우리는 원고를 읽는 데있어서 Christopher Hindley에게 감사드립니다. AM은 Wntsapp (Marie Curie ITN), AA-R에서 지원됩니다. Medical Research Council (MRC) 및 BK.K가 지원합니다. 와 RM은 Wellcome Trust와 Royal Society [101241 / Z / 13 / Z]의 Sir Henry Dale Fellowship의 지원을받으며 Wellcome Trust와 MRC의 Wellcome Trust - MRC Cambridge Stem Cell Institute .

<html> 1. CRISPR-concatemer 벡터를위한 gRNA 디자인 참고 :이 섹션의 목적은 최상의 표적 전략을 선택하는 방법과 CRISPR-concatemer 벡터에 특정 돌출부가 포함 된 gRNA를 설계하는 방법을 설명하는 것입니다. <ol><li> 선택한 CRISPR gRNA 디자인 도구를 사용하여 관심 유전자에 대한 gRNA를 설계하십시오. 예제는 표를 참조하십시오. 참고 : 한 쌍의 평행 유전자를 표적으로 할 때 유전자 당 하나의 gRNA를 디자인 할 수는 있지만 유전자 당 2 개의 gRNA를 설계하여 이중 녹아웃을 달성 할 가능성을 높여야합니다 ( 그림 1 ). </li><li> gRNAs이 제한 매핑 도구 (예를 들어 재료의 표 참조)을 사용하여 BBS I 인식 부위를 포함하지 않는 확인하십시오. </li><li> 표 1 과 같이 각 oligo에 특정 CRISPR-concatemer 벡터 돌출부를 추가합니다. </li></ol>&quot;fo : keep-together.within-page =&quot;1 &quot;fo : keep-with-next.within-page =&quot;always &quot;&gt; <tbody><tr><td></td><td> 카세트 1 </td><td> 카세트 2 </td><td> 카세트 3 </td><td> 카세트 4 </td></tr><tr><td> 서열 (5&#39;-3 &#39;) </td><td> CACCGG [gRNA1] GT </td><td> ACCGG [gRNA2] G </td><td> CCGG [gRNA3] </td><td> ACACCGG [gRNA4] GTT </td></tr><tr><td> 서열 (5&#39;-3 &#39;) </td><td> TAAAAC [RC-gRNA1] CC </td><td> AAAAC [RC-gRNA2] C </td><td> AAAC [RC-gRNA3] </td><td> CTAAAAC [RC-gRNA4] CCG </td></tr></tbody></table> 표 1 : CRISPR-concatemer 벡터의 각 카세트에 대한 오버행. 2. CRISPR-concatemer 벡터에 gRNA의 클로닝 <ol><li> 올리고의 인산화 및 어닐링 참고 :이 단계는 어떻게 to 각 gRNA 올리고에 대해 상단 및 하단 가닥을 어닐링하고 단일 반응으로 말단을 인산화시키는 방법. <ol><li> 아래 지침에 따라 올리고를 인산화시키고 상 및 하부 가닥을 어닐링하기위한 반응 혼합물을 준비하십시오. 참고 : 모든 올리고는 하나의 반응으로 모아 둘 수 있습니다. 예를 들어, 4 gRNA- 연결자 벡터의 경우, 8 개의 올리고 (oligos)를 함께 모으십시오. </li><li> 3 concatemers 들어, 3.0 μL gRNA 상단 가닥 (각 gRNA에서 10 μM, 1 μL / gRNA 1.0 μL), 3.0 μL gRNA 하단 가닥 (각 gRNA에서 1.0 μL, 10 μM, 1 μL / gRNA), 2.0 μL T4 DNA 리가 아제 완충액 (10 배), T4 PNK 1.0 μL, 20.0 μL의 총 부피까지 H 2 O에 추가. </li><li> pipetting하여 잘 혼합하고 다음 설정을 사용하여 thermocycler에서 이것을 실행하십시오 : 37 ° C 30 분, 95 ° C 5 분, 25 ° C에서 0.3 ° C / min으로 낮추십시오. 4 ° C. </li></ol></li><li> Bbs 나는 반응을 뒤섞었다. 참고 :이 섹션에서 사전 어닐링 된 gRNA 올리고는 소화 및 연결의주기를 번갈아 가며 한 단계로 연결 벡터의 적절한 위치에 통합됩니다. <ol><li> 반응 혼합물을 DNase / RNase가없는 물에서 1 : 100으로 희석하여 3 및 4 gRNA- 연결자 벡터를 생성한다. 참고 : 2 gRNA-concatemers를 복제 할 때이 단계가 필요 하지 않습니다. </li><li> 아래 지침에 따라 Bbs I 반응을 얼음 위에서 섞는다 . 벡터 만 포함하는 부정적인 컨트롤을 포함시킵니다. </li><li> 100 ng CRISPR- concatemer 벡터, 10.0 μL oligo 혼합물, 1.0 μL BSA 함유 제한 효소 버퍼 (10X), 1.0 μL DTT (10 MM), 1.0 μL ATP (10 MM), 1.0 μL BBS I, 1.0 μL T7 리가 제 20.0 μL 총량 이하, 및 H 2 O. </li><li> pipetting하여 잘 섞어 다음과 같은 설정을 사용 thermocycler에서 이것을 실행 : 3과 4 gRNA - concatemers를 복제하기 위해 50 사이클 을 실행하고 <strong&gt; 5 분, 5 분, 21 ° C, 37 ° C에서 2 gRNA-concatemers, 모두 25 사이클, 15 분 동안 37 ℃에서 유지 한 후 39 ° 영원히 하였다. </li></ol></li><li> 엑소 뉴 클레아 제 처리 참고 :이 단계는 선형화 된 DNA의 흔적을 제거하여 복제 효율성을 높이므로 권장됩니다. <ol><li> Bbs I 반응을 다음과 같이 DNA exonuclease ( 물질 표 참조)로 처리하십시오. </li><li> 이전 단계 (2.2.3)에서 11.0 μL 연결 믹스를 취하고 1.5 μL 엑소 뉴 클레아 어 완충액 (10X), 1.5 μL ATP (10 MM), 1.0 μL DNA 엑소 뉴 클레아 제를 첨가하고 총 부피를 물로 15.0 μL로 증가시킵니다. 30 분 동안 70 ° C로 30 분 동안 37 ° C에서 품어 낸다. 참고 :이 단계는 혼합물에 잔류하는 선형화 된 DNA를 제거하므로 복제 효율이 높아집니다. </li><li> 2 μL의 반응 혼합물을 사용하여 화학적으로 변성시킨다.열충격에 의한 텐트 E. 대장균 12 . 참고 : 또는 반응은 -20 ° C에서 최대 1 주일 동안 보관할 수 있습니다. </li></ol></li><li> 제한 소화 참고 :이 단계의 목적은 제한 효소 절단으로 클로닝 절차의 성공 여부를 평가하는 것입니다. <ol><li> CRISPR - concatemer 벡터에 gRNA 삽입의 존재를 확인하기 위해 접종 루프와 4 - 8 박테리아 식민지를 선택하고, 궤도 진탕 전자에서 37 ° C 밤새 4 ML LB 매체의 각 클론을 성장. 제조 업체의 지침에 따라 플라스미드 miniprep 키트를 사용하여 DNA를 추출합니다 ( 재료 표 참조). </li><li> 박테리아 배양기에서 3 시간 동안 37 ° C에서 배양하여 10 μL 반응에서 10 U EcoR I + 5 U Bgl II로 DNA 200 ng을 소화합니다. 크기 비교를위한 양성 대조군으로서 상응하는 원 벡터와 별도의 반응 혼합물을 포함시킨다. 참고 : Thi이 두 가지 제한 효소가 전체 concatemers를 소비하기 때문에 모든 concatemers가 있는지 여부를 확인합니다. 각 concatemer의 예상 크기는 2 gRNA concatemer (800 bp), 3 gRNA concatemer (1.2 kbp) 및 4 gRNA concatemer (1.6 kbp)입니다. </li><li> 90 %에서 약 20 분 1 % 아가로 오스 겔에서 소화 반응을 실행합니다. </li><li> UV Transilluminator를 사용하여 젤을 시각화하십시오. 밴드 패턴이 원래 벡터 중 하나와 일치하고 각 조각이 DNA 사다리를 사용하여 예상되는 크기를 갖도록하여 삽입 크기가 올바른 클론을 식별합니다. </li><li> 선택한 클론을 5 U Bbs I로 37 ℃에서 3 시간 동안 박테리아 배양기에서 소화시킵니다. 해당 원래 벡터와 별도의 반응 믹스를 컨트롤로 포함시킵니다. 참고 :이 추가 분해 단계는 gRNA가 올바른 위치에 클로닝되어 결과적으로 모든 Bbs I 인식 사이트가 손실되었음을 확인하는 것입니다. </li><li> 에 소화 반응을 실행하십시오.약 20 분 동안 90V에서 1 % 아가 로즈 겔. 그들은 단지 gRNAs을 포함하기 BBS I에 의해 절단되지 않는 등 올바른만을 벡터를 고려하십시오. </li></ol></li><li> 벡터 시퀀싱 참고 :이 단계의 목적은 제한 효소 분석으로 올바른 것으로 확인 된 벡터에서 gRNA 염기 서열의 존재를 확인하는 것입니다. <ol><li> 다음 프라이머를 사용하여 Sanger sequencing 13에 의해 양성 concatemer vector를 확인하십시오 : 앞으로 : TCAAGCCCTTTGTACACCCTAAG (첫 번째 gRNA 카세트 확인) Linker1_Forward : GACTACAAGGACGACGATGACAA (두 번째 gRNA 카세트 확인 용) Linker2_Reverse : GGCGTAGTCGGGCACGTCGTAGGGGT (두 번째 gRNA 카세트 확인 용) Linker2_Forward : ACCCCTACGACGTGCCCGACTACGCC (세 번째 gRNA 카세트 확인 용) Linker3_Reverse : TCCTCCTCTGAGATCAGCTTCTGCAT (세 번째 gRNA 카세트 확인 용) Reverse : AGGTGGCGCGAAGGGGCCACCAAAG (마지막 gRNA 검사 용)카세트) </li><li> sequencing reading에서 서열을 검색하여 모든 gRNA의 존재를 확인하십시오. </li></ol></li></ol> 3. 일렉트로 포 레이션에 의한 장관 Organoids의 Transfection 참고 :이 절차는 Fujii 등이 게시 한 프로토콜을 기반으로합니다. 2015 년에 마우스 소장 조직 세포 배양에 적응 14 . <ol><li> 사전 전기 천공 법 참고 :이 섹션에서는 모든 항생제와 컨디셔닝 된 배지를 배양 배지에서 제거하여 전기 천공하기 전에 마우스의 장관 유기체를 준비하는 방법을 설명합니다. 이것은 electroporation 동안 가능한 독성 효과를 방지합니다. <ol><li> 형질 감염 과정의 0 일째에, 1 : 2의 비율로 유기체를 분리한다. 참고 : 장 organoid 문화는 이전에 설립 프로토콜 15 에 따라 암호 격리를 수행하여 얻을 수 있습니다. 참고로 <st모든 미디어 구성에 대해 표 2. <ol><li> electroporation에 대한 organoids을 분할하면, transfection 당 48 웰 플레이트의 최소한 6 우물을 씨앗. </li><li> 20 μL 지하실 행렬 떨어진다 organoids를 시드 및 37 ° C에서 WENR + 닉 매체 (의 Wnt + EGF + 소량 + R-spondin + 니코틴)에서 그들을 성장, 가습 인큐베이터에서 5 % CO 2 (같이 이전 15 기재) . </li></ol></li><li> 2 일째, WENR + Nic을 항생제가없는 EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3 억제제) + Y-27632 (ROCK 억제제) 250 μL로 교체하여 배지를 교환하십시오 ( 표 2 참조). 참고 : 모든 단계에서 48 웰 플레이트의 각 웰에 첨가되는 배지의 양은 250 μL입니다. </li><li> 3 일째, 항생제가없는 유기물 배지를 EN + CHIR99021 + Y-27632 + 1.25 % v / v 디메틸 술폭 사이드 (DMSO)로 바꾼다. </li></ol></li><li> 세포의 준비 노트:여기서 우리는 기계적 및 화학적 해리에 의해 유기체를 작은 세포 클러스터로 파쇄하는 방법을 설명합니다. 이러한 단계는 절차의 성공에 중요합니다. <ol><li> 4 일째, 1 ML 피펫 팁 및 1.5 mL 튜브에 organoids를 전송을 사용하여 지하 매트릭스 돔을 방해. 48- 웰 플레이트의 4 개 웰의 내용물을 튜브에 넣습니다. </li><li> P200 피펫으로 위 아래로 약 200 회 피펫 팅하여 유기체를 기계적으로 작은 조각으로 나눕니다. 실온에서 원심 분리기, 600 x g에서 5 분. </li><li> 배지를 제거하고 세포 배양 등급 재조합 프로 테아 제 1 mL의 펠렛을 재현 탁하십시오 (물질 표 참조). 최대 5 분 37 ° C에서 품어 다음 4X 목적으로 거꾸로 빛의 현미경에서 샘플의 50 - μL 드롭을 확인하십시오. 참고 : electroporation 후 셀 생존을 증가 10-15 세포의 클러스터가 바람직합니다. </li><li> 세포 현탁액을 낮은 바인딩 15 ML 튜브에 전송하고 중지항생제가없는 기초 배지 9 mL를 첨가하여 해리시켰다 ( 표 2 참조). 실온에서 600xg로 5 분간 원심 분리 한 후 상층 액을 버리고 환원 된 혈청 배지 ( 표 2 참조) 1 mL에 펠렛을 재현 탁한다. </li><li> Bürker의 챔버로 세포 수를 세고 electroporation 반응 당 최소 1 x 10 5 세포를 사용하십시오. 9 mL의 환원 된 혈청 배지를 15 mL 튜브에 넣고 실온에서 400 x g에서 3 분간 원심 분리한다. </li></ol></li><li> 일렉트로 포 레이션 참고 : 다음 섹션에서는 electroporation을 수행하고 이후 organoid를 복구하는 방법에 대한 지침을 제공합니다. <ol><li> 뜨는 모든 것을 제거하고 electroporation 솔루션 ( 재료의 테이블을 참조)에서 펠렛을 resuspend. 세포 현탁액에 10 μg DNA 총 금액을 추가하고 100 μL의 최종 볼륨 electroporation 솔루션을 추가하고 세포 DN을 유지얼음 혼합물. Cas9 발현 플라스미드 ( 예 : Addgene # 41815)와 CRISPR- concatamer 벡터를 1 : 1 비율로 사용하십시오. 참고 : 첨가 된 DNA의 총 부피는 총 반응 부피의 10 % 이하 여야합니다. </li><li> 형질 감염 효율 ( 예 : pCMV - GFP, Addgene # 11153, 또는 일반 GFP - 표현 플라스미드)을 평가하기 위해 GFP 플라스미드를 포함하는 별도의 트랜 스펙 션 믹스를 포함하십시오. </li><li> 세포 - DNA 혼합물을 electroporation 큐벳에 추가하고 electroporator 챔버에 놓으십시오. 일렉트로 포터에있는 해당 버튼을 눌러 임피던스를 측정하고 0.030-0.055 Ω인지 확인하십시오. 표 3 에 나와 있는 설정에 따라 electroporation을 수행하십시오. 참고 : 임피던스 값이 허용 범위를 벗어나는 경우 큐벳의 용액 부피를 조정하십시오. </li><li> 큐벳에 electroporation 버퍼 + Y - 27632 400 μL를 추가하고 모든 1.5 ML 튜브로 전송할 수 있습니다. Incubate를 실온에서 30 분간 처리하여 세포가 회복되도록 한 다음 실온에서 400 x g에서 3 분간 그들을 회전시킨다. </li><li> 뜨는을 제거하고 지하 매트릭스 20 μL / 잘에서 펠렛을 resuspend. 48 웰 플레이트에 웰 당 약 1 x 10 4 내지 1 x 10 5 세포를 접종하고 EN + CHIR99021 + Y-27632 + 1.25 % v / v DMSO 배지를 첨가한다. 37 ° C에서 배양하십시오. </li><li> 5 일째, 매체를 EN + CHIR99021 + Y-27632로 변경하고 GFP 발현을 관찰하여 형질 감염 효율을 확인하십시오 ( 그림 2 ). 유기체를 37 ° C에 유지하고 2 일 후에 EN + CHIR99021 + Y-27632 배지를 새로 고칠 것. </li><li> 9 일에, 매체를 WENR + Nic + Y-27632로 바꾸고 37 ° C에서 배양하십시오. 참고 : Y-27632는 7-10 일 후 (16-19 일)에 제거 할 수 있습니다. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td></td><td> 펄스 맥박 </strong&gt; </td><td> 전송 펄스 </td></tr><tr><td> 전압 </td><td> 175V </td><td> 20V </td></tr><tr><td> 펄스 길이 </td><td> 5 밀리 초 </td><td> 50msec </td></tr><tr><td> 맥박 간격 </td><td> 50msec </td><td> 50msec </td></tr><tr><td> 펄스 수 </td><td> 2 </td><td> 5 </td></tr><tr><td> 감쇠율 </td><td> 10 % </td><td> 40 % </td></tr><tr><td> 극성 </td><td> + </td><td> +/- </td></tr></tbody></table> 표 3 : 일렉트로 포 레이션 설정. 4. 성장 인자 철수 주 : 여기에서는 장 기관에서 Wnt 경로의 음성 조절 인자를 녹아웃시킬 때 성장 인자 회수 실험을 수행하는 방법을 예시한다. <ol><li> 10-14 일 후에r electroporation은 위에서 언급 한 단계 (3.2.1 - 3.2.2)에 따라 48 - 웰 플레이트에서 1 : 3 비율로 organoids를 분할. </li><li> 기저막 매트릭스의 20 μL에 organoid 펠렛을 Resuspend하고 10 분 동안 37 ° C에서 응고시키다. 다음에, 성장 인자를 박탈 매체 오버레이 250 μL (예를 들어 EN)는 표적 유전자의 녹아웃 5 달성되었는지의 여부를 테스트한다. </li><li> 야생형 야생형 (WT) 조절 유기체와 돌연변이 체 유기체 사이의 생존 차이를보기 위해 최소 2 ~ 3 계대의 성장 인자가 박탈 된 조건에서 유기체를 분리하십시오 5 , 15 . 참고 : wildtype organoid는 2 계대 이상의 성장 인자가 결핍 된 배지에서 살아남아서는 안되며 돌연변이 체는 자랄 수 있어야합니다. </li></ol>

<ol>
	<li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Human+Genome+Engineering+via+Cas9.">RNA-Guided Human Genome Engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Koike-Yusa, H., Li, Y., Tan, E. -. P., Velasco-Herrera, M. D. C., Yusa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+recessive+genetic+screening+in+mammalian+cells+with+a+lentiviral+CRISPR-guide+RNA+library.">Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.</a> Nat Biotech. 32 (3), 267-273 (2014).</li><li>Bassett, A. R., Kong, L., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Genome-Wide+CRISPR+Library+for+High-Throughput+Genetic+Screening+in+Drosophila+Cells.">A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells.</a> J Genet Genomics. 42 (6), 301-309 (2015).</li><li>Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+paralogous+compensation+and+the+robustness+of+cellular+networks.">Molecular mechanisms of paralogous compensation and the robustness of cellular networks.</a> J Exp Zool B Mol Dev Evol. 322 (7), 488-499 (2014).</li><li>Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+paralogue+knockout+using+a+CRISPR-concatemer+in+mouse+small+intestinal+organoids.">Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids.</a> Dev Biol. 420 (2), 1-7 (2016).</li><li>Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Golden+gate+shuffling:+A+one-pot+DNA+shuffling+method+based+on+type+IIs+restriction+enzymes.">Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes.</a> PLoS ONE. 4 (5), (2009).</li><li>Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+in+human+cells+using+all-in-one+CRISPR/Cas9+vector+system.">Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system.</a> Sci Rep. 4 (5), 5400 (2014).</li><li>Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+CRISPR/Cas9-based+genome+engineering+from+a+single+lentiviral+vector.">Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector.</a> Nucleic Acids Res. 42 (19), 1-11 (2014).</li><li>Yin, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+Conditional+Mutagenesis+Using+Transgenic+Expression+of+Cas9+and+sgRNAs.">Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.</a> Genetics. 200 (2), 431-441 (2015).</li><li>Cress, B. F., Toparlak, O. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPathBrick:+Modular+Combinatorial+Assembly+of+Type+II-A+CRISPR+Arrays+for+dCas9-Mediated+Multiplex+Transcriptional+Repression+in+E.+coli.">CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli.</a> ACS Synth Biol. 4 (9), 987-1000 (2015).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> J Vis Exp. (6), e253 (2007).</li><li>Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+Sanger+dideoxy+sequencing+reaction+protocol.">Automated Sanger dideoxy sequencing reaction protocol.</a> FEBS Letters. 233 (2), 432-436 (1988).</li><li>Fujii, M., Matano, M., Nanki, K., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genetic+engineering+of+human+intestinal+organoids+using+electroporation.">Efficient genetic engineering of human intestinal organoids using electroporation.</a> Nat. Protoc. 10 (10), 1474-1485 (2015).</li><li>Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+video+protocol+of+retroviral+infection+in+primary+intestinal+organoid+culture.">A video protocol of retroviral infection in primary intestinal organoid culture.</a> J Vis Exp. (90), e51765 (2014).</li></ol>

저자는 공개 할 것이 없습니다. 저자는 아무런 이해 상충이 없다고 선언했다.

이 프로토콜에서 우리는 여러 유전자를 동시에 녹이기 위해 CRISPR-concatemers를 생성하고 마우스 장 organoids에 CRISPR-concatemer를 적용하는 데 필요한 모든 단계를 상세히 설명합니다. 이전에 언급했듯이이 전략에는 속도, 효율성 및 비용 효율성과 같은 몇 가지 이점이 있습니다. 전체 절차를 성공적으로 수행하려면 몇 가지 중요한 측면을 고려해야합니다. 그들은 그 자체로 매우 효율적이라고 반응을 복제 게시판 I의 출발 물질을 대표로 첫째, 모든 gRNA 올리고 제대로 어닐링하는 것이 중요하고 인산화이다. 둘째로, organoids를 일렉트로 포 레이션 할 때 조건 당 사용되는 세포가 많을수록 가능한 최대 transfection 효율이 높아집니다. 또한 세포 해리 후에 작은 세포 클러스터가 단일 세포보다 우세하다는 것도 중요합니다. 그럼에도 불구하고 기술적 인 문제가 발생할 수 있습니다.처음으로 복제 또는 형질 감염을 시도 할 때 림; gRNA 복제 중 문제가 발생할 경우 gRNA 올리고 서열을 다시 확인하고, 올바른 경우 제한 효소 선별 검사를 위해 추가 박테리아 콜로니를 선택하는 것이 좋습니다. transfection 효율과 세포 생존력이 electroporation 후 낮은 경우, 조건 당 더 많은 세포를 사용하여 프로토콜을 반복하고 세포 해리 시간을 3 분으로 줄이는 것이 좋습니다. CRISPR-concatemer의 생성은 상대적으로 저렴하고 용이하지만 유기체 배양과 관련된 비용과 노동 집약적 인 특성에 의해 규모가 제한되기 때문에 유기체에서 더 큰 규모의 유전자 스크린을 수행하는 것은 불가능하다. 이 경우에 CRISPR- 연결자 방법이 또한 HEK293 및 마우스 배아 줄기 세포와 같은 세포주와 양립 할 수 있음을 언급 할 필요가있다. 셀룰러 시스템에 관계없이, 이것의 또 다른 잠재적 단점3 개 또는 4 개의 다른 유전자를 동시에 녹아웃시키는 것을 목표로 할 때 trategy가 발생할 수 있습니다. 예를 들어, 각 gRNA는 다른 표적화 효율을 가지며 동시에 모든 유전자를 공격하는 변화는 상대적으로 낮을 수 있습니다. 이런 이유로, concatemer 시스템을 사용하여 동일한 유전자에 대해 하나 이상의 gRNA를 지시하는 것이 좋습니다. 유사 골든 게이트 셔플에 따라 대체 전략, 8은 멀티 플렉스 gRNA 벡터 (7)를 생성하기 위해 수년에 걸쳐 제안되었다. 그러나 우리의 방법에서 단일 복제 라운드에서 여러개의 gRNA를 하나의 레트로 바이러스 벡터로 직접 조립하는 것이 가능합니다.이 방법은 패러 로그를 표적으로하는 gRNA 라이브러리를 생성하는 데 적합합니다. 우리의 CRISPR-concatemer는 MSCV retroviral vector 백본에 내장되어 있습니다. 따라서, gRNA concatemer- 함유 레트로 바이러스는 과발현하는 안정한 세포주를 생성하는데 사용될 수있다gRNA를 ress. Cas9 - 유도 성 시스템과 결합하면, 우리 시스템을 사용하여 유도 성 paralogue 녹아웃을 수행 할 수 있습니다. 요약하면, 우리는 하나의 단계에서 동일한 벡터에 최대 4 개의 다른 gRNA를 복제하는 방법과 높은 transfection 효율로 organoid culture에이 전략을 적용하는 방법을 설명합니다. 또한, 우리는 전체 절차를 통해 성공의 기회를 극대화 할 수있는 유용한 제안을 제공합니다.

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/55916/a-protocol-for-multiple-gene-knockout-mouse-small-intestinal">A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer</a>. There was a typo in step 3.3 of the Protocol.

Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

역 유전학 접근법은 유전자의 기능을 조사하기 위해 널리 사용되는 방법입니다. 특히, 유전자의 파괴가 표현형 변화를 야기하는 기능 상실 연구 (Loss of Functional studies)는 생물학적 과정에 대한 우리의 이해를 구축하는 데 중요한 역할을한다. CRISPR / Cas9 방법은 게놈 공학 기술에서 가장 최근의 진보를 대표하며 세포 및 유기체에서 유전학의 현재 관행을 혁명적으로 변화 시켰습니다. Cas9는 gRNA와 상보적인 특정 DNA 서열에 결합하고 이중 가닥 줄기 (double-strand break, DSB)를 생성하는 RNA 유도 엔도 뉴 클레아 제입니다. 이 DSB는 상 동성 재조합을위한 DNA 주형의 부재하에 절단 된 DNA 가닥을 오류가 발생하기 쉬운 비 동종 말단 연결을 통해 재 연결시켜 뉴클레오타이드의 삽입 또는 결실을 초래할 수있는 DNA 수리 기계를 채용한다 frameshift 돌연변이 유발 1 . CRISPR / Cas9 appr의 위력과 다양성oach는 알려지지 않은 유전자 기능을 해독하기위한 게놈 스케일 녹아웃 스크린을위한 매우 매력적인 도구로 만들었습니다 2 , 3 . 그럼에도 불구하고 중복 기능이있는 여러 개의 패러 로그가 존재하는 경우 단일 유전자 녹아웃 접근법이 제한적으로 사용됩니다. 따라서, 단일 유전자를 제거하면 변이에 의한 보상이 주어지면 그 유전자의 기능을 결정하기에는 충분하지 않을 수 있으며, 표현형의 변화가 거의 없거나 전혀 없습니다 4 . 따라서 유전자 보상의 영향을 극복하기 위해 여러 가지 paralogous 유전자를 표적으로하는 여러 gRNA 벡터를 전달함으로써 paralogue를 병렬로 노크하는 것이 중요합니다. CRISPR / Cas9를 paralogous gene knockout으로 확장하기 위해, 우리는 최근에 최대 4 개의 pre-annealed gRNA를 하나의 레트로 바이러스 벡터로 복제하는 신속하고 한 단계 복제 방법을 개발했습니다 5 . CRISPR-concatemer라는 이름의 백본은반복적 인 gRNA 발현 카세트를 포함하는 MSCV 레트로 바이러스 플라스미드에서. 각 카세트에는 유형 IIS 제한 효소 Bbs I의 2 개의 역전 된 인식 사이트가 들어 있으며, 단일 튜브 6 에서 골든 게이트 셔플 링 반응을 사용하여 어 레인 징 된 gRNA oligo로 돌연변이 될 수 있습니다. 이 클로닝 방법은 Bbs I에 의해 생성 된 다른 오버행 서열을 이용하여 다중 DNA 단편을 동시에 조립할 수있는 반복적 인 소화 및 라이 게이션 사이클로 구성됩니다.이 효소의 독창성은 예를 들어 인식 범위 밖에서 비대칭 절단을 수행 할 수있는 능력입니다 순서; 따라서, 각각의 카세트는 BBS 코어 I 부위의 측면에 맞춤 돌출부와 다른 시퀀스를 가질 수 있고, 이러한 방식으로, 각 gRNA는 concatemer 벡터의 특정 위치 및 배향으로 클로닝 할 수있다. 원칙의 증거로서, 우리는이 전략의 사용을마우스 창자 organoids electroporation 5 한 라운드에 의해 동시에 Wnt 통로의 paralogous 부정적인 규제의 두 쌍을 교란하여. 지난 몇 년 동안, 많은 다른 그룹은 골든 게이트 셔플 링 7 을 사용하여 구축 된 여러 gRNA 발현 벡터를 기반으로 유사한 전략을 개발하여 인간 세포주 8 , 9 , 제브라 피쉬 10 및 대장균 과 같은 다양한 모델 시스템에서 다중 유전자 녹아웃을 달성했습니다 11 . 그들의 프로토콜에서, gRNA는 먼저 개별 중간 벡터로 복제 된 다음 함께 하나의 최종 제품으로 조립됩니다. 대조적으로 CRISPR-concatemer 전략의 가장 큰 장점은 단일 Bbs I 셔플 링 (복제 단계)의 편리 성입니다. 다른 gRNA concatemers와 마찬가지로, 우리의 방법은 최대 4 개의 동시 knockout다른 유전자 또는 여러 개의 gRNA가있는 하나 또는 두 개의 유전자를 표적화 한 후 증가 된 CRISPR 녹아웃 효율 ( 그림 1 ). 이 프로토콜에서는 gRNA 설계부터 골든 게이트 반응 및 성공적인 복제 확인에 이르기까지 CRISPR-concatemer 벡터를 생성하는 모든 단계를 자세히 설명합니다. 우리는 또한 electroporation 및 후속 성장 인자 철수 실험에 의해 마우스 소장 organoids에 CRISPR - concatemers의 transfection에 대한 매우 효율적인 프로토콜을 제공합니다.

<table><tbody><tr><td>Optimized CRISPR Design Tool</td><td>Feng Zhang group</td><td></td><td>CRISPR gRNA design tool; http://crispr.mit.edu/</td></tr><tr><td>Webcutter 2.0</td><td></td><td></td><td>restriction mapping tool; http://rna.lundberg.gu.se/cutter2/</td></tr><tr><td>T4 PNK (Polynucleotide Kinase)</td><td>New England Biolabs</td><td>M0201L</td><td></td></tr><tr><td>T4 DNA ligase buffer</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T7 DNA Ligase</td><td>New England Biolabs</td><td>M0318L</td><td></td></tr><tr><td>DTT (dithiothreitol)</td><td>Promega</td><td>P1171</td><td></td></tr><tr><td>ATP (adenosine triphosphate)</td><td>New England Biolabs</td><td>P0756S</td><td></td></tr><tr><td>FastDigest BbsI (BpiI)</td><td>Thermo Fisher</td><td>FD1014</td><td></td></tr><tr><td>Tango buffer (BSA-containing restriction enzyme buffer)</td><td>Thermo Fisher</td><td>BY5</td><td></td></tr><tr><td>BglII</td><td>New England Biolabs</td><td>R0144</td><td></td></tr><tr><td>EcoRI</td><td>New England Biolabs</td><td>R0101</td><td></td></tr><tr><td>Plasmid-safe exonuclease</td><td>Cambio</td><td>E3101K</td><td></td></tr><tr><td>Thermal cycler</td><td>Applied biosystems</td><td>4359659</td><td></td></tr><tr><td>10G competent E. coli bacteria</td><td>Cambridge Bioscience</td><td>60108-1</td><td></td></tr><tr><td>Plasmid mini kit</td><td>Qiagen</td><td>12125</td><td></td></tr><tr><td>Table top microcentrifuge</td><td>Eppendorf</td><td>UY-02580-01</td><td></td></tr><tr><td>Inoculating loops</td><td>Microspec</td><td>PLS5</td><td></td></tr><tr><td>Bacteria incubator</td><td>Sanyo</td><td>MIR-262</td><td></td></tr><tr><td>Luria-Bertani broth (LB)</td><td>Sigma-Aldrich</td><td>L3522</td><td></td></tr><tr><td>Agarose</td><td>Sigma-Aldrich</td><td>A4718</td><td></td></tr><tr><td>Agarose gel electrophoresis apparatus</td><td>Bioneer</td><td>A-7020</td><td></td></tr><tr><td>Advanced DMEM/F12(cell culture medium)</td><td>Invitrogen</td><td>12634-034</td><td></td></tr><tr><td>Glutamax (L-Glutamine) 100x</td><td>Invitrogen</td><td>35050-068</td><td></td></tr><tr><td>HEPES 1 M (buffering agent)</td><td>Invitrogen</td><td>15630-056</td><td></td></tr><tr><td>Penicillin-streptomycin 100x</td><td>Invitrogen</td><td>15140-122</td><td></td></tr><tr><td>B27 supplement (Neuronal cell serum-free supplement) 50x</td><td>Invitrogen</td><td>17504-044</td><td></td></tr><tr><td>N2 supplement (Neuronal cell serum-free supplement) 100x</td><td>Invitrogen</td><td>17502-048</td><td></td></tr><tr><td>n-Acetylcysteine 500 mM</td><td>Sigma-Aldrich</td><td>A9165-5G</td><td></td></tr><tr><td>Mouse EGF 500 &amp;micro;g/mL</td><td>Invitrogen Biosource</td><td>PMG8043</td><td></td></tr><tr><td>Mouse Noggin 100 &amp;micro;g/mL</td><td>Peprotech</td><td>250-38</td><td></td></tr><tr><td>Nicotinamide 1 M</td><td>Sigma</td><td>N0636</td><td></td></tr><tr><td>R-Spondin conditioned medium</td><td>n.a.</td><td>n.a.</td><td>Produced in house from HEK293 cells, for details see Sato and Clevers 2013</td></tr><tr><td>Wnt conditioned medium</td><td>n.a.</td><td>n.a.</td><td>Produced in house from HEK293 cells, for details see Sato and Clevers 2013</td></tr><tr><td>Y-27632 10 &amp;micro;M</td><td>Sigma-Aldrich</td><td>Y0503-1MG</td><td></td></tr><tr><td>Standard BD Matrigel matrix</td><td>BD Biosciences</td><td>356231</td><td></td></tr><tr><td>48-well Plate</td><td>Greiner Bio One</td><td>677980</td><td></td></tr><tr><td>CHIR99021</td><td>Sigma-Aldrich</td><td>A3734-1MG</td><td></td></tr><tr><td>IWP-2</td><td>Cell Guidance Systems</td><td>SM39-10</td><td></td></tr><tr><td>TrypLE (recombinant protease)</td><td>Invitrogen</td><td>12605-010</td><td></td></tr><tr><td>Opti-MEM (reduced serum medium )</td><td>Life technologies</td><td>51985-034</td><td></td></tr><tr><td>Electroporation Cuvettes 2 mm gap</td><td>NepaGene</td><td>EC-002S</td><td></td></tr><tr><td>Low binding 15 mL tubes</td><td>Sigma-Aldrich</td><td>CLS430791</td><td></td></tr><tr><td>B&amp;uuml;rker&amp;rsquo;s chamber</td><td>Sigma-Aldrich</td><td>BR719520-1EA</td><td></td></tr><tr><td>NEPA21 Super Electroporator</td><td>NepaGene</td><td>contact supplier</td><td></td></tr><tr><td>Protein LoBind tubes low binding</td><td>Thermo Fisher</td><td>10708704</td><td></td></tr><tr><td>BTXpress electroporation buffer</td><td>Harvard Apparatus</td><td>45-0805</td><td></td></tr><tr><td>DMSO (Dimethyl sulfoxide)</td><td>AppliChem</td><td>A3672</td><td></td></tr></tbody></table>

a protocol for multiple gene knockout in mouse small intestinal organoids using a crispr-concatemer

CRISPR / Cas9 기술은 유전자 기능을 이해하는데 필수적인 기능 손실 연구의 실행 가능성과 속도를 크게 향상시켰다. 고등 진핵 생물에서, paralogous 유전자는 유전자의 손실을 보완함으로써 잠재적 인 표현형을 가려 낼 수 있으므로 단일 유전자 knockouts에 의존하는 유전 연구로부터 얻을 수있는 정보를 제한합니다. 우리는 마우스 작은 창자 organoids의 단일 transfection 다음에 다중 유전자 knockouts을 만들기 위해 가이드 RNA (gRNA) concatemers에 대한 소설, 빠른 복제 방법을 개발했습니다. 우리의 전략은 어닐링 된 gRNA 올리고와 사전 설계된 레트로 바이러스 벡터를 사용하여 골든 게이트 셔플 링 반응을 수행함으로써 최대 4 개의 개별 gRNA를 하나의 벡터로 연결하는 것을 허용합니다. 이를 통해 최대 4 개의 다른 유전자를 동시에 녹아웃하거나 여러 개의 gRNA에 의해 하나의 유전자를 타겟팅 한 후 녹아웃 효율을 높일 수 있습니다. 이 프로토콜에서는 우리가 자세히 보여줍니다.어떻게 여러 개의 gRNA를 레트로 바이러스 CRISPR-concatemer vector로 효율적으로 복제하는지, 그리고 어떻게 장내 organoids에서 매우 효율적인 electroporation을 달성 할 수 있는지에 대해 설명합니다. 예를 들어, Wnt 신호 전달 경로 (Axin1 / 2 및 Rnf43 / Znrf3)의 음성 조절자를 코딩하는 두 쌍의 유전자를 동시에 녹아웃하면 장 성장 인자가 주요 성장 인자의 내성에 내성이 있음을 보여줍니다.

Concatemer 벡터에서 올바른 gRNA 삽입물의 존재를 확인하기 위해 모든 gRNA 발현 카세트 (각 카세트 크기는 ~ 400 bp, 그림 1 )와 인접한 효소 ( EcoR I + Bgl II)로 제한 효소 처리를 수행합니다. 예를 들어, 4 gRNA- 연결자 벡터를 생성 할 때, 아가로 오스 겔에서 하부 밴드의 예상 크기는 약 1.6 Kbp이다. 이보다 낮은 밴드는 4 개의 gRNA 카세트가 모두 벡터에 삽입되어 있지 않다는 것을 의미합니다 ( 그림 2A ). 또한 모든 Bbs I 인식 부위가 손실되고 효소가 벡터를 절단하지 않는지 항상 확인하는 것이 좋습니다 ( 그림 2B ). 일단 구조가 확인되면, 그들은 최적의 결과를 얻기 위해 일렉트로 포 레이션 (electroporation)에 의해 마우스 창자 유기체에 전달 될 수 있습니다GFP control ( 그림 3 )에서 볼 수 있듯이 1 수준의 transfection 효율 (최대 70 %)을 제공합니다. 마지막으로,이 전략의 효율을 기능적으로 시험하기 위해, Cas9 및 Axin1 / 2 및 Rnf43 / Znrf3에 대한 concatemer 벡터를 트랜 스펙 션 한 장 기관을 EN (R- 스핀 딘 회수) 및 EN + IWP2 (R- 스핀 딘 및 Wnt 회수, IWP2 : 고슴도치 억제제, 2.5 μm의) 미디어 최소한 3 구절 ( 그림 4 ). 형질 감염되지 않은 WT 유기체는 두 조건 하에서 모두 죽었지 만, Axin1 / 2 녹아웃 유기물은 Wnt 경로의 하류 활성화로 인해 두 곳에서 생존했다. 또한, Rnf43 / Znrf3 돌연변이 유기물은 R- 스핀 인의 부재하에 생존하지만 IWP2의 존재 하에서는 생존 할 수 없으며, 이는 경로를 활성화시키는 Wnt의 고갈을 야기한다. 이 관찰 결과를 종합 해 보면,이 두 쌍의 paralogue의 녹아웃은 t그는 유기체 표현형을 예상했다. 이 결과의 세부 사항은 Developmental Biology 5 에 게시되었습니다. <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/55916/55916fig1.jpg" /> 그림 1 : 4 개의 카세트가있는 CRISPR 컨 테이너의 도식적 표현. U6 프로모터, 2 개의 역 반복 된 Bbs I 부위 (BB로 표시됨) 및 gRNA 비계를이 순서로 함유하는 각각의 400 bp 카세트를 갖는 4 개 gRNA- 연결자 벡터의 도식. 셔플 반응하는 동안, 게시판 I 사이트는 오버행 일치 결과적으로 손실로 gRNA 조각으로 대체됩니다. gRNA oligos의 올바른 삽입을 확인하기위한 시퀀싱 프라이머의 결합 부위는 파란색 화살표로 표시됩니다. Fwd = 정방향 프라이머, Rev = 리버스 프라이머, 링크 1/2/3 = 링커 영역 1/2/3. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55916/55916fig1large.jpg" target="_blank">제발</a>이 그림의 더 큰 버전을 보려면 여기를 핥아 라. <img alt="그림 2" class="xfigimg" src="/files/ftp_upload/55916/55916fig2.jpg" /> 그림 2 : Concatemer Vectors의 대표적인 소화 패턴. ( A ) 3 및 4 gRNA concatemer 벡터의 EcoR I 및 Bgl II 로의 이중 절단. 올바른 소화 패턴은 녹색 진드기로 표시되는 반면, 단지 1 또는 2 gRNA 삽입이있는 벡터는 적색 십자가로 표시됩니다. 레인 1은 양성 대조군 ( &quot;+&quot;로 표시)으로 사용 된 4 gRNA- 컨 케터 머 부모 벡터의 절단을 나타낸다; 유사하게, 레인 5는 &quot;+&quot;로 표시된 3 개의 gRNA- 컨 케터 머 부모 벡터의 절단을 나타낸다. BBS I와 (B)의 분해 (녹색 눈금으로 표시) 소화 concatemer 벡터의 정확한 크기를 나타낸. 게시판 I 사이트를 잃은 gRNA 함유 concatemer 벡터의 소화는 긍정적 인 제어 int로서 사용된다d는 &quot;+&quot;로 표시됩니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55916/55916fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" class="xfigimg" src="/files/ftp_upload/55916/55916fig3.jpg" /> 그림 3 : 성공적으로 Electroporated 장 Organoids의 대표 이미지. GFP 플라스미드의 형질 감염은 형질 감염 효율을 평가하는데 유용합니다. 약 24 시간 동안 electroporation 후, 세포의 소수를 포함 organoids 이미 볼 수 있으며, electroporation 절차가 성공하면 그들의 최대 70 % 녹색 형광 표시됩니다. BF = 밝은 영역, GFP = 녹색 형광 단백질. 스케일 바 = 2,000 μm. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55916/55916fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 그림 4 : 돌연변이 장 organoids의 대표 이미지. Wnt 경로 Axin1과 Rnf43의 부정적 조절 자의 넉 아웃 (knockout)은 그들의 패럴 로그와 함께 성장 인자 결핍에 내성 인 장 유기체를 렌더링한다. 특히 R-spondin (EN : EGF + Noggin)과 Wnt (EN + IWP2 : EN + Porcupine inhibitor)가없는 Axin1 / 2 녹아웃 유기체 (Axin1 / 2KO)는 Rnf43 / Znrf3 돌연변이 체 (R &amp; Z KO)는 R-spondin (EN)이 없을 때만 생존 할 수 있습니다. 대조적으로, WT 유기체는 대조 배양 조건, WENR + Nic (Wnt + EGF + Noggin + R- spondin + Nicotinamide)에서만 생존 할 수 있습니다. 스케일 바 = 1,000 μm. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55916/55916fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page = &quot;1&quot;fo : keep-with-next.within-page = &quot;always&quot;&gt; <tbody><tr><td> 기초 매체 </td><td></td><td> 댓글 </td></tr><tr><td> 4 ° C에서 4 주 동안 보관하십시오. </td><td></td><td></td></tr><tr><td> 세포 배양 배지 </td><td> 500 mL </td><td> 자료 표 참조 </td></tr><tr><td> L- 글루타민 100x </td><td> 5 mL </td><td></td></tr><tr><td> 완충제 1 M </td><td> 5 mL </td><td> 자료 표 참조 </td></tr><tr><td> 페니실린 스트렙토 마이신 100x </td><td> 5 mL </td><td></td></tr><tr><td> WENR + Nic (Wnt + EGF + Noggin + R- 스 퐁당 + 니코틴 아미드) </td><td></td><td></td></tr><tr><td> 4 ° C에서 2 주 동안 보관하십시오. </td><td></td><td></td></tr><tr><td> 기초 매체 </td><td> 최대 50 mL </td><td></td></tr><tr><td> 신경 세포 무 혈청 보충제 (50x) </td><td> 1 mL </td><td> 엄마 표보기테리아 </td></tr><tr><td> 신경 세포 무 혈청 보충제 (100x) </td><td> 500 μL </td><td> 자료 표 참조 </td></tr><tr><td> n- 아세틸 시스테인 (500 mM) </td><td> 125 μL </td><td></td></tr><tr><td> 마우스 EGF (100 μg / mL) </td><td> 25 μL </td><td></td></tr><tr><td> 마우스 Noggin (100 μg / mL) </td><td> 50 μL </td><td></td></tr><tr><td> R- 스 폰딘 컨디셔닝 배지 </td><td> 5 mL </td><td></td></tr><tr><td> Wnt3a 컨디셔닝 된 배지 </td><td> 25 mL </td><td></td></tr><tr><td> 니코틴 아미드 (1 M) </td><td> 250 μL </td><td></td></tr><tr><td> EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632) </td><td></td><td></td></tr><tr><td> 4 ° C에서 2 주 동안 보관하십시오. </td><td></td><td></td></tr><tr><td> 페니실린 스트렙토 마이신이없는 기초 배지 </td><td> 최대 20 mL </td><td></td></tr><tr><td>신경 세포 무 혈청 보충제 (50x) </td><td> 400 μL </td><td> 자료 표 참조 </td></tr><tr><td> 신경 세포 무 혈청 보충제 (100x) </td><td> 200 μL </td><td> 자료 표 참조 </td></tr><tr><td> n- 아세틸 시스테인 (500 mM) </td><td> 50 μL </td><td></td></tr><tr><td> 마우스 EGF (100 μg / mL) </td><td> 10 μL </td><td></td></tr><tr><td> 마우스 Noggin (100 μg / mL) </td><td> 20 μL </td><td></td></tr><tr><td> Y-27632 (10 μM) </td><td> 20 μL </td><td></td></tr><tr><td> CHIR99021 (8 μM) </td><td> 10 μL </td><td></td></tr><tr><td> EN (EGF + 노긴) </td><td></td><td></td></tr><tr><td> 4 ° C에서 4 주 동안 보관하십시오. </td><td></td><td></td></tr><tr><td> 기초 매체 </td><td> 최대 50 mL </td><td></td></tr><tr><td> 신경 세포 무 혈청 보충제 (50x) </td><td&gt; 1 mL </td><td> 자료 표 참조 </td></tr><tr><td> 신경 세포 무 혈청 보충제 (100x) </td><td> 500 μL </td><td> 자료 표 참조 </td></tr><tr><td> n- 아세틸 시스테인 (500 mM) </td><td> 125 μL </td><td></td></tr><tr><td> 마우스 EGF (100 μg / mL) </td><td> 25 μL </td><td></td></tr><tr><td> 마우스 Noggin (100 μg / mL) </td><td> 50 μL </td><td></td></tr></tbody></table> 표 2 : 오가 노이드 미디어 조성.

Watch this Scientific Journal Video about A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer at JoVE.com

A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

이 프로토콜은 CRISPR / Cas9 기술을 사용하여 다중 유전자 녹아웃을 만드는 데 사용되는 하나의 가이드 RNA concatemer 벡터에 여러 단일 가이드 RNA를 복제하는 단계를 설명합니다. 장 organoids에 이중 knockouts의 생성은이 방법의 가능한 응용 프로그램으로 표시됩니다.

CRISPR-concatemer를 이용한 마우스 작은 창자 organoids에서 다중 유전자 녹아웃을위한 프로토콜

CRISPR/Cas9 technology has greatly improved the feasibility and speed of loss-of-function studies that are essential in understanding gene function. In ...

a-protocol-for-multiple-gene-knockout-mouse-small-intestinal

Nanyang Technological University

Research

JoVE Journal

Bioengineering

18.0K 조회수.  University of Cambridge.  이 프로토콜은 CRISPR / Cas9 기술을 사용하여 다중 유전자 녹아웃을 만드는 데 사용되는 하나의 가이드 RNA concatemer 벡터에 여러 단일 가이드 RNA를 복제하는 단계를 설명합니다. 장 organoids에 이중 knockouts의 생성은이 방법의 가능한 응용 프로그램으로 표시됩니다. 

비디오: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

연구

유전학

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Generation of Genetically Modified Mice through the Microinjection of Oocytes

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear injection of DNA expression constructs into fertilized oocytes remains the most commonly used technique to generate transgenic mice for overexpression. With the introduction of CRISPR technology for gene targeting, pronuclear injection into fertilized oocytes has been extended to the generation of both knockout and knockin mice. This work describes the preparation of DNA for injection and the generation of CRISPR guides for gene targeting, with a particular emphasis on quality control. The genotyping procedures required for the identification of potential founders are critical. Innovative genotyping strategies that take advantage of the "multiplexing" capabilities of CRISPR are presented herein. Surgical procedures are also outlined. Together, the steps of the protocol will allow for the generation of genetically modified mice and for the subsequent establishment of mouse colonies for a plethora of research fields, including immunology, neuroscience, cancer, physiology, development, and others.

The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

난 모세포의 미세 주입을 통한 유전자 조작 마우스의 생성

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

발생학

Universal and Efficient Electroporation Protocol for Genetic Engineering of Gastrointestinal Organoids

Electroporation is a common method for transfection with different kinds of molecules by electrical permeabilization of the plasma membrane. With the increasing use of organoids as a culturing method for primary patient material in the last years, efficient transfer methods of components for genetic engineering in this 3D culture system are in need. Especially for organoids, the efficiency of genetic manipulations depends on a successful transfection. Thus, this protocol was developed to facilitate the electroporation of organoids and to prove its universal functionality in different entities. Human colorectal, pancreatic, hepatic and gastric cancer organoids were successfully electroporated with small and large plasmids in comparison. Based on GFP encoding vectors, the transfection efficiency was determined by FACS. No extensive preparation of the cells or special, cost-intensive electroporation buffers are necessary, and the protocol can be performed within one day.

This protocol describes an efficient electroporation method for the transfection of four different gastrointestinal organoid entities with larger plasmids (to the extent of 10 kB). It can be performed within one day and does not need extensive preparation or special, cost-intensive electroporation buffers.

위장 유기 체의 유전 공학에 대 한 보편적이 고 효율적인 전기 기광 프로토콜

Electroporation is a common method for transfection with different kinds of molecules by electrical permeabilization of the plasma membrane. With the ...

In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to assess therapeutic avenues. However, their time-, labor- and cost-intensive nature limits their utility for systematic analysis of gene function. Recent advances in genome-editing technologies overcome those limitations and allow for the rapid generation of specific gene perturbations directly within specific mouse organs in a multiplexed and rapid manner. Here, we describe a CRISPR/Cas9-based method (Clustered Regularly Interspaced Short Palindromic Repeats) to generate thousands of gene knock-out clones within the epithelium of the skin and oral cavity of mice, and provide a protocol detailing the steps necessary to perform a direct&#160;in vivo&#160;CRISPR&#160;screen for tumor suppressor genes. This approach can be applied to other organs or other CRISPR/Cas9 technologies such as CRISPR-activation or CRISPR-inactivation to study the biological function of genes during tissue homeostasis or in various disease settings.

Here we describe a rapid and direct in vivo CRISPR/Cas9 screening methodology using ultrasound-guided in utero embryonic lentiviral injections to simultaneously assess functions of several genes in the skin and oral cavity of immunocompetent mice.

마우스 피부와 구강의 유전자 기능을 동시에 평가하기 위한 Vivo CRISPR/Cas9 스크리닝

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to ...

Genetic Engineering of Primary Mouse Intestinal Organoids Using Magnetic Nanoparticle Transduction Viral Vectors for Frozen Sectioning

Intestinal organoid cultures provide a unique opportunity to investigate intestinal stem cell and crypt biology in vitro, although efficient approaches to manipulate gene expression in organoids have made limited progress in this arena. While CRISPR/Cas9 technology allows for precise genome editing of cells for organoid generation, this strategy requires extensive selection and screening by sequence analysis, which is both time-consuming and costly. Here, we provide a detailed protocol for efficient viral transduction of intestinal organoids. This approach is rapid and highly efficient, thus decreasing the time and expense inherent in CRISPR/Cas9 technology. We also present a protocol to generate frozen sections from intact organoid cultures for further analysis with immunohistochemical or immunofluorescent staining, which can be used to confirm gene expression or silencing. After successful transduction of viral vectors for gene expression or silencing is achieved, intestinal stem cell and crypt function can be rapidly assessed. Although most organoid studies employ in vitro assays, organoids can also be delivered to mice for in vivo functional analyses. Moreover, our approaches are advantageous for predicting therapeutic responses to drugs because currently available therapies generally function by modulating gene expression or protein function rather than altering the genome.

We describe step-by-step instructions to: 1) efficiently engineer intestinal organoids using magnetic nanoparticles for lenti- or retroviral transduction, and, 2) generate frozen sections from engineered organoids. This approach provides a powerful tool to efficiently alter gene expression in organoids for investigation of downstream effects.

냉동 절편을 위한 자기 나노입자 전착 바이러스성 벡터를 사용하여 1 차적인 마우스 장 오르가노이드의 유전 공학

Intestinal organoid cultures provide a unique opportunity to investigate intestinal stem cell and crypt biology in vitro, although efficient approaches to ...

<meta charset="utf8"></head><body>LEGO: 지질 조절 장애 및 약물 표적을 밝히는 인간 GBM 오가노이드 모델

Laboratory-Engineered Glioblastoma Organoid Culture and Drug Screening

Glioblastoma (GBM) is described as a group of highly malignant primary brain tumors and stands as one of the most lethal malignancies. The genetic and cellular characteristics of GBM have been a focal point of ongoing research, revealing that it is a group of heterogeneous diseases with variations in RNA expression, DNA methylation, or cellular composition. Despite the wealth of molecular data available, the lack of transferable pre-clinic models has limited the application of this information to disease classification rather than treatment stratification. Transferring the patients' genetic information into clinical benefits and bridging the gap between detailed descriptions of GBM, genotype-phenotype associations, and treatment advancements remain significant challenges. In this context, we present an advanced human GBM organoid model, the Laboratory Engineered Glioblastoma Organoid (LEGO), and illustrate its use in studying the genotype-phenotype dependencies and screening potential drugs for GBM. Utilizing this model, we have identified lipid metabolism dysregulation as a critical milestone in GBM progression and discovered that the microsomal triglyceride transfer protein inhibitor Lomitapide shows promise as a potential treatment for GBM.

<meta charset="utf8"></head><body>실험실에서 엔지니어링한 교모세포종 오가노이드 배양 및 약물 스크리닝

Here, we outline a comprehensive protocol for generating and utilizing laboratory-engineered glioblastoma organoids (LEGO) to investigate genotype-phenotype dependencies and screen potential drugs for glioblastoma treatment.

실험실에서 엔지니어링한 교모세포종 오가노이드 배양 및 약물 스크리닝

Glioblastoma (GBM) is described as a group of highly malignant primary brain tumors and stands as one of the most lethal malignancies. The genetic and ...

암 연구학

Efficient Genome Editing of Mice by CRISPR Electroporation of Zygotes

With exceptional efficiency, accuracy, and ease, the CRISPR/Cas9 system has significantly improved genome editing in cell culture and lab animal experiments. When generating animal models, the electroporation of zygotes offers higher efficiency, simplicity, cost, and throughput as an alternative to the gold standard method of microinjection. Electroporation is also gentler, with higher viability, and reliably delivers Cas9/single-guide RNA (sgRNA) ribonucleoproteins (RNPs) into the zygotes of common laboratory mouse strains (e.g., C57BL/6J and C57BL/6N) that approaches 100% delivery efficiency. This technique enables insertion/deletion (indels) mutations, point mutations, the deletion of whole genes or exons, and small insertions in the range of 100-200 bp to insert LoxP or short tags like FLAG, HA, or V5. While constantly being improved, here we present the current state of CRISPR-EZ in a protocol that includes sgRNA production through in vitro transcription, embryo processing, RNP assembly, electroporation, and the genotyping of preimplantation embryos. A graduate-level researcher with minimal experience manipulating embryos can obtain genetically edited embryos in less than 1 week using this protocol. Here, we offer a straightforward, low-cost, efficient, high-capacity method that could be used with mouse embryos.

Here, we describe a simple technique intended for the efficient generation of genetically modified mice called CRISPR RNP Electroporation of Zygotes (CRISPR-EZ). This method delivers editing reagents by electroporation into embryos at an efficiency approaching 100%. This protocol is effective for point mutations, small genomic insertions, and deletions in mammalian embryos.

CRISPR-concatemer를 이용한 마우스 작은 창자 organoids에서 다중 유전자 녹아웃을위한 프로토콜

요약

더 많은 비디오 탐색

이 비디오의 챕터

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

난 모세포의 미세 주입을 통한 유전자 조작 마우스의 생성

위장 유기 체의 유전 공학에 대 한 보편적이 고 효율적인 전기 기광 프로토콜

마우스 피부와 구강의 유전자 기능을 동시에 평가하기 위한 Vivo CRISPR/Cas9 스크리닝

냉동 절편을 위한 자기 나노입자 전착 바이러스성 벡터를 사용하여 1 차적인 마우스 장 오르가노이드의 유전 공학

실험실에서 엔지니어링한 교모세포종 오가노이드 배양 및 약물 스크리닝

실험실에서 엔지니어링한 교모세포종 오가노이드 배양 및 약물 스크리닝

실험실에서 엔지니어링한 교모세포종 오가노이드 배양 및 약물 스크리닝

접합체의 CRISPR 전기천공에 의한 마우스의 효율적인 게놈 편집