-coding regions outside the origin.</a> Curr Genet. , (2016).</li><li>Sherratt, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+and+chromosome+segregation.">Recombination and chromosome segregation.</a> Philos Trans R Soc Lond B Biol Sci. 359 (1441), 61-69 (2004).</li><li>Bigot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+motifs+that+control+E.+coli+chromosome+segregation+by+orienting+the+FtsK+translocase.">DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase.</a> EMBO J. 24 (21), 3770-3780 (2005).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Replication+Control+Is+Linked+to+Genomic+Positioning+of+Control+Regions+in+Escherichia+coli.">DNA Replication Control Is Linked to Genomic Positioning of Control Regions in Escherichia coli.</a> PLoS Genet. 12 (9), 1006286 (2016).</li><li>Kornberg, A., Baker, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> DNA Replication, Second Edition. , (1992).</li><li>Kaguni, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+initiation+at+the+Escherichia+coli+chromosomal+origin.">Replication initiation at the Escherichia coli chromosomal origin.</a> Curr Opin Chem Biol. 15 (5), 606-613 (2011).</li><li>Leonard, A. C., Grimwade, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+DnaA+assembly+and+activity:+taking+directions+from+the+genome.">Regulation of DnaA assembly and activity: taking directions from the genome.</a> Annu Rev Microbiol. 65, 19-35 (2011).</li><li>Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+cycle-coordinated+change+of+the+adenine+nucleotide-bound+forms+of+DnaA+protein+in+Escherichia+coli.">Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli.</a> EMBO J. 18 (23), 6642-6652 (1999).</li><li>Sekimizu, K., Bramhill, D., Kornberg, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP+activates+dnaA+protein+in+initiating+replication+of+plasmids+bearing+the+origin+of+the+E.+coli+chromosome.">ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome.</a> Cell. 50 (2), 259-265 (1987).</li><li>Brendler, T., Austin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+of+SeqA+protein+to+DNA+requires+interaction+between+two+or+more+complexes+bound+to+separate+hemimethylated+GATC+sequences.">Binding of SeqA protein to DNA requires interaction between two or more complexes bound to separate hemimethylated GATC sequences.</a> EMBO J. 18 (8), 2304-2310 (1999).</li><li>Lu, M., Campbell, J. L., Boye, E., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SeqA:+a+negative+modulator+of+replication+initiation+in+E.+coli.">SeqA: a negative modulator of replication initiation in E. coli.</a> Cell. 77 (3), 413-426 (1994).</li><li>Katayama, T., Kubota, T., Kurokawa, K., Crooke, E., Sekimizu, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+initiator+function+of+DnaA+protein+is+negatively+regulated+by+the+sliding+clamp+of+the+E.+coli+chromosomal+replicase.">The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase.</a> Cell. 94 (1), 61-71 (1998).</li><li>Kato, J., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hda,+a+novel+DnaA-related+protein,+regulates+the+replication+cycle+in+Escherichia+coli.">Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.</a> EMBO J. 20 (15), 4253-4262 (2001).</li><li>Kasho, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DnaA+binding+locus+datA+promotes+DnaA-ATP+hydrolysis+to+enable+cell+cycle-coordinated+replication+initiation.">DnaA binding locus datA promotes DnaA-ATP hydrolysis to enable cell cycle-coordinated replication initiation.</a> Proc Natl Acad Sci U S A. 110 (3), 936-941 (2013).</li><li>Kitagawa, R., Ozaki, T., Moriya, S., Ogawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+control+of+replication+initiation+by+a+novel+chromosomal+locus+exhibiting+exceptional+affinity+for+Escherichia+coli+DnaA+protein.">Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.</a> Genes Dev. 12 (19), 3032-3043 (1998).</li><li>Fujimitsu, K., Senriuchi, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+genomic+sequences+of+E.+coli+promote+replicational+initiation+by+directly+reactivating+ADP-DnaA.">Specific genomic sequences of E. coli promote replicational initiation by directly reactivating ADP-DnaA.</a> Genes Dev. 23 (10), 1221-1233 (2009).</li><li>Kasho, K., Fujimitsu, K., Matoba, T., Oshima, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timely+binding+of+IHF+and+Fis+to+DARS2+regulates+ATP-DnaA+production+and+replication+initiation.">Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.</a> Nucleic Acids Res. 42 (21), 13134-13149 (2014).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+regions+for+chromosome+replication+are+conserved+with+respect+to+sequence+and+location+among+Escherichia+coli+strains.">Control regions for chromosome replication are conserved with respect to sequence and location among Escherichia coli strains.</a> Front Microbiol. 6, 1011 (2015).</li><li>Bergthorsson, U., Ochman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+chromosome+length+variation+in+natural+isolates+of+Escherichia+coli.">Distribution of chromosome length variation in natural isolates of Escherichia coli.</a> Mol Biol Evol. 15 (1), 6-16 (1998).</li><li>Boye, E., Steen, H. B., Skarstad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+bacteria:+a+promising+tool+in+experimental+and+clinical+microbiology.">Flow cytometry of bacteria: a promising tool in experimental and clinical microbiology.</a> J Gen Microbiol. 129 (4), 973-980 (1983).</li><li>Rossignol, M., Basset, A., Espeli, O., Boccard, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NKBOR,+a+mini-Tn10-based+transposon+for+random+insertion+in+the+chromosome+of+Gram-negative+bacteria+and+the+rapid+recovery+of+sequences+flanking+the+insertion+sites+in+Escherichia+coli.">NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli.</a> Res Microbiol. 152 (5), 481-485 (2001).</li><li>Shafferman, A., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+properties+of+the+beta+origin+of+replication+of+plasmid+R6K.">Structural properties of the beta origin of replication of plasmid R6K.</a> J Biol Chem. 258 (7), 4083-4090 (1983).</li><li>Gonzales, M. F., Brooks, T., Pukatzki, S. U., Provenzano, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+protocol+for+preparation+of+electrocompetent+Escherichia+coli+and+Vibrio+cholerae.">Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae.</a> J Vis Exp. (80), (2013).</li><li>Smith, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+primed+labeling+of+DNA.">Random primed labeling of DNA.</a> Methods Mol Biol. 18, 445-447 (1993).</li><li>Lobner-Olesen, A., von Freiesleben, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+replication+incompatibility+in+Dam+methyltransferase+deficient+Escherichia+coli+cells.">Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells.</a> EMBO J. 15 (21), 5999-6008 (1996).</li><li>Harrison, R. W., Miller, J. C., D'Souza, M. J., Kampo, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+gene+walking.">Easy gene walking.</a> Biotechniques. 22 (4), 650-653 (1997).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J Mol Biol. 215 (3), 403-410 (1990).</li><li>Stepankiw, N., Kaidow, A., Boye, E., Bates, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+right+half+of+the+Escherichia+coli+replication+origin+is+not+essential+for+viability,+but+facilitates+multi-forked+replication.">The right half of the Escherichia coli replication origin is not essential for viability, but facilitates multi-forked replication.</a> Mol Microbiol. 74 (2), 467-479 (2009).</li><li>Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+minichromosomes+in+individual+Escherichia+coli+cells:+implications+for+replication+control.">Distribution of minichromosomes in individual Escherichia coli cells: implications for replication control.</a> EMBO J. 18 (6), 1712-1721 (1999).</li><li>Lobner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K., Boye, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DnaA+protein+determines+the+initiation+mass+of+Escherichia+coli+K-12.">The DnaA protein determines the initiation mass of Escherichia coli K-12.</a> Cell. 57 (5), 881-889 (1989).</li><li>Carver, T., Thomson, N., Bleasby, A., Berriman, M., Parkhill, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAPlotter:+circular+and+linear+interactive+genome+visualization.">DNAPlotter: circular and linear interactive genome visualization.</a> Bioinformatics. 25 (1), 119-120 (2009).</li><li>Eckert, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrospective+application+of+transposon-directed+insertion+site+sequencing+to+a+library+of+signature-tagged+mini-Tn5Km2+mutants+of+Escherichia+coli+O157:H7+screened+in+cattle.">Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle.</a> J Bacteriol. 193 (7), 1771-1776 (2011).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat Methods. 6 (10), 767-772 (2009).</li><li>van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+a+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms.</a> Nat Rev Microbiol. 11 (7), 435-442 (2013).</li><li>Jeong, H., Lee, S. J., Kim, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Procedure+for+Adaptive+Laboratory+Evolution+of+Microorganisms+Using+a+Chemostat.">Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat.</a> J Vis Exp. (115), (2016).</li><li>Bryant, J. A., Sellars, L. E., Busby, S. J., Lee, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+position+effects+on+gene+expression+in+Escherichia+coli+K-12.">Chromosome position effects on gene expression in Escherichia coli K-12.</a> Nucleic Acids Res. 42 (18), 11383-11392 (2014).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li></ol>

저자는 전혀 경쟁 금융 관심이 없다.

여기에서 사용 하는 방법론-의 상태--예술 기법 유전적 요소의 최적의 게놈 위치에 대 한 어려운 질문에 대답을 활용 합니다. 유전자 요소 (중재는 transposon)의 임의 삽입 수 클론 다음 조사 유전 요소의 최적의 위치를 위해 선택 하는 서로 대하여 경쟁 하기 위해 만들 수 있는 수천의 신속 하 고 쉽게 컬렉션 (즉 적자 클론).
여기, DARS2 미니-테네시10에 삽입 된...

어떤 유전적 요소의 기능 게놈에 있는 그것의 위치에 따라 달라질 수 있습니다. 박테리아에이 주로 결과 방해에서 인접 유전자, 로컬 DNA 토폴로지 및 복제 관련 유전자 노출량의 전사에 의해. 특히, DNA 복제 및 분리의 프로세스 제어, 적어도 부분에서 비 코딩 염색체 지역별1, 그리고이 지역의 적절 한 기능에 따라 달라 집니다 genomic 위치/컨텍스트. 대장균, 예제에서는 여동생에 필요한 dif 사이트 염색체 해상도2; KOPS 시퀀스, 염색체 분리3;에 필요한 및 데이터, DARS1및 DARS2 지역, (아래; 적절 한 염색체 복제 제어에 필요한 4). 우리 여기 DARS2 비 코딩 영역의 연구에 의해 exemplified 임의의 이전, 선택, 그리고 어떤 주어진된 유전 요소의 최적의 유전자 맥락의 결정에 대 한 허용 하는 방법 제시.
대장균, DnaA에 시작자 단백질은 DNA 물가는 단일 복제 원점오릭스, 여 helicase DnaB5,,67의 채용에 대 한 책임. DnaA AAA+ (즉, 다양 한 활동과 관련 된 ATPases)에 속하는 단백질 유사한 높은 ATP 그리고 ADP를 바인딩할 수 및 화력5. DnaAATP 수준 개시8, DnaAATP 에 multimer를 형성에서 봉우리 오릭스 는 DNA 이중 오프닝9트리거합니다. 개시, 후 오릭스 hemimethylated SeqA 단백질의 바인딩을 포함 하는 메커니즘에 의해 격리로 인해 다시 개시에 대 한 일시적으로 사용할 수 없게 만든 오릭스10,11. 격리, 동안 DnaAATP 의 수준을 적어도 두 가지 메커니즘에 의해 감소 된다: DnaA (RIDA)12,13 및 데이터의 규제 비활성화-종속 DnaAATP 가수분해 (DDAH)14 ,15. RIDA와 DDAH 홍보 DnaAADPDnaAATP 의 변환. 개시의 새로운 라운드 전에 DnaAADP 는 특정 DnaA 재가동 시퀀스 (DARS)에 DnaAATP 를 재가동: DARS1 및 DARS216,17. 염색체 데이터, DARS1및 DARS2는 비 코딩 지역과 DnaAATP를 변조 하는 보호자와 같은 방식으로 행동 /DnaAADP interconversion. 복제의 근원 밖에이 지역 활성화 DnaA 복잡 한 어셈블리 중 하나에 대 한 비활성화 (데이터, 14) 또는 활성화 (DARS1 및 DARS2; 17) DnaA의. DARS2 셀에서 삭제 대량 배로 시간 되지만 비동기 복제 개시15,,1618변경 되지 않습니다. 그러나, DARS2-결핍 세포는 피트 니스는 풍부한 매체에서 모두 지속적인 성장 경쟁 하는 동안 또는 마우스 내장18에 있는 식민지의 설립 동안에 그렇지 않으면 isogenic wildtype에 비해 비용. 이 비동기/근원 농도에 사소한 변화 세균성 체력에 부정적인 효과 나타냅니다. 대장균, 선택적 압력 유지 염색체 대칭 (즉, 두 거의 같은 길이의 복제 팔)19있다. 데이터, DARS1및 DARS2 지역에 동일한 상대 거리는 오릭스 모든 대장균 변종 시퀀싱18, 염색체 크기에 큰 변화에도 불구 하 고.
여기, 우리가 그것의 기능에 대 한 최적의 염색체 position(s)의 식별에 대 한 예를 들어 대장균 의 DARS2 지역을 사용합니다. DARS2 NKBOR transposon 및 결과 NKBOR에 삽입 되었다: MG1655의 게놈에 무작위로 삽입 이후DARS2 transposon ΔDARS2. 우리는 따라서 셀의 컬렉션을 생성, 각 보유 DARS2 염색체에 다른 위치에 배치 합니다. 생체 외에서 경쟁 실험, 어디는 컬렉션에 있는 모든 셀 풀링된 되었고 약된 700 세대에 대 한 파운드에서 지속적인 성장을 하는 동안 서로 대하여 경쟁, 수행 되었다. 경쟁 실험의 결과 모니터링/결정 했다 남쪽 오 점, 쉬운 유전자 산책, 그리고 전체 게놈 시퀀싱 (WGS;를 사용 하 여 그림 1)입니다. 끝점 클론 쉬운 유전자 걸어서 해결 cytometry 세포 주기 매개 변수를 평가 하 여 특징 이었다. 흐름 cytometric 분석에 많은 수의 셀에 대 한 셀 크기, DNA 콘텐츠 및 개시 synchrony를 측정할 수 있습니다. Cytometry, 하는 동안 단일 셀의 흐름은 다음 동시에 등록 내보낸된 형광 DNA 콘텐츠, 측정을 수집 하는 photomultipliers에 의해 제공, 스테인드 DNA를 자극 하는 적절 한 파장의 광선 전달 합니다 세포는 DNA에 물 들 다. 앞으로 흩어져 빛 셀 대량20의 측정 이다.
생체 외에서 경쟁 실험 선물이 여기 염색체 위치 및 유전 요소의 게놈 맥락의 중요성에 관한 문제를 해결 하는 데 사용 됩니다. 방법은 공평 하 고 사용 하기 쉬운입니다.

<table width="819">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Autoclaved Mili-Q water</td>
			<td style="width:164px;"></td>
			<td style="width:119px;">None</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Electroporation Cuvettes, 0.1 cm</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">P41050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Bio-Rad MicroPulser Electroporation System</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;">165-2100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">LB Broth</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">12780029&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">LB Agar, powder (Lennox L agar)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">22700025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Glycerol</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">17904</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Fisherbrand&#160;Plastic Petri Dishes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">S33580A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Falcon 50mL Conical Centrifuge Tubes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">14-432-22</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Falcon 15mL Conical Centrifuge Tubes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">14-959-53A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Nunc&#160;CryoTubes</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">V7634&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">Phusion High-Fidelity DNA Polymerase (2 U/&#181;L)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">F530S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">dATP, [&#945;-32P]- 3000Ci/mmol 10mCi/ml, 250 &#181;Ci</td>
			<td style="width:164px;">PerkinElmer</td>
			<td style="width:119px;">BLU012H250UC</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">DECAprime II DNA Labeling Kit</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">AM1455</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Spectrophotometer&#160; SF/MBV/03.32</td>
			<td style="width:164px;">Pharmacia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Hermle Centrifuge&#160;&#160;&#160; SF/MBV/03.46</td>
			<td style="width:164px;">Hermle</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ole Dich Centrifuge&#160; SF/MBV/03.29</td>
			<td style="width:164px;">Ole Dich</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Eppendorftubes 1.5 mL</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Eppendorftubes 2.0 mL</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T2795</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Merck</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">96% Ethanol</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">16368</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Trizma HCl</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T-3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Phenol Ultra Pure</td>
			<td>BRL</td>
			<td>5509UA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Chloroform</td>
			<td>Merck</td>
			<td>2445</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ribonuclease A type II A</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>R5000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Sodiumdodecylsulphate (SDS)</td>
			<td>Merck</td>
			<td>13760</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Lysozyme</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>L 6876</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Isopropanol</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>405-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">0.5M Na-EDTA pH 8.0</td>
			<td>BRL</td>
			<td>5575 UA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Kanamycin sulfate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">10106801001</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">PvuI (10 U/&#181;L)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">ER0621</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">UltraPure Agarose</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">DNA Gel Loading Dye (6X)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">R0611</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Tris-Borate-EDTA buffer</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T4415</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ethidium bromide</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">E7637</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Hydrochloric acid</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">433160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Sodium Hydroxide</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">71687</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Whatman&#160;3MM papers</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">WHA3030931</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">SSC Buffer 20&#215; Concentrate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">S6639</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Amersham Hybond-N+</td>
			<td style="width:164px;">GE Healthcare</td>
			<td style="width:119px;">RPN119B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ficoll&#160;400</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">F8016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Polyvinylpyrrolidone</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">PVP40</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Bovine Serum Albumin - Fraction V</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">85040C</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Deoxyribonucleic acid sodium salt from salmon testes</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1626</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Carestream Kodak &#160;BioMax &#160;light film</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">Z373494</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">GenElute &#160;Gel Extraction Kit</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">NA1111&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">GenElute &#160;PCR Clean-Up Kit</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">NA1020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">T100&#160; Thermal Cycler</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Rifampicin</td>
			<td style="width:164px;">Serva</td>
			<td style="width:119px;">34514.01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Cephalexin</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">C4895</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Mithramycin</td>
			<td style="width:164px;">Serva</td>
			<td>29803.02</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Magnesium chloride hexahydrate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">246964</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Apogee A10 instrument</td>
			<td style="width:164px;">Apogee</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach

특정된 DNA 요소의 최적의 염색체 position(s)는 / transposon 중재 무작위 삽입 휘트니스 선택에 의해 다음에 의해 결정 되었다. 박테리아, 유전적 요소의 기능에 유전 맥락의 영향을 평가 하기 위해 어려울 수 있습니다. 토폴로지 효과, 이웃 유전자 또는 유전자 복제 관련 된 복용량, transcriptional 방해를 포함 하 여 몇 가지 메커니즘 주어진 유전적 요소의 기능 영향을 줄 수 있습니다. 여기, 대장균 및 간단한 성장 경쟁을 사용 하 여 가장 유리한 위치 실험 선택의 염색체에 DNA 요소의 임의의 통합을 허용 하는 방법을 설명 합니다. 메서드를 사용 하면 임의의 삽입, 성장 혜택, 실험적인 요구에 쉽게 조절 절차 적자 clone(s)의 선택과 결합의 잘 설명된 transposon-기반 시스템의 활용. 복잡 한 다중 클론 인구에 전체 게놈 시퀀싱 또는 선택 된 클론의 급속 한 식별에 대 한 쉬운 유전자 적자 clone(s)의 성격을 결정할 수 있습니다. 여기, 비 코딩 DNA 영역 DARS2, 대장균의 염색체 복제의 개시를 제어 하는 예제로 사용 되었다. DARS2 의 기능 유전자 복제 관련 된 복용량;에 의해 영향을 받을 것으로 알려져 가까이 DARS2 는 더 활성화 된다 DNA 복제의 기원에 가져옵니다. DARS2 DARS2의 염색체에 무작위로 삽입 된-변형 삭제. 개별 삽입을 포함 하는 결과 클론 풀링된 그리고 세대의 수백을 위해 서로 경쟁 했다. 마지막으로, 적자 클론 특징 되었고 DARS2 원래 DARS2 위치에 가까운 근접에서 삽입 포함 발견.

남쪽 오 점 DARS2 transposon 라이브러리에 염색체에 걸쳐 무작위로 배포 했다 확인 이루어졌다 (t = 0) 적자 클론 시간이 지남에 유지할 것 이다 그. 남쪽 오 점 초기 transposon 풀에서 추출한 DNA에서 수행 되었다 (t = 0)과 경쟁 (그림 3)의 700 세대에서 모든 예상된 100. 여기, 각 시간 점에서 총 세포 DNA가 나 제한 효소, 잘라 transposon NKBOR 알려진 Pvu?...

Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

여기, 비 코딩 DNA 요소의 transposon 중재 무작위 삽입의 힘의 최적의 염색체 위치를 해결 하기 위해 사용 되었다.

소설 Transposon 중재 방식을 사용 하 여 대장균 의 DNA 요소에 대 한 최적의 염색체 위치 결정

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

determination-optimal-chromosomal-location-s-for-dna-element

Universidad San Sebastian

Research

JoVE Journal

Genetics

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

7.5K 조회수.  University of Copenhagen. 여기, 비 코딩 DNA 요소의 transposon 중재 무작위 삽입의 힘의 최적의 염색체 위치를 해결 하기 위해 사용 되었다.

비디오: Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

를 사용하여 주변 입자상 물질에 의한 염색체 수차 분석<em&gt; 체외</em&gt; 시스템

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

연구

유전학

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

단일 셀 시퀀싱을 사용하여 복사 번호 수선의 검출

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Genome-wide Determination of Mammalian Replication Timing by DNA Content Measurement

Replication of the genome occurs during S phase of the cell cycle in a highly regulated process that ensures the fidelity of DNA duplication. Each genomic region is replicated at a distinct time during S phase through the simultaneous activation of multiple origins of replication. Time of replication (ToR) correlates with many genomic and epigenetic features and is linked to mutation rates and cancer. Comprehending the full genomic view of the replication program, in health and disease is a major future goal and challenge.
This article describes in detail the &#34;Copy Number Ratio of S/G1 for mapping genomic Time of Replication&#34; method (herein called: CNR-ToR), a simple approach to map the genome wide ToR of mammalian cells. The method is based on the copy number differences between S phase cells and G1 phase cells. The CNR-ToR method is performed in 6 steps: 1. Preparation of cells and staining with propidium iodide (PI); 2. Sorting G1 and S phase cells using fluorescence-activated cell sorting (FACS); 3. DNA purification; 4. Sonication; 5. Library preparation and sequencing; and 6. Bioinformatic analysis. The CNR-ToR method is a fast and easy approach that results in detailed replication maps.

We describe here a relatively fast and simple approach for mapping genome-wide mammalian replication timing, from cell isolation to the basic analysis of the sequencing results. A genomic map of a representative replication program will be provided following the protocol.

DNA 콘텐츠 측정에 의한 포유 동물 복제 타이밍의 게놈 전체의 결정

Replication of the genome occurs during S phase of the cell cycle in a highly regulated process that ensures the fidelity of DNA duplication. Each genomic ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

강력한 DNA 고립과 표 본관 표본에 대 한 높은 처리량 시퀀싱 도서관 건축

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Phosphorothioates를 사용 하 여 RNA에서 사이트 바인딩 규제 단백질의 소설 포화 Mutagenesis 접근: 단일 단계 특성

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Excisable 항 생 저항 카세트와 P1 변환 하 여 대장균 에서 생산 유전자 삭제

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences is desired. We herein provide a detailed in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) protocol to study the RNA structural change in the presence of an experimental drug for spinal muscular atrophy (SMA), survival of motor neuron (SMN)-C2, and in exon 7 of the pre-mRNA of the SMN2 gene. In in vitro SHAPE, an RNA sequence of 140 nucleotides containing SMN2 exon 7 is transcribed by T7 RNA polymerase, folded in the presence of SMN-C2, and subsequently modified by a mild 2&#39;-OH acylation reagent, 2-methylnicotinic acid imidazolide (NAI). This 2&#39;-OH-NAI adduct is further probed by a 32P-labeled primer extension and resolved by polyacrylamide gel electrophoresis (PAGE). Conversely, 2&#39;-OH acylation in in-cell SHAPE takes place in situ with SMN-C2 bound cellular RNA in living cells. The pre-mRNA sequence of exon 7 in the SMN2 gene, along with SHAPE-induced mutations in the primer extension, was then amplified by PCR and subject to next-generation sequencing. Comparing the two methodologies, in vitro SHAPE is a more cost-effective method and does not require computational power to visualize results. However, the in vitro SHAPE-derived RNA model sometimes deviates from the secondary structure in a cellular context, likely due to the loss of all interactions with RNA-binding proteins. In-cell SHAPE does not need a radioactive material workplace and yields a more accurate RNA secondary structure in the cellular context. Furthermore, in-cell SHAPE is usually applicable for a larger range of RNA sequences (~1,000 nucleotides) by utilizing next-generation sequencing, compared to in vitro SHAPE (~200 nucleotides) that usually relies on PAGE analysis. In case of exon 7 in SMN2 pre-mRNA, the in vitro and in-cell SHAPE derived RNA models are similar to each other.

Detailed protocols for both in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) experiments to determine the secondary structure of pre-mRNA sequences of interest in the presence of an RNA-targeting small molecule are presented in this article.

작은 분자 조사를 시험관 및 셀 모양을 사용 하 여 사전 mRNA 구조 변화 유도

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Vivo 내 인 성 유전자 발현의 조작에 대 한 원격 제어 시스템의 응용 프로그램에서

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame (ORF) annotation impose two arbitrary criteria: a minimum length of 100 codons and a single ORF per transcript. However, a growing number of studies report expression of proteins from allegedly non-coding regions, challenging the accuracy of current genome annotations. These novel proteins were found encoded either within non-coding RNAs, 5' or 3' untranslated regions (UTRs) of mRNAs, or overlapping a known coding sequence (CDS) in an alternative ORF. OpenProt is the first database that enforces a polycistronic model for eukaryotic genomes, allowing annotation of multiple ORFs per transcript. OpenProt is freely accessible and offers custom downloads of protein sequences across 10 species. Using OpenProt database for proteomic experiments enables novel proteins discovery and highlights the polycistronic nature of eukaryotic genes. The size of OpenProt database (all predicted proteins) is substantial and need be taken in account for the analysis. However, with appropriate false discovery rate (FDR) settings or the use of a restricted OpenProt database, users will gain a more realistic view of the proteomic landscape. Overall, OpenProt is a freely available tool that will foster proteomic discoveries.

OpenProt is a freely accessible database that enforces a polycistronic model of eukaryotic genomes. Here, we present a protocol for the use of OpenProt databases when interrogating mass spectrometry datasets. Using OpenProt database for analysis of proteomic experiments allows for discovery of novel and previously undetectable proteins.

질량 분석 기반 Proteomics 분석 소설 단백질을 공개할 OpenProt 데이터베이스를 사용 하 여 비 정식 열려있는 독서 프레임에서 번역

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

DNA 손상의 평가를 위한 혜성 분석에서 냉동 조직의 사용

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...