우리는 필터링 된 초상 자성 나노 입자의 TEM 이미지를 획득과 자신의 X 선 분석을 수행하기에 기술 지원을위한 G. 풀다 (전자 현미경 센터, 로스 토크 대학, 독일)에 감사드립니다. RTC 로스 토크에서 수행 작업은 연방 교육 연구부 독일 (FKZ 0312138A, FKZ 316159 및 VIP + 03VP00241) 및 EU 구조 기금과 국가 메 클렌 부르크 - 서쪽 포메 라니아 (ESF / IV-WM-B34-에 의해 지원되었다 0030/10와 ESF / IV-BM-B35-0010 / 12) 및 DFG (DA 1296-1), 축축한 재단 및 독일 심장 재단 (F는 / 01 / 12)에 의해. 프랭크 위호스트 EU FP7 연구 프로그램 &quot;Nanomag&quot;FP7-NMP-2013-LARGE-7에 의해 지원되었다.

우리는 공개 경쟁 금융 관심 회원이 없습니다.

상기 자기 자신의 제어 지침 상자성 나노로드 유 전적으로 조작 된 세포의 제조는 현재의 프로토콜에 제공된다. 이 전략의 성공적인 응용 프로그램은 이식에 대한 타겟팅 전지 제품을 제공함으로써, 같은 부상 영역 2, 3, 4, 낮은 유지와 가난한 생착 등 세포 치료의 어려움의 해결을 위해 수 있습니다. 또한, 적절히 선택 유전 물질의 동시 도입은 전지 특성을 촉진 할 수있어 기능적 이득 (41)을 증가 할 수있다. 현재의 프로토콜은 모델로 된 HUVECs에 개발되었다. 이러한 세포 독성 영향이 18, 19, 20의 형질 어렵고 민감한 것으로 알려져있다. 민주PEI / MNP 형질 전환 후 95 % 이상의 형광 표지 미르 흡수 onstrated 수준은 일반적 PEI 계 벡터로 얻어진 통상 양이온 계 지질 형질 전환 시약을 사용한다 (예를 들면, 리포 펙 타민) 42. NP 40 - 또한, (25)의 최적의 비율은 NP (20)의 이전에 발행 된 값에 대응한다. 그럼에도 불구하고, 테스트 형광 - 태그 미르 고효율 흡수는 반드시 배달 43 이후 적절한 미르 처리 및 기능을 보장하지 않습니다. 이 점 NA의 긴밀한 정전 축합와 PEI의 경우에 특히 적합하다. 따라서, 전달 미르 결과 기능적 능력도 시험해야한다. 여기서, 기능적 내생 미르 HUVEC 표현 미르-92A (31)가 선택하고, 그것에 대하여 반 미르 PEI 및 PEI / MNP를 사용하여 전달 하였다. 결과적으로, 타겟은 miR-92A의 거의 완전한 녹다운 항은 miR F의 효율적인 분리를 증명트랜 단지를 ROM. 중요한 것은, 이전의 작품에서 PEI / MNP 벡터의 성공적인 응용 프로그램은 다른 세포 유형에 플라스미드 DNA (pDNA에) 미르의 전달, 모두 부착 (예를 들어, COS7, 인간 중간 엽 줄기 세포 15, 16)과에서 증명되었다 현탁액 (예, 골수 유래 CD133 + 조혈 줄기 세포 (44)). 모든 실험은 형질 전환 효율과 세포 독성 형태 45 의존적이라는 알려진 사실을 확인했다. 따라서, 최적의 벡터 성분의 선택 (즉, 미르 양 NP 비율 및 MNP 철의 양)를 기준점으로서 미리 설정된 최적의 조건을 이용하여, 각 특정 세포 유형에 대해 수행되어야한다. 또한, 달성 유전자 변형의 과도 특성이 고려되어야한다. 한편으로, 나는t는 성장 인자의 단기 납기 등의 특정 기능에 매우 적합하다. 반면에, 표현의 기간은 장기간의 발현을 요구하는 다양한 목적을 위해 충분히 오래 지속되지 않을 수 있습니다. 상기 조건이 최적화되면 역시, PEI / MNP 벡터의 안전성이 입증은 반복 가능한 관리를 지원한다. PEI 및 그 유도체는 일반적으로 다른 비 바이러스 성 차량과 7, 수정하는 유연성에 비해 높은 효율성으로 인해 사용됩니다. 그러나, 생체 외 및 생체 내에서 PEI의 성공에도 불구하고, 임상 시험에서의 적용은 매우 (즉, 몇 단계 1, 2 시험 또는 암 환자) 7, 14 인해 PEI 독성 (7), (13)로 제한됩니다. 우리 그룹 (16)뿐만 아니라,이 프로토콜의 이전 작품으로, MNPS을 증명하고있다크게 PEI 독성을 감소 할 수 있습니다. 특히 미르 / PEI 형질 감염시켜 이들 세포에 대한 시험 관내 기능 테스트 메인 실패들이 행렬에 튜브를 형성하기 위해 HUVEC를 능력을 손상하고있다. 반면 미르 / PEI / MNP-된 HUVECs 관 형성의 성능은 비 처리 세포와 비교 하였다. 특히, PEI 독성의 감소는 생체 일상적 피험자 40 대조 시약으로 사용되는 철 산화물 성분의 낮은 레벨을 도입함으로써 달성 하였다. 그렇다 기능적 특성을 유지에서,이 기능은 세포 치료제 이식 후 46의 적절한 통합에 필요로 변형 세포, 간 통신을 구축 할 수있는 것이 중요하다. 또한, 변형 된 세포는 조직 손상 치료 47 미르 전달을위한 담체로서 이용 될 수있다. 이 경우, 자신의 capaci이웃하는 셀을 갖는 분자를 교환 타이 수단으로 성공을 정의한다. PEI / MNP 형질 수정 된 HUVEC에서 GJIC을 허용하기 때문에, 생체 내에서의 통합 가능성을 손상 부위에 미르 전달을 제공한다. 특히, 다음 타겟팅 세포 자화에 이전에 출판 된 작품은 셀 ~ 4의 로딩 및 철 / 셀 48, 49, 50, 51의 30 페이지를보고했다. 이러한 수치는 유의 값 ~ 관내 정적 및 동적 시뮬레이션 조건에서 NA / PEI / MNP-HUVEC를 타겟팅 충분했다 0.16-0.7 PG / 셀을 초과한다. 낮은 철 량은 안전성면에서 유리하다 : 산화철 나노 입자 - 관련 독성의 공지기구 (즉, 활성 산소 종의 생성 (ROS))은 직접 INTE의 크기와 관련된 것으로 알려진rnalized 40 나노 입자. 더하여, 몇몇 연구는 산화철 나노 입자의 세포 내 농도가 높은 농도 의존적 해체 골격 손상 (52), (53)으로 이어질 수 있다는 것을 증명하고있다. 중요한 것은, 대부분의 유전자 세포 조작을 포함하지 않는 타겟팅 용도 세포 자화의 사례를보고했다. 반대로, 미르 / PEI / MNP 벡터를 동시에 세포를 수정하고 자기 특성을 추가 할 수있는 기회를 제공한다. 그러나, 낮은 MNP 로딩은 혈액의 흐름과 난류 환경에서 대상으로 자기에 충분하지 수 있습니다. 생체 내 상황에 도전 가까이 제공하기 위해, 동적 인 조건은 시험 관내 모의했다 : 현탁액 자화은 miR / PEI / MNP-HUVEC를 가진 배양 플레이트는 회전 진탕 기 (34) 상에 배치했다. 이 실험은 명확에서 발생하는 모든 상호 작용을 포함 할 수생체. 그러나, PEI / MNP 변형 된 세포의 대상으로 잠재력을 더 잘 이해되었다. 배양액의 흔들림에도 활성 자석 (54)으로 세포 이동을 방해하지 않았던 결과, 고효율 셀 타겟팅 입증되었다. 이를 위해 미르 수정 된 HUVECs 철 / 셀의 최소 ~ 0.16 페이지로드되었다. 또한, 자기 반응성 세포를 정렬 할 수 있습니다. 본 연구에 적용된 자석 계 세포 분리 과정 미르 / PEI / MNP 세포의 생존력을 손상하지 않았다. 중요한 것은, 정적 자기장의 응용 프로그램 (즉, 12 자기장의 응용 프로그램을 포함 실험 대상 - 24 시간) 표적 세포에 손상 영향을 미치지 않았다 있습니다. 따라서, 자화 된 유전자 변형 세포의 생산 입증 자력에 의해 확실하게 고정 셀의 효율을 다루는 생체 내 연구에있어서의 기초를 제공한다. 특히, 일즉 51, 54, 55 사용되는 셀 보유 국소 투여가 아닌 세포 유도 후에 정맥 주사 후 자성 세포의 표적화를 이용한 생체 내 연구에 가장 성공적인. 따라서, 주사 부위에 자석 기반 유지 미르 / PEI / MNP는 변성 세포의 생체 내 적용에 대해 더 바람직 나타난다.

유전자 및 세포 치료는 CVD 처리에 현재의 문제를 해결할 가능성이있는 강력한 도구입니다. 이러한 접근 방법 모두 현재 임상 실험에서 테스트되고 있다는 사실에도 불구하고, 그들은 아직 다양한 임상 적 적용 일에 대한 준비가되지 않습니다. 특히, 유전자 및 세포 치료의 과제를 해결하는 일반적인 접근 방식은 임상 적 적용에 적합한 다기능 유전자 전달 벡터를 개발하는 것입니다. 안전하고 효율적인 유전자 전달 시스템의 부족은 유전자 치료의 주요 관심사입니다. 동시에, 세포 제품의 유전 공학 낮은 효율 (예를 들어, 심장 분야에서 기능 개선 만 ~ 5 % 달성 후 줄기 세포 이식 1과 세포 치료의 심각한 도전을 극복 할 수 이식에 앞서 시간 포 분 이내에 10 % -)와 가난한 유지 / 상해의 사이트에 생착이 (즉, 세포의 유지는 아래 5 방울세인트 애플리케이션, 투여 경로에 관계없이 2, 3, 4). 현재까지, 바이러스 벡터가 크게 임상 시험에서의 넓은 응용 가져왔다 효율의 관점에서 비 바이러스 시스템 (~ 67 %)를 초과 5. 그러나 바이러스 차량은 실시 유전 물질 (6)의 크기에 심각한 (심각한 합병증 및 후속 염증 반응) 등의 면역 원성 등의 위험, 관련한 종양 및 제한을 실시한다. 이러한 안전 문제 및 바이러스 벡터 생산의 높은 비용으로 인해, 비 바이러스 시스템의 사용은 어떤 경우 7, 8 바람직하다. 여기에는 (CVD 처리에 대한 예)를 제어 혈관 성장 인자의 발현 유전자로서 과도 보정을 필요 이상, 또는 대인 수수에 특히 적합백신의 스피. 우리 그룹에서, 전달 시스템은 지형 25 kDa의 폴리에틸렌 이민 (PEI)과 비오틴 - 스트렙 트 아비딘 상호 작용 (9)에 의해 함께 결합 초상 자성 산화철 나노 입자 (MNP)를 조합하여 설계되었다. 이 벡터는 이전의 이식에 대한 그들의 동시 자화를 허용 세포의 유전 공학에 대한 잠재적 인 도구입니다. 후자는 고급 자기 타겟팅 기술이 성공적으로 10을 개발하고 있습니다로, 요즘 특히 유망 자기 안내 / 보존을위한 기초를 제공한다. 또, 얻어진 자기 응답 세포가 될 가능성이있는 비 침습적으로 자기 공명 영상 (MRI) 또는 자기 입자 이미지 (11) (12)에 의해 모니터링. PEI는 / MNP 벡터의 경우에, 폴리아민은 분해 인자로부터 핵산 축합 따라서 보호를 보장<html> 의, 세포에서 벡터의 국제화 및 엔도 좀은 5 탈출. MNPS 자기 유도의 관점에서뿐만 아니라, 공지 된 PEI 중독 7, 13, 14을 감소시킴으로써뿐만 아니라, PEI의 특성을 보완. 이전 PEI / MNP 벡터 성질은 섬유 아세포와 인간 중간 엽 줄기 세포 (15, 16)를 사용하여 전달 효율 (즉,과의 pDNA의 miRNA) 및 안전성의 관점에서 조정 하였다. 이 논문에서 miRNA의 변성 세포의 발생에 대한 PEI / MNPS의 애플리케이션에 대한 상세한 프로토콜은 17을 설명한다. 이를 위해, HUVECs를 사용하고 체외 혈관 신생에 대한 확립 된 모델을 나타내고있다. 그들은 형질에 도전하고 독성 영향 (18), (19)에 취약엉덩이 = &quot;외부 참조&quot;&gt; 20. 또한, 우리는 그들의 타겟팅, 세포 간 통신 및 MRI 탐지를 포함하여 체외에서 이러한 세포를 평가하는 알고리즘을 제공한다.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

현재까지, 심혈관 질환에 사용할 수있는 수술 및 약물 치료 (CVD)는 제한적이며 종종 완화. 동시에, 유전자 및 세포 치료는 CVD 치료에 매우 유망한 대안 적 방법을 제공합니다. 그러나, 유전자 치료의 다양한 임상 적 적용이 매우 적합 유전자 전달 시스템의 부족에 의해 제한된다. 적절한 유전자 전달 벡터의 개발은 세포 치료의 현재 문제점에 대한 해결책을 제공 할 수있다. 등 부상 기관에 제한 효율성과 낮은 세포 유지와 같은 특히, 기존의 단점에서, 적절한 세포 공학에 의해 (즉, 유전) 이전에 이식에 극복 할 수있다. 제시된 프로토콜은 폴리에틸렌 초상 자성 나노 입자 (PEI / MNP) 기반 전달 벡터를 사용하여 내피 세포의 효율적이고 안전한 과도 변형 례를 설명한다. 또한, 알고리즘과 셀 특성화 방법이 정의되어있다. 성공적인 intracellu마이크로 RNA 인간 제대 정맥 내피 세포로 (은 miR) (HUVEC를)의 경 전달 세포 생존, 기능, 또는 간 통신에 영향을주지 않고 달성되었다. 또한,이 방법은 소개 외생은 miR에서 강력한 기능 효과를 일으킬 것으로 입증되었다. 중요한 것은,이 MNP 기반 벡터의인가는 자기 타겟팅 및 비 침습성 MRI 추적 가능성을 수반 셀 자화를 보장한다. 이것은 MRI와 비 침습적 모니터링 할 수있는 자기 유도, 유 전적으로 조작 된 세포 치료제를위한 기초를 제공 할 수있다.

제안 된 프로토콜의 주요 목적은 자기 반응은 miR-수정 세포를 생산하기 위해 자신의 정확한 특성 (그림 1)을 수행하는 것입니다. 따라서, MRI 자기장으로 선택하고 안내 및 검출 응답을 효율적으로 형질 감염된 세포를 수득한다. 먼저, 절연 된 HUVEC의 신원은 내피 세포 마커 CD31 전형적인 염색 (PECAM) (도 2a)에 의해 적절한 기저막 매트릭스 (도 2b)의 튜브를 형성하는 능력에 의해 확인되었다. 얻어진 세포는 미르가 매우 효율적으로 PEI / MNP 도입 채택했다; 현미경 모든 셀은 miR 태그 (Cy3가) 24 시간 후 형질 감염 (도 3a)의 신호에 대해 양성인 것으로 보였다. 중요한 것은, 어떤 세포 사멸은 미처리 세포 (도 3B)에 비해 기록되지 및 Normal 외관 (도 3a)를 유지 하였다. 공 초점 레이저 주사 현미경으로 관찰 된 바와 같이,는 Cy3-미르 신호는 주로 세포 내에 위치 하였다. 또한, 형질 전환 벡터 미르의 모든 부분의 세포 내 편재 자세한 연구가 더 높은 해상도 3 컬러 표지 복합체를 사용하여 수행 하였다. SIM 미르, PEI, 및 MNP 신호는 모두 핵 주변 영역 (도 3c) 내의 세포질에서 발견되었다. 또한, 형질 전환 벡터 안전성의 상세한 조사 미르 / PEI / MNP-된 HUVECs는 (도 4a 결과 네트워크는 양성 대조군으로 사용 된 비 처리 된 세포의 것과 비교 될 적절한 기저막 매트릭스 것을 튜브를 형성 할 수 있음을 입증 ). 3D-FRAP 실험 밝혀 더욱이, 형질 세포 GJIC을 유지 하였다. 특히, 세포는 형광 GJ-permea로로드BLE 염료 중 하나가 탈색되고, 그 형광 때문에 이웃 셀과 통신하고, 생성 된 염료 전사 (도 4b)로 복원한다. 중요한 인해 상자성 화합물 (40) (도 5a)의 존재로, PEI / MNP 애플리케이션뿐만 아니라 형질 전환 세포뿐만 아니라, 동시 자화를 허용한다. 세포 내 철의 생성 양을 최적 범위 내의 모든인가 MNP 농도위한 MPS (도 5B)를 사용하여 측정 하였다 (2.5 pmol의 / cm 2은 miR; NP 25 ~ 25 ㎍ / ㎖의 MNP 보완) : 0.37 ± 0.079 0.7 ± 행 0.150 PG 철 / 셀 (17). 자기 분리 컬럼의 입증 된 바와 같이, 이러한 모든 MNP 농도를 들어, 형질 감염된 세포의 총 부피의 자기 응답 세포의 양이 70 % (도 5C) ~하다. 또한, H를 형질UVECs 마우스 조직의 감수성을 모방 체외 아가 팬텀 내부 MRI (도 5D)로 표시된다. 또한, 시험 관내에서 모사 동적 조건에서 형질 전환 된 HUVEC의 자기 타겟팅 효율 (도 6)으로 입증되었다. 이 실험 설정에서 문화 매체의 경우에도 지속적인 활발한 움직임은 자석 응용 근처 영역에서 세포의 성장을 널리 방지하지 않았다. <img alt="그림 1" src="/files/ftp_upload/55567/55567fig1.jpg" /> 그림 1. 자화은 miR-수정 된 HUVECs와 그 분석의 생산의 개략도. PEI는 / MNP (폴리에틸렌 이민 / 상자성 나노 입자 - 기반 벡터)는 인간 제대 정맥 내피 세포 (HUVEC에)에 마이크로 RNA (은 miR)를 제공하기 위해 적용된다. 얻어진 셀 제품은 다음과 같은 매개 변수에 의해 특징되어 안전 (포함한 세포 생존을 기능적성만 및 간 통신 용량); 형질 전환 효율 (즉, 미르 흡수 효율과 이후 기능); 정적 및 동적 시뮬레이션 조건에서 시험 관내 타겟팅 자석; 자기 공명 영상 (MRI) 검출. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/55567/55567fig2.jpg" /> 고립 된 HUVEC 2. 특성을 그림. 내피 CD31 마커로 염색 고립 배양 된 HUVECs의 A. 대표 이미지. 핵은 DAPI (파란색)으로 대조된다. 스케일 바는 20㎛가. 격리 된 HUVEC에서 수행 된 관 형성 어 세이의 결과 B. 주제; 화상은 레이저 스캐닝 공 초점 현미경을 사용하여 기록 하였다 (시차 간콘트라스트 ference) 기저막 매트릭스에서 세포 파종 후 18 시간. 스케일 바는 100 ㎛의 것이다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55567/55567fig3.jpg" /> PEI / MNP를 사용 된 HUVECs에 그림 3. 미르 배달. A. 태그 미르 통풍 관 (Cy3가 적색) 24 시간 후 형질 정상 세포 모양의 유지 (Cy3가 표지 된 미르 NP 25 MNP 25 ㎍ / mL의 2.5 pmol의 / cm 2)가 도시되어있다. 이미지는 514 nm의 여기 레이저 (Cy3에, 적색)과 미분 간섭 콘트라스트를 이용하여 공 초점 레이저 주사 현미경으로 촬영 하였다. 스케일 바는 50㎛의 것이다. B. 세포 생존율 24 시간 후 형질 감염은 유동 세포 계측법으로 측정 하였다. 플롯은 HUVEC에 대해 얻어진 결과를 나타낸다다음 복잡한 조성물로 처리 S : Cy3가 - 미르 2.5 pmol의 / cm 2; NP 비 25 MNPS 5 행 25 ㎍ / mL로 보충. (; SEM 오차 막대 N = 6)를 바 생존 세포의 평균 수와 전체 세포 집단의 비율을 나타낸다. 3 색의 구조적 C. 조명 현미경 (SIM)에 의해 촬상 된 HUVEC는 용해은 miR / PEI / MNP 착체 표지. 세포를 전술 한 바와 같이 배양 한 형질 감염 24 시간 후 처리를 고정시켰다; 핵은 DAPI으로 대조되었다. 원시 데이터는 SIM Z-스택에 기록 처리 하였다; 대표적인 이미지는 최대 강도 투영의 결과이다. 다음 여기 레이저 적용되었다 : 405 nm의 (DAPI 청색), 488 나노 미터 (Atto488-PEI, 오렌지), 565 나노 미터 (Atto565-MNP, 시안), 및 633 nm의 (-Cy5에 미르 적색). 스케일 바는 5㎛이다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/55567/55567fig4.jpg" /> 그림 4.은 miR / PEI / MNP와 HUVECs를 수정의 안전. 48 시간 후 처리] A. 관 형성 분석법 형질 세포 (NP 25 MNP 25 ㎍ / mL의 SCR-미르 2.5 pmol의 / cm 2)를 수행 하였다. 화상은 레이저 스캐닝 공 초점 현미경으로 수집 하였다 (즉, 미분 간섭 대비) 18 시간 기저막 매트릭스 세포 파종 후. 은 miR / PEI로 형질 된 HUVEC는 양성 대조군으로 독성 제어 및 미처리 세포로 사용 하였다. 스케일 바는 100 ㎛의 것이다. 플롯은 형질 HUVEC를 여러 개의 파라미터 미처리 세포의 비율을 반영 튜브 길이, 브랜치 수 및 분기점 (N = 3, 오차 막대 : SEM). B. 결과 miR / PEI / MNP 변성 된 HUVEC의 갭 정션 매개 세포 간 통신 평가 24 시간 후 transfec기. 이를 위해, 세포를 GJ 투과성 염료 칼 세인 (오렌지)로 로딩 하였다; (FRAP)을 photobleaching에 후 형광 복구 Z-스택의 시험 셀을 3D 스캐닝하여 조사 하였다. 대표적인 표백 전 칼 세인로드 셀의 이미지를 직접 표백 후 및 (회 형광)와 함께 15 분 후 표백 도시된다. 스케일 바는 20㎛가. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/55567/55567fig5.jpg" /> PEI / MNP 및 그 용도에 따른 형질도 5 셀 자화. 그들의 클러스터의 형태를 나타내는 TEM으로 촬영 여과 MNPS A.의 대표 이미지. 소형 - (초상 자성 결과) 싱글 산화철 입자 (~ 5 내지 15)은 이에이며확인했다. 스케일 바는 100 ㎚이다. B. 형질 감염된 세포의 세포 내로드 자분 분광법 (MPS) 24 시간 후 형질 감염에 의해 평가 하였다. 대표적인 패널 조사 샘플의 MPS 스펙트럼을 나타낸다. 특히 순수한 MNP 서스펜션 (50 μL)을 기준 (청색 사각형)로 제공; 회색 삼각형이 어떤 샘플없이 측정에 의해 얻어진 검출 배경 스펙트럼을 표시하면서 :; 원 두 형질 세포 샘플 (MNP 5 ㎍ / ㎖의 녹색 원 MNP 25 ㎍ / mL의 적색 원)의 MPS 스펙트럼이다. 진폭 (A)의 로그 스케일 참고. C.는 자기 변형 셀의 양은 형질 된 HUVEC의인가에 의해 정량화 하였다 (2.5 pmol의 / cm 2은 miR; NP 25 5-25 μg의 MNP의 / mL로 보충) 자기로 트립신 처리 24 시간 후 처리로 수집, 세포 분리 컬럼. 얻어진 자화 양성 분획 (즉, 열이 남아)계산 한 후, 형질 감염된 세포의 전량 중 그 비율은 각 MNP 농도 (적색 삼각형)에 대한 플롯에 반영된다. 세포 생존율이어서 트리 판 블루 배제 분석법 (회색 rhombuses)에 의해 검사 하였다. 데이터는 평균 ± SEM으로 제시된다 (N = 3). 형질 전환 된 HUVEC의 D. 예시 MRI 이미지 (300,000 세포 2.5 pmol의 / cm 2은 miR; NP 25 및 25 μg의 MNP의 / ㎖) 아가 팬텀에 매립은 7.1 T MRI 동물 시스템으로 기록 하였다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/55567/55567fig6.jpg" /> 시뮬레이션 동적 조건 미르 / PEI / MNP-된 HUVECs의 체외 자기 타겟팅에서 그림 6.. HUVECs를 24 시간 후 트랜를 수집이온 (2.5 pmol의 / cm 인 Cy3-미르 2; NP 25 MNP 25 ㎍ / ㎖) 및 다시 시드 로컬 측벽에 부착 된 작은 자석 웰 신선한 배지에서. 차례로,이 배양 용기는 150 rpm의 회전 진탕에 고정시켰다. 세포 부착 및 성장은 레이저 스캐닝 공 초점 현미경, PFA로 세포를 고정 DAPI 자신의 핵을 염색하고 수행하여 12 시간 후에 평가 하였다 (여기 레이저 : 블루 405 nm의 DAPI, 514 nm의 인 Cy3, 오렌지). 대표적인 이미지는 자석 응용 프로그램 영역의 세포 증식을 도시한다; 자석 응용 프로그램없이; 액체의 흐름은 세포 농축 하였다 웰 배양의 중심이다. 스케일 바는 50 μm의 수 있습니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다.

준비 및<em&gt; 체외</em&gt; 자화 특성의 내피 세포를 미르 변성

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Nanyang Technological University

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K 조회수.  University of Rostock.  이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다. 

비디오: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full thickness corneal transplantation has been the treatment to restore sight in those limited by corneal disease. Some disadvantages to this approach include a high degree of post-operative astigmatism, lack of predictable refractive outcome, and disturbance to the ocular surface. The development of Descemet's stripping endothelial keratoplasty (DSEK), transplanting only the posterior corneal stroma, Descemet's membrane, and endothelium, has dramatically changed treatment of corneal endothelial disease. DSEK is performed through a smaller incision; this technique avoids 'open sky' surgery with its risk of hemorrhage or expulsion, decreases the incidence of postoperative wound dehiscence, reduces unpredictable refractive outcomes, and may decrease the rate of transplant rejection3-6.
Initially, cornea donor posterior lamellar dissection for DSEK was performed manually1 resulting in variable graft thickness and damage to the delicate corneal endothelial tissue during tissue processing. Automated lamellar dissection (Descemet's stripping automated endothelial keratoplasty, DSAEK) was developed to address these issues. Automated dissection utilizes the same technology as LASIK corneal flap creation with a mechanical microkeratome blade that helps to create uniform and thin tissue grafts for DSAEK surgery with minimal corneal endothelial cell loss in tissue processing.
Eye banks have been providing full thickness corneas for surgical transplantation for many years. In 2006, eye banks began to develop methodologies for supplying precut corneal tissue for endothelial keratoplasty. With the input of corneal surgeons, eye banks have developed thorough protocols to safely and effectively prepare posterior lamellar tissue for DSAEK surgery. This can be performed preoperatively at the eye bank. Research shows no significant difference in terms of the quality of the tissue7 or patient outcomes8,9 using eye bank precut tissue versus surgeon-prepared tissue for DSAEK surgery. For most corneal surgeons, the availability of precut DSAEK corneal tissue saves time and money10, and reduces the stress of performing the donor corneal dissection in the operating room. In part because of the ability of the eye banks to provide high quality posterior lamellar corneal in a timely manner, DSAEK has become the standard of care for surgical management of corneal endothelial disease.
The procedure that we are describing is the preparation of the posterior lamellar cornea at the eye bank for transplantation in DSAEK surgery (Figure 1).

Endothelial corneal transplantation is a surgical technique for treatment of posterior corneal diseases. Mechanical microkeratome dissection to prepare tissue results in thinner, more symmetric grafts with less endothelial cell loss and improved outcomes. Dissections can be performed at the eye bank prior to corneal transplantation surgery.

내피 Keratoplasty을위한 각막 기증자 조직 준비

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

연구

의학

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

인간 치과 펄프의 줄기 세포의 분리, 특성화 및 비교 차별화 두 가지 방법을 사용하여 영구 치아에서 파생

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying mechanisms involved in it are useful for treatment. There are both in vivo and in vitro methods available for this purpose. In vivo models can mimic actual head injury as it occurs during TBI. However, in vivo techniques may not be exploited for studies at the cell physiology level. Hence, in vitro methods are more advantageous for this purpose since they provide easier access to the cells and the extracellular environment for manipulation.
Our protocol presents an in vitro model of TBI using stretch injury in brain microvascular endothelial cells. It utilizes pressure applied to the cells cultured in flexible-bottomed wells. The pressure applied may easily be controlled and can produce injury that ranges from low to severe. The murine brain microvascular endothelial cells (cEND) generated in our laboratory is a well-suited model for the blood brain barrier (BBB) thus providing an advantage to other systems that employ a similar technique. In addition, due to the simplicity of the method, experimental set-ups are easily duplicated. Thus, this model can be used in studying the cellular and molecular mechanisms involved in TBI at the BBB.

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

In vitro traumatic brain injury models are being developed to reproduce in vivo brain deformation. Stretch-induced injury has been employed for astrocytes, neurons, glial cells, aortic, and brain endothelial cells. However, our system uses a blood brain barrier (BBB) model that possesses properties constituting a legitimate model of the BBB to establish an in vitro&#160;TBI model.

로 뇌 미세 혈관 내피 세포 (CEnd를)에 기지개<em&gt; 체외</em혈액 뇌 장벽의&gt; 외상성 뇌 손상 모델

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to extravasate and form a secondary niche.&#160;The extravasation of tumor cells from the blood vascular system can be studied using endothelial cells (ECs) and tumor cells obtained from different cell lines.&#160;Initial studies were conducted using static conditions but it has been well documented that ECs behave differently under physiological flow conditions.&#160;Therefore, different flow chamber assemblies are currently being used to studying cancer cell interactions with ECs.&#160;Current flow chamber assemblies offer reproducible results using either different cell lines or fluid at different shear stress conditions.&#160;However, to observe and study interactions with rare cells such as circulating tumor cells (CTCs), certain changes are required to be made to the conventional flow chamber assembly.&#160;CTCs are a rare cell population among millions of blood cells. Consequently, it is difficult to obtain a pure population of CTCs.&#160;Contamination of CTCs with different types of cells normally found in the circulation is inevitable using present enrichment or depletion techniques.&#160;In the present report, we describe a unique method to fluorescently label circulating prostate cancer cells and study their interactions with ECs in a self-assembled flow chamber system.&#160;This technique can be further applied to observe interactions between prostate CTCs and any protein of interest.

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Our report describes a unique method to visualize and analyze CTC/EC interactions in prostate cancer under physiological flow conditions.

환자와 인간의 내피 세포에서 파생 된 전립선 순환 종양 세포 사이에 E-셀렉틴 매개 상호 작용을 관찰하는 시험 관내 방법에

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, along with its basement membrane (Descemet&#39;s membrane) is introduced onto the recipient&#39;s posterior stroma3. Unlike Descemet&#8217;s Stripping Automated Endothelial Keratoplasty (DSAEK), where additional donor stroma is introduced, no unnatural stroma-to-stroma interface is created. As a result, the natural anatomy of the cornea is preserved as much as possible allowing for improved recovery time and visual acuity4. Endothelial Keratoplasty (EK) is the procedure of choice for treatment of endothelial dysfunction. The advantages of EK include rapid recovery of vision, preservation of ocular integrity and minimal refractive change due to use of a small, peripheral incision1. DSAEK utilizes donor tissue prepared with partial thickness stroma and endothelium. The rapid success and utilization of this procedure can be attributed to availability of eye-bank prepared precut tissue. The benefits of eye-bank preparation of donor tissue include elimination of need for specialized equipment in the operating room and availability of back up donor tissue in case of tissue perforation during preparation. In addition, high volume preparation of donor tissue by eye-bank technicians may provide improved quality of donor tissue. DSAEK may have limited best corrected visual acuity due to creation of a stromal interface between the donor and recipient cornea. Elimination of this interface with transplantation of only donor Descemet&#39;s membrane and endothelium in DMEK may improve visual outcomes and reduce complications after EK5. Similar to DSAEK, long term success and acceptance of DMEK is dependent on ease of availability of precut, eye-bank prepared donor tissue. Here we present a stepwise approach to donor tissue preparation which may reduce some barriers eye-banks face in providing DMEK grafts.

Endothelial keratoplasty is a surgical technique continuously evolving as advancements result in transplantation of thinner grafts with each succession1. Here we present a technique for controlled manual tissue dissection to allow safe and repeatable separation of endothelium and Descemet&#39;s membranes from donor corneoscleral buttons for transplantation2.

데스 메막 내피 각막 이식을위한 각막 기증자의 조직 준비

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The approach allows unbiased identification and functional characterization of individual colorectal afferents. Extracellular recordings of propagated action potentials (APs) that originate from one or a few afferent (i.e., single-fiber) receptive fields (RFs) in the colorectum are made from teased nerve fiber fascicles. The colorectum is removed with either the pelvic (PN) or lumbar splanchnic (LSN) nerve attached and opened longitudinally. The tissue is placed in a recording chamber, pinned flat and perfused with oxygenated Krebs solution. Focal electrical stimulation is used to locate the colorectal afferent endings, which are further tested by three distinct mechanical stimuli (blunt probing, mucosal stroking and circumferential stretch) to functionally categorize the afferents into five mechanosensitive classes. Endings responding to none of these mechanical stimuli are categorized as mechanically-insensitive afferents (MIAs). Both mechanosensitive and MIAs can be assessed for sensitization (i.e., enhanced response, reduced threshold, and/or acquisition of mechanosensitivity) by localized exposure of RFs to chemicals (e.g., inflammatory soup (IS), capsaicin, adenosine triphosphate (ATP)). We describe the equipment and colorectum&#8211;nerve recording preparation, harvest of colorectum with attached PN or LSN, identification of RFs in the colorectum, single-fiber recording from nerve fascicles, and localized application of chemicals to the RF. In addition, challenges of the preparation and application of standardized mechanical stimulation are also discussed.

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates a protocol for conducting single-fiber electrophysiological recordings on an in vitro mouse colorectum-nerve preparation.

마우스 대장 수입 성의 엔딩의 생체 기능 특성에

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

종양 특이 내피 세포의 분리 및 문화 확장

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

개 동맥과 정맥에서 차 내피 세포의 분리 및 문화

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...