이 연구는 이탈리아 교육, 대학 및 연구부 (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003)의 유럽 연구위원회 (ERC-2010-AdG, GT-SKIN) , EPIGEN Epigenomics 대표 프로젝트), 이탈리아 보건부 (젊은 연구자는 2011 GR-2011-02352026) 및 Imagine Institute Foundation (프랑스, 파리).

1. 인간 세포의 MLV 형질 도입 <ol><li> 대상 세포를 분리하고 eGFP 리포터 유전자를 포함하고 Vesicular Stomatitis Virus G (VSV - G) 또는 amphotropic 봉투 glycoprotein 16 pseudotyped mLV 유래 레트로 바이러스 벡터로 그들을 transduce. <ol><li> 모의 변형 된 세포를 다음 분석을위한 음성 대조군으로 유지하십시오. mLV 기반의 레트로 바이러스 벡터는 효율적으로 분열하는 세포를 형질 도입 할 수 있기 때문에 세포 분열을 자극하는 조건에서 표적 세포 집단을 배양하십시오. 형질 도입 조건은 연구중인 각 세포 유형에 대해 특별히 최적화되어야합니다. 인간 조혈 전구 세포, T 세포 및 표피 세포에 대한 세포 성장 및 형질 도입 조건은 문헌 7, 14, 15 및 17에 기재되어있다. </li></ol></li><li> 48 시간 후, 2 % 태아 소 혈청을 함유 한 인산염 완충 식염수 (PBS) 300 μL에 100,000 세포를 재현하고 f에 의해 eGFP 발현을 측정한다낮은 cytometric 분석 (488 nm의 여기 레이저). 모의 - 형질 전환 된 세포를 음성 대조군으로 사용하십시오. 최적의 통합 사이트 검색을 위해 Fluorescence Activated Cell Sorting (FACS)로 GFP + 세포를 정제하십시오. </li><li> 게놈 DNA 준비를 위해 0.5 ~ 5 백만 개의 세포를 수집하십시오. 통합되지 않은 프로 바이러스를 희석하고 선천적 인 줄기 세포의 장기 자손을 분석 할 때 더 긴 배양 기간 (&gt; 7 일)이 바람직합니다 ( 토론 절 및 참조 15 참조). 세포 펠렛은 사용하기 전까지 급속 동결되고 -80 ° C에서 보관할 수 있습니다. </li></ol> 2. 링커 매개 PCR (LM - PCR)에 의한 mLV 통합 사이트의 증폭 <ol><li> 게놈 DNA (gDNA) <ol><li> 컬럼 기반의 DNA 추출 키트를 사용하여 gDNA를 추출하고 배양 세포에 대한 프로토콜을 따르십시오 (제조 업체의 지침에 따라). </li></ol></li><li> 제한 효소 digesti...에 <ol><li> 1.5 ML 튜브에서 샘플 당 4 제한 효소 소화를 설정합니다. 10 μL의 최종 부피에 1 μL의 Tru9I (10U)와 1 μL의 Buffer M을 첨가하여 각 튜브에 0.1 ~ 1 μg gDNA를 분해하십시오. 65 ° C에서 6 시간 또는 밤새 반응을 일으킨다. </li><li> 각 반응 1 μl의 PstI (10U), 1 μL의 버퍼 H와 8 μL의 물을 첨가하십시오. 37에서 반응을 6 시간 또는 밤새 품어. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 링커 라이 게이션 <ol><li> 100 μM 농도의 링커 플러스 가닥 및 링커 마이너스 스트랜드 oligonucleotides를 혼합하여 1.5 ML 튜브에 100 μM Tru9I 링커 주식 솔루션을 준비합니다. 튜브를 100 ° C로 설정된 물에 넣고 실온에서 식히십시오. Tru9I 링커 스톡 용액은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li><li> 1.5 ML 튜브에서 8 링커의 연결 반응을 설정합니다. 각 반응에 대해 다음 성분을 첨가하십시오10 μL의 10 X T4 DNA 리가 제 반응 완충액, 1 μL의 10 μM 링커 Tru9I, 1 μL (2,000 U)의 T4 DNA 리가 제 및 0.6 μL의 물. 16에서 3에서 6 시간 동안 품어 라. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 첫 번째 PCR <ol><li> 0.2 ML 튜브에서 48 PCR 반응 (각 연결 튜브에서 6 반응)를 설정합니다. 각 PCR에 대해 다음과 같은 시약을 2 μL의 연결 반응에 첨가하십시오 : 5 μL의 10X PCR 버퍼, 2 μL의 50 mM 마그네슘 설페이트, 1 μL의 10 mM deoxynucleotide (dNTP) Mix, 1 μL의 10 μM 링커 프라이머, 1 10 μM mLV-3 &#39;LTR 프라이머 μL, Taq DNA Polymerase 0.3 μL (1.5 U) 및 물 37.7 μL. 프라이머 서열은 표 1에 제시되어있다. </li><li> 다음과 같이 가열 된 뚜껑을 갖춘 열 순환 장치에서 PCR 반응을 수행하십시오 : 95 ℃에서 2 분; 15 초 동안 95 ℃, 30 초 동안 55 ℃, 1 분 동안 72 ℃의 25주기; 72 °5 분간 C; 4 ° C에서 유지. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 두 번째 PCR <ol><li> 0.2 ML 튜브에서 48 PCR 반응 (각 &quot;첫 번째 PCR&quot;튜브에서 1)를 설정합니다. 각 PCR에 대해 첫 번째 PCR 반응 2 μL에 다음 구성 요소를 추가합니다. 5 μL의 10X PCR 버퍼, 2 μL의 50 mM 마그네슘 설페이트, 1 μL의 10 mM dNTP Mix, 1 μL의 10 μM 링커 중첩 프라이머, 1 10 μM mLV-3 &#39;LTR 중첩 프라이머 μL, Taq DNA 중합 효소 (1.5 U) 0.3 μL 및 물 37.7 μL. 선택된 거대한 시퀀싱 전략을 위해 설계된 중첩 된 프라이머를 사용하십시오 : (i) 링커 중첩 프라이머 및 Illumina 플랫폼과 호환되는 mLV-3 &#39;LTR 중첩 프라이머; (ii) Roche 플랫폼과 호환되는 링커 중첩 프라이머 및 mLV-3 &#39;LTR 네 스팅 프라이머. 프라이머 서열은 표 1 에 열거되어있다. </li><li> 다음과 같이 가열 된 뚜껑을 갖춘 열 순환 장치에서 PCR 반응을 수행하십시오 : 95 ℃에서 2 분; 25 세95 ℃에서 15 초간, 58 ℃에서 30 초간, 72 ℃에서 1 분간의 사이클; 72 ℃에서 5 분; 4 ° C에서 유지. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li><li> 15 ML 튜브 (~ 2.4 ML의 최종 볼륨)에서 48 개의 중첩 PCR 반응을 풀. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 아가로 오스 겔 전기 영동으로 LM-PCR 제품의 존재 여부와 크기를 결정하십시오. <ol><li> LM-PCR 제품 20 μL에 Loading Buffer 4 μL를 넣고 샘플을 100 bp DNA 사다리와 함께 1 % 아가 로스 겔에로드하십시오. 30 ~ 60 분 동안 5 V / cm에서 겔을 실행하고 ethidium 브로마이드 얼룩에 의해 PCR 제품을 시각. </li><li> 모의 - transduced 샘플에서 부정적인 컨트롤로 LM - PCR 반응을 실행하십시오. </li></ol></li><li> 0.1 아세트산 나트륨 용액 (3 M, pH 5.2)과 2.5 부피의 100 % 에탄올을 가하여 증폭 물을 침전시킨다. -80에서 20 분 동안 혼합하고 동결시킨다. <ol><li> 푸에서 스핀표준 미세 원심 분리기에서 4 ° C에서 20 분간 속도. 상등액을 버리고 70 % 에탄올로 펠렛을 씻는다. 5 분 동안 4 ° C에서 표준 미세 원심 분리기에서 최대 속도로 스핀하십시오. </li><li> 뜨는을 버리고 펠렛을 공기 건조하십시오. PCR 급수 200 μL를 추가하고 DNA를 resuspend. 샘플은 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 100 μL의 LM-PCR 제품에 Loading Buffer 20 μL를 첨가하고 샘플을 100 bp DNA 사다리와 함께 1 % 아가 로스 겔에로드하십시오. <ol><li> 30 ~ 60 분 동안 5 V / cm에서 겔을 실행하고 150 ~ 500 BP의 긴 amplicons을 포함하는 젤의 부분을 자르십시오. </li><li> 칼럼 기반 젤 추출 키트로 LM-PCR 제품을 정제하고 UV 분광 광도계를 사용하여 농도를 측정하십시오. </li></ol></li><li> 제조사의 지침에 따라 bioanalyzer 악기를 사용하여 LM-PCR 제품의 길이를 평가하기 위해 1 μL의 라이브러리를 사용하십시오. </li><li><strong&gt; 산탄 총 복제 <ol><li> 정제 LM-PCR 제품 20 ng을 사용하고 제조 업체의 지침에 따라 pCR2.1 - TOPO 벡터에서 복제. </li><li> 최종 샘플을 확인하기 위해 클론의&gt; 50 %에서 바이러스 게놈 접합부 (mLV-3 &#39;LTR 중첩 프라이머 포함)의 존재를 밝히기 위해 결과 서열의 게놈지도 작성 후 M13 유니버셜 프라이머를 사용하여 시퀀싱 반응 수행 대규모 시퀀싱. 바이러스 - 게놈 접합의 예 : <img alt="접합" src="/files/ftp_upload/55919/55919junction.jpg" /> MLV-3 &#39;LTR 내포 프라이머 454 및 링커 내포 프라이머 454 ( 표 1 )는 굵게 표시하고 바이러스 성 LTR의 3&#39;말단은 이탤릭체로 표시 하였다. 인간 게놈 서열은 붉은 색 텍스트로 강조 표시됩니다 (chr10 : 6439408-6439509, hg19). </li></ol></li></ol> 3. mLV 통합 사이트의 대규모 시퀀싱 참고 : LM-PCR 제품상업용 플랫폼을 사용하여 서열을 분석 할 수 있습니다 (두 번째 PCR 반응에서 적절한 중첩 프라이머 쌍을 선택하십시오, 2.5.1 절 참조). Roche GS-FLX pyrosequencing 플랫폼을 이용한 시퀀싱에 대해서는 이전 논문 7 , 14 , 15를 참조하십시오. 이 섹션에서는 Illumina 시퀀싱 플랫폼에 대해 새로 최적화 된 프로토콜에 대해 설명합니다. <ol><li> 도서관 준비 <ol><li> 0.2 ML 튜브에서 샘플 당 1 색인 PCR 반응을 설정합니다. 각 PCR에 대해 5 μL (150-170 ng)의 정제 LM-PCR 제품에 다음 시약을 첨가하십시오 : 5 μL의 Index Primer 1, 5 μL의 Index Primer 2, 25 μL의 2X Master Mix 및 10 μL의 PCR- 학년 물. 각 견본마다 다른 색인 조합을 사용하십시오. </li><li> 다음과 같이 열 뚜껑이있는 열 순환 장치에서 PCR 반응을 수행하십시오 : 95 ℃에서 3 분; 95 ℃에서 30 초, 55 ℃에서 30 초, 72 ℃에서 30 초의 8 사이클; 72 ° C에서 5m에서; 4 ° C에서 유지. </li><li> 고상 가역 고정 (SPRI) 비드 격리 프로토콜을 사용하여 PCR 제품을 정화 : 새로운 1.5 ML 튜브에서 각 샘플에 비즈 56 μL를 추가하고 제조 업체의 지침에 따라 진행합니다. Tris-HCl 10 mM 25 μL로 용출시킨다. 라이브러리는 사용하기 전까지 -20 ° C에서 보관할 수 있습니다. </li></ol></li><li> 도서관 수표 <ol><li> Bioanalyzer 장비를 사용하여 라이브러리 크기를 평가하기 위해 1 μL 샘플을 사용하십시오. </li><li> 제조사의 지침에 따라 형광 기반 실시간 PCR 분석을 사용하여 라이브러리 몰 농도를 계량하기 위해 1 μL 샘플을 사용하십시오. </li></ol></li><li> 라이브러리 희석 및 시퀀싱 <ol><li> Tris-HCl 10 mM을 사용하여 10 nM까지 라이브러리를 희석하십시오. 라이브러리를 풀링하려면 각 희석 라이브러리 5 μL를 새로운 1.5 mL 튜브에 옮기고 10 mM Tris-HCl에서 4 nM으로 풀을 희석하십시오. </li><li> 희석 된 풀 5 μL와 새로운 1.5 m의 0.2 N NaOH 5 μL를 섞는다.L 튜브에 넣고 간단히 보텍스로 스핀 - 다운하고 실온에서 5 분 동안 배양하여 라이브러리를 변성시킨다. </li><li> 얼음에 튜브를 넣어 사전 냉각 하이브 리다이 제이션 버퍼 (HT1) 990 μL를 추가합니다. 새로운 1.5 ML 튜브에 300 μl의 변성 풀을 나누어 주며 미리 냉각 된 HT1 300 μL를 첨가하여 10 pM 최종 라이브러리 풀을 얻습니다. </li><li> 병렬로 PhiX 컨트롤 라이브러리 (10nM) 2 μL와 1.5 mL 튜브에 3 μL의 Tris-HCl 10 mM을 섞으십시오. NaOH 0.2 N 5 μL를 가볍게 넣고 스핀 - 다운하고 상온에서 5 분 동안 배양하여 희석 된 PhiX를 변성시킨다. 얼음에 튜브를 넣고 미리 냉장 된 HT1 990 μL를 넣으십시오. </li><li> 분분한 PhiX 300 μL를 새로운 1.5 mL 튜브에 넣고 미리 냉각 된 HT1 300 μL를 첨가하여 최종 PhiX 10 pM을 얻습니다. </li><li> 새로운 1.5 mL 튜브에서 변성 라이브러리 풀 510 μL와 변성 PhiX 라이브러리 90 μL를 혼합하여 15 % PhiX 컨트롤을 갖춘 최종 10 pM 풀을 얻습니다. </li><li> 샘플 600μL를 피펫볼륨을 해동 된 시퀀싱 시약 카트리지의로드 샘플 저장고에 넣고 즉시 단일 판독 150 사이클 실행을 수행하십시오. 참고 :이 프로토콜에 필요한 중요한 시약 및 프라이머 서열은 표 1 에 나와 있습니다. </li></ol></li></ol>

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

저자는 공개 할 것이 없습니다.

여기에서 우리는 염색질 부위를 표적으로하는 레트로 바이러스 인 mLV의 통합 사이트의 게놈 - 전체 매핑을위한 프로토콜을 설명했으며, 활성 프로모터 및 인핸서로 후생적으로 표시했습니다. 프로토콜의 중요한 단계 및 / 또는 한계는 다음을 포함합니다 : (i) 표적 세포 집단의 mLV 형질 도입; (ii) LM-PCR에 의한 바이러스 - 숙주 접합부의 증폭; (iii) 통합 사이트의 높은 비율의 검색. mLV- 기반 레트로 바이러스 벡터는 분열 세포를 효율적으로 형질 전환시킨다. 비분 할 세포 (예 : 사후 유사 분열 신경 세포)의 형질 도입 효율이 낮 으면이 기법의 잠재적 한계가됩니다. 그러나, 리포터 유전자 ( 예, eGFP)의 발현에 기초하여 형질 감염된 집단의 세포 분류를 통해 극복 될 수있다. LM-PCR (150 ~ 500 bp)에 의한 상대적으로 짧은 앰플 리콘의 생성은 현재 사용되는 방대한 시퀀싱 전략과 호환되는 앰플 리콘 라이브러리를 생성하고 포괄적 인 유전자를 허용하는 데 필수적입니다mLV 통합 사이트의 전체 분석. 예를 들어 LM-PCR 증폭 산물 (데이터는 표시되지 않음)의 샷건 복제로 평가할 때,&gt; 500 bp 길이의 LM-PCR 제품의 증폭은 부분적인 게놈 DNA 분해 또는 Tru9I 분해 된 게놈 단편의 내부 연결로 인해 발생할 수 있습니다. 첫 번째 경우에는 게놈 DNA 분해 조건을 최적화하여 문제를 해결할 수 있지만 후자의 경우 mLV 통합 사이트의 대규모 시퀀싱은 150 ~ 500 bp 사이의 앰플 리콘 겔 정제를 통해 수행 할 수 있습니다. 마지막으로 제한 효소를 사용하여 게놈 DNA를 절단하면 제한 효소 근처에있는 통합 부위를 우선적으로 증폭 및 검출 할 수 있습니다. Tru9I 제한 효소가 검색 할 수있는 통합 사이트의 비율은 ~ 50 %로 추정됩니다. 따라서,이 기술은 여러 제한 효소를 사용하거나 무작위 DNA sheari를 수행하여 통합 사이트 검색을 향상 시키도록 더욱 최적화 될 수 있습니다초음파 처리 20 , 21 . 최근에, 우리는이 백서에 설명 된대로 널리 사용되는 Illumina 플랫폼을 사용하여 바이러스 통합 사이트의 시퀀싱을 최적화했습니다. 이 시퀀싱 접근 방식은 Roche 플랫폼에 비해 실행 당 더 많은 읽기 수를 생성하여 단일 실험에서 검색된 통합 사이트의 수를 크게 증가시켜 전 세계적으로 시간과 비용을 절감합니다. 세포 특이 적 조절 영역의 게놈 - 전체 식별은 ChIP-seq 6 (효소 및 프로모터를 확인하기위한 히스톤 H3 라이신 4의 단일 및 삼중 메틸화 및 활성 및 비활성 사이의 구별을위한 H3K27ac)에 의한 1 내지 3 개의 히스톤 변형의 매핑을 필요로한다 조절 요소) 4 , 5 , 6 과 다른 세포 유형을 체계적으로 비교하여cis- 작용 요소는 결정된 세포 집단에서만 독점적으로 활동한다. 우리는 multipotent 조혈 progenitors과 그들의 헌신 erythroid 및 myeloid 자손 14 , 배아 줄기 세포, neuroepithelial 같은 줄기 세포와 차별화 keratinocytes 15 같은 전향 적으로 격리 된 표적 세포 인구에 MLV 통합 사이트를 매핑했습니다. 레트로 바이러스 스캐닝을 통해 분석 된 각 세포 집단의 세포 특이 적 조절 요소에 대한 게놈 차원의 정의가 가능 해져 비교 게놈 전반의 연구가 엄격하게 필요하지 않게되었습니다. 중요하게도,이 도구는 희귀 한 세포 집단 ( 예 : 체세포 줄기 세포)의 능동적 인 조절 요소의 식별에 사용될 수 있으며, 장래의 격리를위한 강력한 마커가 없으며 ChIP-seq 기반 히스톤 수정 분석에 의해 분석 될 수 없다. 이러한 세포 집단에서 mLV 통합은 활성 조절 영역의 영구적 인 유전 표지자이며,in vitro 및 in vivo 에서 보다 풍부한 세포 자손의 전향 적 신원 확인 . 예를 들어, 후 향적으로 확인 된 keratinocyte stem cell (KSC) 개체군에서 promoter와 enhancer의 대용 마커로 mLV integration clusters를 성공적으로 사용했습니다. 우리는 mLV 벡터를 가진 KSCs를 함유하는 포어킨 유래 각화 세포 배양 물을 초기에 통과 시켰고, 35 세포 배양액 이상을 통과시켜 KSCs의 자손을 풍부하게 만들었습니다. 통로. 이 경우, mLV 통합은 최초의 형질 전환 된 KSC 집단에서 활성화 된 조절 영역을 영구적으로 표시했다. 향후 연구는 많은 희귀 인간 줄기 세포 집단에서 게놈 차원에서 세포 특이 적 조절 요소를 규명하는 것을 목표로 할 것이다.

세포 동일성은 특정 유전자 세트의 발현에 의해 결정됩니다. 프로모터 및 인핸서와 같은 시스 조절 요소의 역할은 세포 유형 특이 적 전사 프로그램의 활성화에 결정적이다. 이러한 조절 부위는 특이적인 히스톤 변형, 전사 인자 및 보조 인자 결합, 염색질 접근성과 같은 특이적인 염색질 특징을 특징으로하는데, 이는 여러 세포 유형 1 , 2 , 3 에서 게놈 전체의 식별을 위해 널리 사용되어왔다. 특히 히스톤 H3 라이신 27 (H3K27ac)의 게놈 전체 프로파일은 활성 프로모터, 인핸서 및 슈퍼 인핸서 4 , 5 , 6 을 정의하는 데 일반적으로 사용됩니다. Moloney murine leukemia virus (MLV)는 유전자에 널리 사용되는 감마 - 레트로 바이러스입니다포유 동물 세포에서 전달. 표적 세포를 감염시킨 후 retroviral RNA genome은 pre-integration complex (PIC)를 조립하기 위해 바이러스 및 세포 단백질에 결합하는 이중 가닥의 DNA 분자에서 역전사된다. PIC는 핵을 입력하고 숙주 세포 염색질을 바인딩합니다. 여기에서 중요한 PIC 성분 인 바이러스 인테그라 아제 (viral integrase)는 프로 바이러스 DNA의 숙주 세포 게놈으로의 통합을 매개한다. 게놈 DNA에서의 mLV 통합은 무작위 적이 지 않지만 세포 특이적인 방식으로 활성 cis 조절 요소, 예를 들어 프로모터 및 인핸서에서 일어난다 7 , 8 , 9 , 10 . 이 특이 적 통합 프로파일은 mLV integrase와 세포 bromodomain 및 외쪽 끝 도메인 (BET) 단백질 11 , 12 , 13 사이의 직접적인 상호 작용에 의해 매개됩니다. BET 단백질 (BRD2, BRD3 및BRD4)는 숙주 염색질과 mLV PIC 사이의 가교 역할을한다. 브롬 도메인을 통해 고도로 아세틸 화 된 시스 조절 영역을 인식하고 외측 말단 도메인은 mLV 인테그라 아제 11 , 12 , 13 과 상호 작용한다. 여기에서, 우리는 mLV의 통합 특성에 기초하여 활성 cis- 조절 영역을 매핑하는 새로운 도구 인 레트로 바이러스 스캐닝을 기술한다. 간략하게, 세포는 강화 된 녹색 형광 단백질 (eGFP) 리포터 유전자를 발현하는 mLV 유래 레트로 바이러스 벡터로 형질 도입된다. 게놈 DNA 추출 후, mLV 벡터의 3 &#39;긴 말단 반복 (LTR)과 게놈 DNA 간의 연결 부위는 링커 매개 PCR (LM-PCR)에 의해 증폭되고 대량으로 서열 분석된다. mLV 통합 사이트는 인간 게놈에 매핑되며 mLV에 의해 표적화되는 게놈 영역은 mLV 통합 사이트의 클러스터로 정의됩니다. 레트로 바이러스 검사ning은 여러 인간의 일차 세포에서 세포 특이 적 활성 조절 요소를 정의하는 데 사용되었습니다 14 , 15 . mLV 클러스터는 후생 적으로 정의 된 프로모터 및 인핸서와 함께 매핑되었으며, 대부분은 H3K27ac과 같은 활성 히스톤 마커를 가지며 세포 특이 적이었다. 레트로 바이러스 스캐닝은 전향 적으로 정제 된 세포 집단 7,14뿐 아니라 예비 격리 15 에 효과적인 마커가없는 케라틴 틴틴 줄기 세포와 같은 후 향적으로 정의 된 세포 집단에서 DNA 조절 요소의 게놈 전체 식별을 허용합니다.

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Moloney murine leukemia (MLV) 바이러스 기반 레트로 바이러스 벡터는 주로 아세틸 화 된 인핸서와 프로모터에 통합됩니다. 이러한 이유로 mLV 통합 사이트는 능동적 인 규제 요소의 기능적 표지자로 사용될 수 있습니다. 여기에 우리는 세포 특이 적 인핸서 (enhancer)와 프로모터 (promoter)에 대한 게놈 차원의 식별을 가능하게하는 레트로 바이러스 스캐닝 도구를 제시한다. 간단히 말해, 표적 세포 집단은 mLV 유래 벡터로 형질 도입되고 게놈 DNA는 절단 제한 효소로 절단된다. 호환 DNA 링커와 게놈 조각의 연결 후, 링커 중재 폴리머 라제 연쇄 반응 (LM-PCR)은 바이러스 - 호스트 게놈 교차점의 증폭을 허용합니다. amplicons의 대규모 시퀀싱은 게놈 전체 mLV 통합 프로필을 정의하는 데 사용됩니다. 마지막으로, 반복적 통합의 클러스터는 세포 유형 특이적인 전사 프로그램의 활성화를 담당하는 세포 특이 적 조절 영역을 확인하기 위해 정의된다. 예를 들면 체세포 줄기 세포)의 회고 확인을위한 도구 기술을 대표한다.

레트로 바이러스 스캐닝 절차의 워크 플로우 레트로 바이러스 스캐닝 절차의 워크 플로가 그림 1 에 나와 있습니다. 표적 세포 집단을 정제하고 eGFP 리포터 유전자를 발현하는 mLV 유래 레트로 바이러스 벡터로 형질 감염시켰다. 형질 도입 유전자는 2 개의 동일한 긴 말단 반복 (5 &#39;및 3&#39;LTR)에 의해 둘러싸여 있으며, 합성, 역전사 및 바이러스 게놈의 숙주 DNA 내로의 통합을 보장한다. 형질 도입 효율은 eGFP 발현의 FACS 분석에 의해 평가된다. mLV - transduced 세포의 높은 비율 (&gt; 30 %)을 포함하는 세포 인구가 증폭하고 통합 mLV 바이러스 카세트를 포함하는 게놈 DNA를 추출하기 위해 lysed. 게놈 DNA를 분해하고 호환 링커로 연결하고 바이러스 3 &#39;LTR과 숙주 게놈 사이의 접합부를 LM-PCR로 증폭시킨다. Vir우리 - 호스트 게놈 접합은 Roche 또는 Illumina 플랫폼을 사용하여 대규모 시퀀싱됩니다. 마지막으로, mLV 통합 사이트는 반복적 인 삽입 사이트의 게놈 클러스터를 정의하기 위해 인간 게놈에 매핑됩니다. LM-PCR에 의한 mLV 통합 부위의 증폭 LM-PCR은도 2 에 개략적으로 도시 되어 있다 . 게놈 DNA는 mLV로 형질 도입 된 세포에서 추출되어 Tru9I 제한 효소로 소화되어 인간 게놈을 자주 절단하여 중간 길이가 70bp 인 단편을 생성합니다. 두 번째 제한 효소 (PstI)는 통합 및 통합되지 않은 내부 5 &#39;LTR 단편의 증폭을 방지하기 위해 사용됩니다. 그런 다음 Tru9I 이중 가닥 링커를 게놈 조각에 연결하고 LM-PCR을 링커에 특이적인 프라이머로 수행하고 3&#39;- LTR은 바이러스 - 숙주 게놈 접합을 증폭시킨다. 중첩 된 PCR은 pri를 사용하여 수행 할 수 있습니다.Roche 또는 Illumina 시퀀싱 플랫폼과 호환됩니다. 바이러스 - 호스트 게놈 접합 amplicons의 분석 그림 3 에 표시된 실험에서 우리는 CD34 - CD13 + myeloid progenitor / precursor (MPP)를 정제하고 eGFP 리포터 유전자를 발현하는 MLV 유래 레트로 바이러스로 이들을 형질 도입했습니다. MPP 세포의 60 % 이상이 형질 도입 후 48 시간 동안 eGFP를 발현했다 (데이터는 나타내지 않았다). 형질 도입 15 일 후, 우리는 위에서 설명한대로 세포를 채취하고, gDNA를 추출하고, 바이러스 - 숙주 게놈 접합을 증폭시켰다. 풀링 된 LM-PCR 제품의 분취 량을 1 % 아가 로스 겔에 로딩하여 앰플 리콘의 존재 및 크기를 확인 하였다. 우리는 150에서 500 bp의 다양한 크기의 LM-PCR 제품에 해당하는 DNA 얼룩을 성공적으로 시각화했습니다 ( 그림 3A ). Amplicons는 그 때이었다DNA 침전에 의해 농축시키고 1 % 아가 로즈 겔 상에 로딩 하였다. LM-PCR 제품을 겔 정제하고 bioanalyzer 시스템에서 작동시켜 예상 앰플 리콘 크기 (150 ~ 500 bp; 그림 3B )를 확인했습니다. mLV 통합을 활성 및 세포 특이 적 조절 영역으로 매핑 도 4 에보고 된 실험에서, 조혈 모 / 전구 세포 (HSPC), 적혈구 전구 세포 (EPP) 및 골수 전구 전구 세포 (MPP)를 mLV 유래 레트로 바이러스 벡터로 형질 도입 하였다. 이러한 결과는 잠재적 인 오염 / 충돌을 피하기 위해 다른 세포 유형으로부터 분리 된 시료를 처리하고 시퀀싱하여 얻은 것입니다 18 , 19 . 대량 시퀀싱에 의해 생성 된 미처리 서열 판독은 자동화 된 생물 정보학바이러스 및 링커 서열을 제거하는 파이프 라인. 그런 다음 Blat 17을 사용하여 최소한 20 bp의 고유 서열을 인간 게놈에 매핑했습니다. 첫 번째 3 개 뉴클레오타이드 내에서 일치가 시작되고, 일 의성 일치 (univocal matches) 및 최소 95 % 동일성이 요구되는 날 정렬이 필터링되었습니다. 반복적 인 mLV 적분의 클러스터는 시퀀싱 플랫폼과 호환되는 거리에서 Tru91 제한 모티프로 인간 게놈으로부터 게놈 위치를 무작위 추출하여 생성 된 무작위 게놈 서열의 데이터 세트와 통계적으로 비교하여 정의되었습니다. 제어 시퀀스는 통합 시퀀스에 사용 된 것과 동일한 매핑 및 필터링 파이프 라인을 통해 처리되어 고유 사이트의 무작위 집합을 생성합니다. mLV 클러스터를 정의하기 위해 DBSCAN 클러스터링 알고리즘 19를 적용하여 연속적인 mLV 통합 분포를 동일한 수의 무작위 사이트 분포와 비교하여 고도로 클러스터 된 통합 영역을 식별합니다. define 세포 특이 적 조절 요소 7 , 14 , 15 . 거짓 클러스터의 생성을 피하기 위해 임의 제어 데이터 세트에서 여러 추출을 수행했습니다. HSPC, EPP 및 MPP에서 각각 LM-PCR 및 pyrosequencing 32,574, 27,546 및 36,358 mLV 통합 사이트로 매핑했습니다. 재발 성 mLV 통합의 클러스터는 아세틸 화 된 인핸서 및 프로모터와 함께 매핑됩니다 ( 그림 4A ). 대부분의 mLV 표적화 조절 영역은 다음과 같은 세포 특이 적이었다 : (i) HSPC 특이 적 SPINK2 유전자의 프로모터 ( 도 4B ); (ii) 적혈구 특이적인 β- 유사 글로빈 유전자의 강력한 인핸서를 함유하는 로커스 컨트롤 영역 ( 도 4C ); (iii) MPP- 특이 적 LYZ 유전자의 상류에 위치한 인핸서 ( 도 4D ). 마지막으로, 우리는 루시퍼 라제 분석법을 사용하여EPP 및 MPP에서 추정 세포 특이 적 mLV 표적 인핸서의 서브 세트 ( 도 4E ). <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/55919/55919fig1.jpg" /> 그림 1 : 레트로 바이러스 통합 사이트 맵핑 절차의 일반적인 계획. 표적 세포는 eGFP 카세트를 함유하는 mLV- 기반 레트로 바이러스 벡터로 형질 도입된다. 형질 감염된 세포에서 얻은 게놈 DNA를 Tru9I로 분해하고 호환되는 Tru9I 이중 가닥 링커로 연결한다. mLV 통합 사이트는 중첩 된 LM-PCR에 의해 증폭되었으며 바이러스 - 숙주 게놈 접합 라이브러리는 Illumina 또는 Roche 플랫폼을 사용하여 대량 시퀀싱 될 수 있습니다. 그 결과 얻어진 독성은 반복적 인 mLV 적분의 클러스터를 정의하기 위해 인간 게놈에 매핑되었다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55919/55919fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> &lt;/ p&gt; <img alt="그림 2" class="xfigimg" src="/files/ftp_upload/55919/55919fig2.jpg" /> 도표 2 : LM-PCR에 의하여 바이러스 주인 접합점의 증폭. 통합 된 mLV 프로 바이러스를 함유 한 게놈 DNA (gDNA)를 Tru9I 및 PstI 제한 효소로 절단하고 호환 가능한 Tru9I 링커로 연결한다. 중첩 된 PCR은 LTR 및 링커에 특이적인 프라이머를 사용하여 수행한다. 바이러스 성 및 인간 게놈의 Tru9I 및 PstI 제한 사이트가 표시됩니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55919/55919fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" class="xfigimg" src="/files/ftp_upload/55919/55919fig3.jpg" /> 도표 3 : LM-PCR amplicons의 분석. ( A ) LM - PCR 제품 (레인 +)은 1 % 아가로 오스 겔에서 실행하고 시각화에티 디움 브로마이드 염색법. 템플릿이없는 샘플은 PCR 프라이머 만 시각화 된 음성 대조 샘플 (레인 -)으로 사용되었습니다. ( B ) 겔 정제 후, LM-PCR 생성물 크기를 마이크로 캐 필러 리 전기 영동으로 확인 하였다. 전기 영동 사진의 x 축과 y 축에는 시료 크기 (bp)와 형광 강도 (FU)가 각각 표시됩니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55919/55919fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" class="xfigimg" src="/files/ftp_upload/55919/55919fig4.jpg" /> 그림 4 : epigenetically 정의 된 규제 지역에 mLV 통합의 매핑. ( A ) 우리는 각각 HSPC, EPP 및 MPP에서 재발 mLV 통합 사이트의 3,498, 2,989 및 4,103 클러스터를 정의했습니다. 각 세포 집단에서 mLV cluster의 95 % 이상이 epigenetically defined enhanc과 겹쳤다ers 및 발기인. ( B , C 및 D ) 세포 특이 적 mLV 표적 부위는 고도로 아세틸 화되었으며 표적 유전자 ( SPINK2 , HBB 및 LYZ , 거의 독점적으로 각각 HSPC, EPP 및 MPP 로만 발현 됨)의 세포 특이 적 발현과 관련 이있다 유전자 발현의 모자 분석에 의해). mLV 단일 통합은 작은 막대로 표시됩니다. TPM은 백만 당 태그를 나타냅니다. ( E ) EPP 및 MPP에서 세포 특이 적 mLV 표적 증강 인자를 추정한다. 그림 4는 참조 번호 14 에서 채택되었습니다. Google은 크리에이티브 커먼즈 라이선스에 따라이 수치를 다시 사용할 수있는 권한을 받았습니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55919/55919fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

여기, 우리는 인간 세포에서 Moloney 뮤린 백혈병 바이러스 기반의 레트로 바이러스 벡터의 통합 사이트의 게놈 전체 매핑을위한 프로토콜을 설명합니다.

레트로 바이러스 스캐닝 : MLV 통합 사이트 맵핑으로 세포 특정 규제 지역 정의

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

retroviral-scanning-mapping-mlv-integration-sites-to-define-cell

Nanyang Technological University

Research

JoVE Journal

Genetics

8.3K 조회수.  University of Modena and Reggio Emilia.  여기, 우리는 인간 세포에서 Moloney 뮤린 백혈병 바이러스 기반의 레트로 바이러스 벡터의 통합 사이트의 게놈 전체 매핑을위한 프로토콜을 설명합니다. 

비디오: Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

약물 저항 유전자를 확인하기위한 QTL 매핑 및 CRISPR / Cas9 편집<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

연구

유전학

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.

Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Biotinylated Psoralen을 사용하여 RNA-RNA 상호 작용을 세계적으로 매핑

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

양방향 레트로 바이러스 통합 사이트 PCR 방법론 및 정량적 데이터 분석 워크 플로

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

CRISPR/Cas9-중재 대상된 통합에서 Vivo에서 Homology 중재 끝에 합류 기반 전략을 사용 하 여

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly defined states of chromatin organization. The dynamic architecture of the nucleus is controlled by multiple mechanisms and shapes the transcriptional output programs. It is, therefore, important to determine locus-specific chromatin accessibility in a reliable fashion that is preferably independent from antibodies, which can be a potentially confounding source of experimental variability. Chromatin accessibility can be measured by various methods, including the Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE) assay, that allow the determination of general chromatin accessibility in a relatively low number of cells. Here we describe a FAIRE protocol that allows simple, reliable, and fast identification of genomic regions with a low protein occupancy. In this method, the DNA is covalently bound to the chromatin proteins using formaldehyde as a crosslinking agent and sheared to small pieces. The free DNA is afterwards enriched using phenol:chloroform extraction. The ratio of free DNA is determined by quantitative polymerase chain reaction (qPCR) or DNA sequencing (DNA-seq) compared to a control sample representing total DNA. The regions with a looser chromatin structure are enriched in the free DNA sample, thus allowing the identification of genomic regions with lower chromatin compaction.

The plasticity of nuclear architecture is controlled by dynamic epigenetic mechanisms including non-coding RNAs, DNA methylation, nucleosome repositioning as well as histone composition and modification. Here we describe a Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE) protocol which allows the determination of chromatin accessibility in a reproducible, inexpensive, and straightforward manner.

포유류 세포에 측정 Chromatin 접근 규제 요소의 포 름 알 데히드 기반 격리

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly being extended to integrative studies to enhance the understanding of molecular dynamics within cells. Current tools for the visualization and integration of proteomics with other omics datasets are inadequate for large-scale studies. Furthermore, they only capture basic sequence identify, discarding post-translational modifications and quantitation. To address these issues, we developed PoGo to map peptides with associated post-translational modifications and quantification to reference genome annotation. In addition, the tool was developed to enable the mapping of peptides identified from customized sequence databases incorporating single amino acid variants. While PoGo is a command line tool, the graphical interface PoGoGUI enables non-bioinformatics researchers to easily map peptides to 25 species supported by Ensembl genome annotation. The generated output borrows file formats from the genomics field and, therefore, visualization is supported in most genome browsers. For large-scale studies, PoGo is supported by TrackHubGenerator to create web-accessible repositories of data mapped to genomes that also enable an easy sharing of proteogenomics data. With little effort, this tool can map millions of peptides to reference genomes within only a few minutes, outperforming other available sequence-identity based tools. This protocol demonstrates the best approaches for proteogenomics mapping through PoGo with publicly available datasets of quantitative and phosphoproteomics, as well as large-scale studies.

Here we present the proteogenomic tool PoGo and protocols for fast, quantitative, post-translational modification and variant enabled mapping of peptides identified through mass spectrometry onto reference genomes. This tool is of use to integrate and visualize proteogenomic and personal proteomic studies interfacing with orthogonal genomics data.

포스트 번역 상 수정 및 변형에 대 한 신속 하 고 양적 방법 사용의 펩 티 드 유전자에 매핑

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Phosphorothioates를 사용 하 여 RNA에서 사이트 바인딩 규제 단백질의 소설 포화 Mutagenesis 접근: 단일 단계 특성

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

하나의 물방울 디지털 연쇄 반응 핫스팟 지역에서 돌연변이의 포괄적이 고 동시 검색

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational steps are used to regulate specific genes. Sequence-specific nucleic acid-binding proteins target specific sequences to control spatial or temporal gene expression. The binding sites in nucleic acids are typically characterized by mutational analysis. However, numerous proteins of interest have no known binding site for such characterization. Here we describe an approach to identify previously unknown binding sites for RNA-binding proteins. It involves iterative selection and amplification of sequences starting with a randomized sequence pool. Following several rounds of these steps-transcription, binding, and amplification-the enriched sequences are sequenced to identify a preferred binding site(s). Success of this approach is monitored using in vitro binding assays. Subsequently, in vitro and in vivo functional assays can be used to assess the biological relevance of the selected sequences. This approach allows identification and characterization of a previously unknown binding site(s) for any RNA-binding protein for which an assay to separate protein-bound and unbound RNAs exists.

Sequence specificity is critical for gene regulation. Regulatory proteins that recognize specific sequences are important for gene regulation. Defining functional binding sites for such proteins is a challenging biological problem. An iterative approach for identification of a binding site for an RNA-binding protein is described here and is applicable to all RNA-binding proteins.

규제 RNA 결합 단백질에 대한 결합 부위를 식별하기 위한 서열 공간 탐색

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). Accurate detection of TSSs enhances identification and discovery of core promoters. In addition, active enhancers can be detected through signatures of bidirectional transcription initiation. Described here is a protocol for performing super-low input carrier-CAGE (SLIC-CAGE). This SLIC adaptation of the CAGE protocol minimizes RNA losses by artificially increasing the RNA amount through use of an in vitro transcribed RNA carrier mix that is added to the sample of interest, thus enabling library preparation from nanogram-amounts of total RNA (i.e., thousands of cells). The carrier mimics the expected DNA library fragment length distribution, thereby eliminating biases that could be caused by the abundance of a homogenous carrier. In the last stages of the protocol, the carrier is removed through degradation with homing endonucleases and the target library is amplified. The target sample library is protected from degradation, as the homing endonuclease recognition sites are long (between 18 and 27 bp), making the probability of their existence in the eukaryotic genomes very low. The end result is a DNA library ready for next-generation sequencing. All steps in the protocol, up to sequencing, can be completed within 6 days. The carrier preparation requires a full working day; however, it can be prepared in large quantities and kept frozen at -80 &#176;C. Once sequenced, the reads can be processed to obtain genome-wide single-nucleotide resolution TSSs. TSSs can be used for core promoter or enhancer discovery, providing insight into gene regulation. Once aggregated to promoters, the data can also be used for 5&#8217;-centric expression profiling.

Cap Analysis of Gene Expression (CAGE) is a method for genome-wide quantitative mapping of mRNA 5&#8217;ends to capture RNA polymerase II transcription start sites at a single-nucleotide resolution. This work describes a low-input (SLIC-CAGE) protocol for generation of high-quality libraries using nanogram-amounts of total RNA.

초저입력 캐리어-CAGE를 사용한 전사 시작 사이트 매핑

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...