S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

이 실험에서는 스트렙토 diastatochromogenes 게놈의 코스 미드 라이브러리를 생성하고 매우 시간 소모적 인 과정을 통해 polyketomycin 유전자 클러스터의 식별 결과 오래전 스크리닝 하였다. 단일 유전자의 특성은 타겟 유전자 삭제하고, 생성 된 돌연변이 체 (12)의 분석을 통해 가능했다. 최근, S.의 diastatochromogenes 초안 게놈 서열은 polyketomycin 생합성 유전자 클러스터의 빠른 확인을 가능하게 얻었다. 초안 게놈 시퀀스는 여전히 많은 콘티가 포함되어 있지만, 우리는 쉽게 생합성 유전자를 검출 할 수있다. 설명 된 과정은 개월 이내에 달성 될 수있다. 그러나, 절차는 다수의 단계를 포함한다. 단일 단계는 다음 단계로의 진행을 방지하는 여러 번 실패 할 수있다 : 속은 스트렙토 생리 활성 화합물을 생성하는 능력에 대해 공지되어있다. 그들은 종종 20 개 이상의 바이오스를 수행하는 동안일반적으로 하나 또는 두 화합물은 실험실 조건에서 일어난다 ynthetic 유전자 클러스터. 침묵 유전자 클러스터를 깨울 수있는 OSMAC 방식 (다른 조건에서 하나의 균주의 배양)의 적용은 때로는 충분하지 않을 수 있습니다. 예다면 발현 성 조절 유전자 ADPA 44, 45, 46 등 bldA 조절 유전자의 유전자 조작은, 다른 이차 대사 산물의 생산을 활성화 할 수있는 효과적인 방법이다. NMR 분석에 의해 예 화합물의 구조 규명을 위해, 정제 된 화합물을 일반적으로 2 개 이상의 밀리그램이 필요하다. 따라서, 10 개 이상의 L 문화의 발효는 종종 필요합니다. 산소, pH 및 온도 조건을 유지 할 수있는 발효기없이, 문화 및 후속 추출이 양을 처리 할 수있는 작은 실험실에서 어려울 수 있습니다. 정제 중에, 상기 화합물은 산화에 의한 방사선 또는 온도로 변경 될 수있다.또한, 이상의 정제 단계는 높은 분해의 가능성을 사용한다. 천연 생성물의 구조 및 게놈 클러스터를 분석 할 때, 때때로 해당하는 클러스터를 식별하는 것을 용이하지 않다. 단지 초안 게놈 시퀀스가있는 경우 첫째, 클러스터의 일부가 누락 될 수 있습니다. 둘째, 생합성에 필요한 모든 유전자 클러스터에 있지. 셋째, 때때로 많은 클러스터 킬로베이스가 서로 분리 된 두 부분으로 분할된다. 넷째, 적절한 유전자 클러스터 어느 하나를 결정하기 어려울 수있다. 이 모듈의 개수에 기초하여 확장 유닛의 개수를 계산, 또는 상기 선택 영역을 분석하여 하나의 확장 유닛을 식별 할 수있다 큰 PKS 유형 I 또는 NRPS 시스템의 경우에, 쉽게집니다. 그러나, 반복적으로 작동하는 경우에, 합성 화합물의 예측 특히 STRA 경우가 종종 불가능 효소에 40 개 이상의 유전자 클러스터를 보유하고 있습니다. 다섯째, 자연은 매우 복잡하고 아직 알 수없는 화합물이 가득합니다. 종종 다른 생합성 경로의 혼합물이다. 신규 화합물은 다른 화합물에 관한 아직 식별 여부되지 않는다면 생합성 모델을 제안하고 증명 클러스터를 식별하기 어려울 수있다. 클러스터가 식별되면, 단일 크로스 오버 기술은 가정을 확인하는 것이 빠른 방법이다. PCR, 자살 벡터, 접합, 긍정적 인 클론의 선택, 생산 분석에 복제에 필요한 유일한 단계입니다. 이 기법의 단점은 염색체 내로 벡터의 통합으로 인해 상기 재조합으로 안정하지 않다는 것이다. 따라서, 상기 하나의 유전자를 분석하기 위하여, 정확한 유전자 결실이 필요하다. 또한 그것은 유전자 수준에서 스트렙토 마이 세스 (Streptomyces) 균주를 조작하는 까다로운 일이 될 수 있습니다. 설명 된 절차는 t을 할당 할 수 있습니다방선균 또는 다른 미생물에 의해 생성 된 임의의 다른 화합물을 오. 생합성 유전자 클러스터 및 합성 화합물에 대한 지식은 우리에게 다제 내성 병원균과의 싸움을 위해 그들을 향상을 목표로 기존의 분자를 수정할 수있는 추가 기회를 제공합니다.

식물과 미생물로부터 천연 제품은 항상 임상 약물 개발 및 연구를위한 중요한 원천이었다. 최초의 항생제 페니실린은 알렉산더 플레밍 (1)에 의해 곰팡이에서 1928 년에 발견되었다. 요즘, 많은 천연 제품은 임상 치료에 사용된다. 다른 생리 활성 이차 대사 산물의 다양한 종류를 생산하는 자사의 능력에 대해 알려진 하나 속 스트렙토 마이 세스입니다. 스트렙토 마이 세스 (Streptomyces)은 그람 양성 세균과 방선균의 클래스와 순서 방선균 목에 속한다. 임상 적으로 사용되는 항생제의 거의 3 분의 2는 3 테트라 사이클린 4 daptomycin, 암포 테리 신 2와 같이 주로 스트렙토 마이 세스 (Streptomyces)에서, 방선균 목에서 파생됩니다. 두 노벨상은 스트렙토 마이 세스 (Streptomyces) 항생제 연구의 분야에서 수상했습니다. 첫번째는 스트렙토 마이신의 발견은 먼저 대한 셀만 브와 왁스 갔다결핵에 대한 효과적인 tibiotic. 5 2015 년, 생리학 및 의학 노벨상의 일환으로, S.의 avermitilis에서 avermectin에의 발견은 물론 수상했다. avermectin에 기생 -6,7- 질환의 치료에 사용된다. 예컨대 스트렙토 같은 미생물 천연 제품의 발견에 대한 전통적인 접근은 일반적으로 다른 성장 조건 하에서 배양 균주뿐 아니라 추출 및 이차 대사 산물의 분석을 포함한다. 생체 활성 분석 (항균 항암 활성에 대한 분석은 예) 화합물의 활성을 검출하기 위해 수행된다. 마지막으로, 관심있는 화합물을 분리하였고, 화학 구조가 밝혀져있다. 천연물의 구조는 종종 복잡한 분자 형성되어 단일 부분으로 구성된다. 블록 건물로 이어지는 몇 가지 있지만, 제한, 주요 생합성 경로가 있습니다자연 산물의 생합성에 사용되는 KS. 주요 생합성 경로는 설탕 부분으로 이어지는 폴리 케 티드 경로, 아미노산을 사용 테르 페 노이드 및 알칼로이드, 경로으로 이어지는 경로 및 경로입니다. 각 경로는 특정 효소 (8)의 집합을 특징으로한다. 화합물의 구조를 기반으로 이러한 생합성 효소가 예측 될 수있다. 오늘날, 차세대 시퀀싱 및 생물 정보학적인 분석과 함께 화합물의 상세한 구조 분석을 담당 생합성 유전자 클러스터를 식별 할 수있다. 클러스터 정보는 더 자연 제품 연구에 대한 새로운 방법을 연다. 이 유전자 삭제 또는 변경 및 기타 경로에서 유전자 조합 생합성에 의해 천연 제품의 수율, 목표 화합물의 변형을 증가시키는 이종 표현을 포함한다. Polyketomycin은의 배양액으로부터 독립적으로 분리 하였다두 균주 스트렙토 마이 세스 특검팀. MK277-AF1 9 스트렙토 마이 세스 (Streptomyces) diastatochromogenes Tü6028 10. 구조는 NMR 및 X 선 분석에 의해 밝혀졌다. Polyketomycin는 β-D-amicetose와 α-L-axenose 두 디 옥시 당 부분으로 연결하는 테트라 decaketid 및 다이 메틸 살리실산으로 구성되어있다. 그것은 심지어 MRSA (11) 그람 양성 다제 내성 균주에 대해, 세포 독성 항생제 활동을 표시합니다. S. diastatochromogenes Tü6028의 게놈 코스 미드 라이브러리를 생성하고 몇 년 전에 상영되었다. (41) 유전자를 포함, 52.2 킬로바이트의 크기로 polyketomycin 유전자 클러스터를 특정 유전자를 프로브를 사용하여 강렬한 작품 12의 몇 달 후 확인되었다. 최근, S.의 diastatochromogenes 초안 게놈 서열은 polyketomycin 생합성 유전자 클러스터의 빠른 확인 선도 얻었다. 이러한 개요에서, 방법은 아이덴 돕는천연물을 tify 및 생합성 유전자 클러스터는 예를 들어 polyketomycin하여 설명한다 명료. 여기에서 우리는 스트렙토 마이 세스 (Streptomyces) diastatochromogenes Tü6028에 의해 생성 polyketomycin에 대해 도시의 생합성 유전자 클러스터에 천연 제품에서 이어지는 하나의 단계를 설명합니다. 프로토콜은 항생 물질 특성을 갖는 천연 생성물의 동정 및 정제를 포함한다. 또한 구조 분석 및 생합성 유전자 클러스터의 식별에 게놈 마이닝 리드의 결과와 비교. 이 절차는 방선균 또는 다른 미생물 유래의 다른 화합물에도 적용 할 수있다.

<table><tbody><tr><td>agar</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>5210.4</td><td></td></tr><tr><td>agarose</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6352.4</td><td></td></tr><tr><td>D-mannitol&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>4175.1</td><td></td></tr><tr><td>glucose&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6780.1</td><td></td></tr><tr><td>LB&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X964.3</td><td></td></tr><tr><td>malt extract&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X976.2</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>2189.1</td><td></td></tr><tr><td>Peptone&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td></td></tr><tr><td>soy flour&amp;nbsp;</td><td>W.Schoenemberger GmbH, Magstadt, Germany</td><td></td><td>Hensec-Vollsoja</td></tr><tr><td>tryptic soy broth</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X938.3</td><td>Caso-Bouillon</td></tr><tr><td>yeast extract&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>2363.2</td><td></td></tr><tr><td>&lt;strong&gt;Solvents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Acetic acid</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>3738.5</td><td></td></tr><tr><td>Acetone&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>9372.2</td><td></td></tr><tr><td>Acetonitrile</td><td>Avantor Performance Materials B.V., Deventer, The Netherlands</td><td>JT-9012-03</td><td></td></tr><tr><td>Dichlorofrom&amp;nbsp;</td><td>Fisher Scientific GmbH, Schwerte, Germany</td><td>1530754</td><td></td></tr><tr><td>DMSO (Dimethyl sulfoxide)</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>4720.1</td><td></td></tr><tr><td>DMSO-d&lt;sub&gt;6&lt;/sub&gt; (Dimethyl sulfoxide-d&lt;sub&gt;6&lt;/sub&gt;) 99.9 atom% D</td><td>ARMAR Chemicals, D&amp;ouml;ttingen, Switzerland</td><td>15200.204</td><td></td></tr><tr><td>Ethyl acetate</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6784.4</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6331.4</td><td></td></tr><tr><td>Methanol</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>7342.1</td><td></td></tr><tr><td>&lt;strong&gt;Enzymes&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>restriction enzymes</td><td>New England Biolabs GmbH, Frankfurt am Main, Germany</td><td></td><td></td></tr><tr><td>polymerase&amp;nbsp;</td><td>New England Biolabs GmbH, Frankfurt am Main, Germany</td><td></td><td></td></tr><tr><td>DNA Polymerase I Large (Klenow) Fragment</td><td>Promega GmbH, Mannheim, Germany</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Antibiotics&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>apramycin</td><td>AppliChem GmbH, Darmstadt, Germany&amp;nbsp;</td><td>A7682.0005</td><td></td></tr><tr><td>fosfomycin</td><td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td><td>P5396-50G</td><td></td></tr><tr><td>kanamycin</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>T832.2</td><td></td></tr><tr><td>&lt;strong&gt;Plasmid/Vectors&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pKC1132</td><td>Bierman &lt;em&gt;et al.&lt;/em&gt; 1992</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pokPI_for</td><td>TGATGGTGCCGCTGGCCATGG</td><td>Primer to amplify fragment containing pokPI gene</td><td></td></tr><tr><td>pokPI_rev</td><td>AGCGTTCACTGTTCCGCCCGAC</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Bacterial strains&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;Bacillus subtilis&lt;/em&gt; COHN ATCC6051</td><td></td><td>Gram-positive test strain&amp;nbsp;</td><td></td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt; ET12567 pUZ8002&amp;nbsp;</td><td>MacNeil &lt;em&gt;et al.&lt;/em&gt; 1992</td><td>strain for conjugation</td><td></td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt; XL1 Blue</td><td>Agilient Technologies, Santa Clara, USA</td><td>Gram-negative test strain + cloning host&amp;nbsp;</td><td></td></tr><tr><td>&lt;em&gt;Streptomyces diastatochromogenes&lt;/em&gt; T&amp;uuml;6028</td><td>Paululat &lt;em&gt;et al.&lt;/em&gt;, 1999</td><td>Polyketomycin producer</td><td></td></tr><tr><td>&lt;strong&gt;Online services&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td><td>http://antismash.secondarymetabolites.org/</td><td>Detection of secondary metabolite gene cluster</td><td></td></tr><tr><td>BLAST (Basic Local Alignment Search Tool)</td><td>http://blast.ncbi.nlm.nih.gov/Blast.cgi</td><td>finds regions of similarity between biological sequences</td><td></td></tr><tr><td>GenDB</td><td>https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td><td>http://mibig.secondarymetabolites.org/</td><td>Database of biosyntetic gene clusters</td><td></td></tr><tr><td>NaPDoS</td><td>http://napdos.ucsd.edu/</td><td>Detection of seconary metabolite gene cluster</td><td></td></tr><tr><td>NCBI Prokaryotic Genome Annotation Pipeline</td><td>http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>NRPSpredictor</td><td>http://nrps.informatik.uni-tuebingen.de/</td><td>Detection of NRPS domains</td><td></td></tr><tr><td>Prokka (rapid prokaryotic genome annotation)</td><td>http://www.vicbioinformatics.com/software.prokka.shtml</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>RAST (rapid annotation using subsystems technology)</td><td>http://rast.nmpdr.org/</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>&lt;strong&gt;Other programs&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Chem Station Rev. A.09.03</td><td>Agilent Technologies, Waldbronn, Germany</td><td>Handling program for HPLC&amp;nbsp;</td><td></td></tr><tr><td>Clone Manager Suite 7</td><td>Scientific and Educational Software, Cary, USA</td><td>Designing Cloning Experiment&amp;nbsp;</td><td></td></tr><tr><td>Newbler v2.8</td><td>Roche Diagnostics</td><td>Alignment of sequencing reads</td><td></td></tr><tr><td>&lt;strong&gt;Machines&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Centrifuge Avanti J-6000, Rotor JA-10</td><td>Beckman Coulter GmbH, Krefeld, Germany</td><td></td><td></td></tr><tr><td>HPLC/MS</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Autosampler: G1313A</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Column:Xbridge C18 (100 mm &amp;times; 4.6 mm; Particle size: 3.5 &amp;mu;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Degasser: G1322A&amp;nbsp;</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Quarternary pump: G1311A</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Diode array detector (DAD )G1315B (&amp;lambda; = 254 nm and 400 nm)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>rotary evaporator</td><td></td><td></td><td></td></tr><tr><td>_heating bath Hei-VAP Value/G3</td><td>Heidolph Instruments GmbH &amp;amp; Co.KG, Schwabach, Germany</td><td></td><td></td></tr><tr><td>_vacuum pump system SC 920 G</td><td>KNF&amp;nbsp;Global Strategies&amp;nbsp;AG, Sursee, Switzerland</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Other material&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Sephadex LH20</td><td>GE Healthcare,&amp;nbsp;</td><td></td><td></td></tr><tr><td>Chromafil PVDF-45/15MS (pore size 0.45 &amp;micro;m; filter &amp;Oslash;15 mm)</td><td>MACHEREY-NAGEL GmbH &amp;amp; Co. KG, D&amp;uuml;ren, Germany</td><td></td><td></td></tr><tr><td>SPE column Oasis HLB 20 35 cc (6g)</td><td>Waters GmbH, Eschborn, Germany&amp;nbsp;</td><td></td><td></td></tr><tr><td>&lt;em&gt;E. coli&amp;nbsp;&lt;/em&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: LB, Composition: LB, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>&lt;em&gt;Bacillus&amp;nbsp;&lt;/em&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: LB, Composition: LB, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>&lt;em&gt;Streptomyces&lt;/em&gt; sp.</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 30 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 10 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Peptone, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Glucose, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td colspan="4">for agar plates add 2% agar</td></tr></tbody></table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

스트렙토 균주 다양한 생리 활성을 가진 다른 화합물을 많이 생성하는 그들의 능력에 대해 공지되어있다. 상이한 조건에서 배양들은 신규 화합물의 생산 효율을 높일 수있다. 따라서, 생산 균주의 배양 물을 에틸 아세테이트로 추출하고, 조 추출물을 HPLC에 의해 분석된다. 또한, 추출물 다른 분석하여 자신의 생체 활성에 대해 시험한다. 구조 해명 들어 관심의 화합물은 다른 크로마토 그래피 방법의 조합에 의해 정제한다. 게놈 마이닝 결합 게놈 서열은 다른 컴퓨터 프로그램을 사용 천연물 생합성 유전자 클러스터의 식별을 허용한다. 유전자 비활성화 실험을 수행 할 수 있고, 정확한 유전자 클러스터가 발견되었음을 확인한다. 생성 된 돌연변이 체는 특히 천연 제품의 생산에 대해 분석한다. 정확한 유전자 클러스터가 비활성화되면,균주의 화합물을 제조하는 데 실패한다. 워크 플로는 스트렙토 마이 세스 (Streptomyces) diastatochromogenes Tü6028에 의해 생성 된 항균 화합물 polyketomycin에 대해 표시됩니다. 게놈 시퀀싱은 여전히 ​​매우 비싼 때 약 10 년 전, 유전자 클러스터의 복제 및 식별은 매우 시간이 많이 소요되는 과정이었다. 게놈 마이닝과 함께 빠른 게놈 시퀀싱 클러스터 식별 재판을 가속화하고 새로운 방법 생합성을 탐구하고 유전 적 방법으로 새로운 천연 제품을 생성하기 위해 열립니다. 이 논문에 기재된 프로토콜은 방선균 또는 다른 미생물 유래의 다른 화합물에 할당 될 수있다.

이 개요에서 우리는 그 생합성 유전자 클러스터에 이르는 항생제의 식별에서 하나의 단계를 설명합니다. 몇 년 전 우리가 파지로 그들을 패키지 코스 미드 라이브러리를 복제, 대장균 숙주 세포를 형질 도입하고, polyketomycin 클러스터의 중복 영역을 갖는 클론을 식별하기 위해 식민지의 수천을 선별했다. 코스 미드의 시퀀싱도 어렵고 비용 처리 (12)이었다. 변형에 대한 추가 연구를 수행하기 위해 우리는 스트렙토 마이 세스 (Streptomyces) diastatochromogenes Tü6028의 전체 게놈 염기 서열. 초안 게놈 시퀀스를 통해 우리가 쉽게 polyketomycin 유망한 화합물을 인코딩 다른 클러스터의 생합성 유전자 클러스터를 확인했다. 도 7은 코스 미드 라이브러리 스크리닝 정교한 클로닝하여 생합성 클러스터를 식별하는 &quot;이전&quot;방법을 비교하고,거친 시간 척도에 후속 게놈 마이닝과 전체 게놈 시퀀싱에 의해 &quot;새로운&quot;방법. 새로운 시퀀싱 기술 및 새로운 게놈 마이닝 프로그램은 전체 프로세스의 속도. <img alt="그림 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> 그림 7 : 생합성 유전자 클러스터 할당의 &quot;이전&quot;과 &quot;새로운&quot;방법의 비교. &quot;오래된&quot;방법은 양성 클론의 선택과 각 코스 미드 (들)의 시퀀스와 코스 미드 라이브러리의 클로닝 (위)와; &quot;새로운&quot;방법은 전체 게놈 시퀀싱 및 변형 (아래)의 게놈에있는 모든 보조 대사 유전자 클러스터를 식별하기 위해 -mining를 포함한다. 단일 단계의 소요 시간은 대략적인 시간 스케일에 표시됩니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

다음은 (A) 항균 활성을 갖는 천연 제품의 식별, (B) 화합물의 정제 (C)의 생합성의 첫 모델 (D) 게놈 시퀀싱 / -mining 및 상세한 프로토콜을 제시 ( E) 생합성 유전자 클러스터의 확인.

에서 Polyketomycin를 사용하여 데모 : 그 생합성 유전자 클러스터에 천연 제품에서<em&gt; 스트렙토 마이 세스 (Streptomyces)의 diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

from-natural-product-to-its-biosynthetic-gene-cluster-demonstration

Nanyang Technological University

Research

JoVE Journal

Genetics

17.1K 조회수.  Albert-Ludwigs-Universität Freiburg, Germany.  다음은 (A) 항균 활성을 갖는 천연 제품의 식별, (B) 화합물의 정제 (C)의 생합성의 첫 모델 (D) 게놈 시퀀싱 / -mining 및 상세한 프로토콜을 제시 ( E) 생합성 유전자 클러스터의 확인. 

비디오: From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028

Genetic Engineering of an Unconventional Yeast for Renewable Biofuel and Biochemical Production

Yarrowia lipolytica is a non-pathogenic, dimorphic and strictly aerobic yeast species. Owing to its distinctive physiological features and metabolic characteristics, this unconventional yeast is not only a good model for the study of the fundamental nature of fungal differentiation but is also a promising microbial platform for biochemical production and various biotechnological applications, which require extensive genetic manipulations. However, genetic manipulations of Y. lipolytica have been limited due to the lack of an efficient and stable genetic transformation system as well as very high rates of non-homologous recombination that can be mainly attributed to the KU70 gene. Here, we report an easy and rapid protocol for the efficient genetic transformation and for gene deletion in Y. lipolytica Po1g. First, a protocol for the efficient transformation of exogenous DNA into Y. lipolytica Po1g was established. Second, to achieve the enhanced double-crossover homologous recombination rate for further deletion of target genes, the KU70 gene was deleted by transforming a disruption cassette carrying 1 kb homology arms. Third, to demonstrate the enhanced gene deletion efficiency after deletion of the KU70 gene, we individually deleted 11 target genes encoding alcohol dehydrogenase and alcohol oxidase using the same procedures on the KU70 knockout platform strain. It was observed that the rate of precise homologous recombination increased substantially from less than 0.5% for deletion of the KU70 gene in Po1g to 33%-71% for the single gene deletion of the 11 target genes in Po1g KU70&#916;. A replicative plasmid carrying the hygromycin B resistance marker and the Cre/LoxP system was constructed, and the selection marker gene in the yeast knockout strains was eventually removed by expression of Cre recombinase to facilitate multiple rounds of targeted genetic manipulations. The resulting single-gene deletion mutants have potential applications in biofuel and biochemical production.

We herein report methods on the molecular genetic manipulation of the Yarrowia lipolytica Po1g strain for improved gene deletion efficiency. The resulting engineered Y. lipolytica strains have potential applications in biofuel and biochemical production.

신 재생 바이오 연료 및 생물 생산에 대한 자유로운 효모의 유전 공학

Yarrowia lipolytica is a non-pathogenic, dimorphic and strictly aerobic yeast species. Owing to its distinctive physiological features and metabolic ...

연구

유전학

Genetic Incorporation of Biosynthesized L-dihydroxyphenylalanine (DOPA) and Its Application to Protein Conjugation

L-dihydroxyphenylalanine (DOPA) is an amino acid found in the biosynthesis of catecholamines in animals and plants. Because of its particular biochemical properties, the amino acid has multiple uses in biochemical applications. This report describes a protocol for the genetic incorporation of biosynthesized DOPA and its application to protein conjugation. DOPA is biosynthesized by a tyrosine phenol-lyase (TPL) from catechol, pyruvate, and ammonia, and the amino acid is directly incorporated into proteins by the genetic incorporation method using an evolved aminoacyl-tRNA and aminoacyl-tRNA synthetase pair. This direct incorporation system efficiently incorporates DOPA with little incorporation of other natural amino acids and with better protein yield than the previous genetic incorporation system for DOPA. Protein conjugation with DOPA-containing proteins is efficient and site-specific and shows its usefulness for various applications. This protocol provides protein scientists with detailed procedures for the efficient biosynthesis of mutant proteins containing DOPA at desired sites and their conjugation for industrial and pharmaceutical applications.

Genetic Incorporation of Biosynthesized L-dihydroxyphenylalanine DOPA and Its Application to Protein Conjugation

Here, we present a protocol for the genetic incorporation of L-dihydroxyphenylalanine biosynthesized from simple starting materials and its application to protein conjugation.

Biosynthesized L-dihydroxyphenylalanine (DOPA) 및 단백질 활용의 응용의 유전 결합

L-dihydroxyphenylalanine (DOPA) is an amino acid found in the biosynthesis of catecholamines in animals and plants. Because of its particular biochemical ...

생화학

Biosynthesis of a Flavonol from a Flavanone by Establishing a One-pot Bienzymatic Cascade

Flavonols are a major subclass of flavonoids with a variety of biological and pharmacological activities. Here, we provide a method for the in vitro enzymatic synthesis of a flavonol. In this method, Atf3h and Atfls1, two key genes in the biosynthetic pathway of the flavonols, are cloned and overexpressed in Escherichia coli. The recombinant enzymes are purified via an affinity column and then a bienzymatic cascade is established in a specific synthetic buffer. Two flavonols are synthesized in this system as examples and determined by TLC and HPLC/LC/MS analyses. The method displays obvious advantages in the derivation of flavonols over other approaches. It is time- and labor-saving and highly cost-effective. The reaction is easy to be accurately controlled and thus scaled up for mass production. The target product can be purified easily due to the simple components in the system. However, this system is usually restricted to the production of a flavonol from a flavanone.

The derivation of a flavonol is crucial for its application in healthcare and the food industry. Here, we provide a detailed protocol for the biosynthesis of a flavonol from a flavanone and discuss the crucial steps and its advantages over other approaches.

플라바놀에서 플라보놀의 생합성은 원팟 비엔자이매틱 캐스케이드를 확립하여

Flavonols are a major subclass of flavonoids with a variety of biological and pharmacological activities. Here, we provide a method for the in vitro ...

A Customizable Approach for the Enzymatic Production and Purification of Diterpenoid Natural Products

Diterpenoids form a diverse class of small molecule natural products that are widely distributed across the kingdoms of life and have critical biological functions in developmental processes, interorganismal interactions, and environmental adaptation. Due to these various bioactivities, many diterpenoids are also of economic importance as pharmaceuticals, food additives, biofuels, and other bioproducts. Advanced genomics and biochemical approaches have enabled a rapid increase in the knowledge of diterpenoid-metabolic genes, enzymes, and pathways. However, the structural complexity of diterpenoids and the narrow taxonomic distribution of individual compounds in often only a single species remain constraining factors for their efficient production. Availability of a broader range of metabolic enzymes now provide resources for producing diterpenoids in sufficient titers and purity to facilitate a deeper investigation of this important metabolite group. Drawing on established tools for microbial and plant-based enzyme co-expression, we present an easily operated and customizable protocol for the enzymatic production of diterpenoids in either Escherichia coli or Nicotiana benthamiana, and the purification of desired products via silica chromatography and semi-preparative HPLC. Using the group of maize (Zea mays) dolabralexin diterpenoids as an example, we highlight how modular combinations of diterpene synthase (diTPS) and cytochrome P450 monooxygenase (P450) enzymes can be used to generate different diterpenoid scaffolds. Purified compounds can be used in various downstream applications, such as metabolite structural analyses, enzyme structure-function studies, and in vitro and in planta bioactivity experiments.

Here we present easy to use protocols for producing and purifying diterpenoid metabolites through the combinatorial expression of biosynthetic enzymes in Escherichia coli or Nicotiana benthamiana, followed by chromatographic product purification. The resulting metabolites are suitable for various studies including molecular structure characterization, enzyme functional studies, and bioactivity assays.

디테르페노이드 천연제품의 효소 생산 및 정화를 위한 맞춤형 접근법

Diterpenoids form a diverse class of small molecule natural products that are widely distributed across the kingdoms of life and have critical biological ...

Mass Spectrometry-Guided Genome Mining as a Tool to Uncover Novel Natural Products

The chemical space covered by natural products is immense and widely unrecognized. Therefore, convenient methodologies to perform wide-ranging evaluation of their functions in nature and potential human benefits (e.g., for drug discovery applications) are desired. This protocol describes the combination of genome mining (GM) and molecular networking (MN), two contemporary approaches that match gene cluster-encoded annotations in whole genome sequencing with chemical structure signatures from crude metabolic extracts. This is the first step towards the discovery of new natural entities. These concepts, when applied together, are defined here as MS-guided genome mining. In this method, the main components are previously designated (using MN), and structurally related new candidates are associated with genome sequence annotations (using GM). Combining GM and MN is a profitable strategy to target new molecule backbones or harvest metabolic profiles in order to identify analogues from already known compounds.

A mass spectrometry-guided genome mining protocol is established and described here. It is based on genome sequence information and LC-MS/MS analysis and aims to facilitate identification of molecules from complex microbial and plant extracts.

새로운 천연 제품을 발견하는 도구로 질량 분광법 유도 게놈 채굴

The chemical space covered by natural products is immense and widely unrecognized. Therefore, convenient methodologies to perform wide-ranging evaluation ...

화학

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is made by creating two modules: a synthetically engineered strain of E. coli cells and a functionalized material interface. Within this paper, we detail a protocol for genetically engineering selected behaviors within a strain of E. coli using molecular cloning strategies. Once developed, this strain produces elevated levels of biotin when exposed to a chemical inducer. Additionally, we detail protocols for creating two different functionalized surfaces, each of which is able to respond to cell-synthesized biotin. Taken together, we present a methodology for creating a linked, abiotic-biotic system that allows engineered cells to control material composition and assembly on nonliving substrates.

This paper presents a series of protocols for developing engineered cells and functionalized surfaces that enable synthetically engineered E. coli to control and manipulate programmable material surfaces.

살아있는 세포를 엔지니어하는 합성 생물학을 사용하여 해당 프로그램 자료와 인터페이스

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

생체공학

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

모듈형 골든 게이트 복제를 사용하여 다중 유전자 구조물의 신속한 조립

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

A High-Yield Streptomyces Transcription-Translation Toolkit for Synthetic Biology and Natural Product Applications

Streptomyces spp. are a major source of clinical antibiotics and industrial chemicals. Streptomyces venezuelae ATCC 10712 is a fast-growing strain and a natural producer of chloramphenicol, jadomycin, and pikromycin, which makes it an attractive candidate&#160;as a next-generation synthetic biology chassis. Therefore, genetic tools that accelerate the development of S. venezuelae ATCC 10712, as well as other Streptomyces spp. models, are highly desirable for natural product engineering and discovery. To this end, a dedicated S. venezuelae ATCC 10712 cell-free system is provided in this protocol to enable high-yield heterologous expression of high G+C (%) genes. This protocol is suitable for small-scale (10-100 &#956;L) batch reactions in either 96-well or 384-well plate format, while reactions are potentially scalable. The cell-free system is robust and can achieve high yields (~5-10 &#956;M) for a range of recombinant proteins in a minimal setup. This work also incorporates a broad plasmid toolset for real-time measurement of mRNA and protein synthesis, as well as in-gel fluorescence staining of tagged proteins. This protocol can also be integrated with high-throughput&#160;gene expression characterization workflows or the study of enzyme pathways from high G+C (%) genes present in Actinomycetes genomes.

A High-Yield Streptomyces Transcription-Translation Toolkit for Synthetic Biology and Natural Product Applications

This protocol details an enhanced method for synthesizing high yields of recombinant proteins from a Streptomyces venezuelae cell-free transcription-translation (TX-TL) system.

합성 생물학 및 천연 제품 응용 을 위한 고수성 연쇄상 구형 전사 -번역 도구 키트

Streptomyces spp. are a major source of clinical antibiotics and industrial chemicals. Streptomyces venezuelae ATCC 10712 is a fast-growing strain and a ...

The Logic, Experimental Steps, and Potential of Heterologous Natural Product Biosynthesis Featuring the Complex Antibiotic Erythromycin A Produced Through E. coli

The heterologous production of complex natural products is an approach designed to address current limitations and future possibilities. It is particularly useful for those compounds which possess therapeutic value but cannot be sufficiently produced or would benefit from an improved form of production. The experimental procedures involved can be subdivided into three components: 1) genetic transfer; 2) heterologous reconstitution; and 3) product analysis. Each experimental component is under continual optimization to meet the challenges and anticipate the opportunities associated with this emerging approach.
Heterologous biosynthesis begins with the identification of a genetic sequence responsible for a valuable natural product. Transferring this sequence to a heterologous host is complicated by the biosynthetic pathway complexity responsible for product formation. The antibiotic erythromycin A is a good example. Twenty genes (totaling &gt;50 kb) are required for eventual biosynthesis. In addition, three of these genes encode megasynthases, multi-domain enzymes each ~300 kDa in size. This genetic material must be designed and transferred to E. coli for reconstituted biosynthesis. The use of PCR isolation, operon construction, multi-cystronic plasmids, and electro-transformation will be described in transferring the erythromycin A genetic cluster to E. coli.
Once transferred, the E. coli cell must support eventual biosynthesis. This process is also challenging given the substantial differences between E. coli and most original hosts responsible for complex natural product formation. The cell must provide necessary substrates to support biosynthesis and coordinately express the transferred genetic cluster to produce active enzymes. In the case of erythromycin A, the E. coli cell had to be engineered to provide the two precursors (propionyl-CoA and (2S)-methylmalonyl-CoA) required for biosynthesis. In addition, gene sequence modifications, plasmid copy number, chaperonin co-expression, post-translational enzymatic modification, and process temperature were also required to allow final erythromycin A formation.
Finally, successful production must be assessed. For the erythromycin A case, we will present two methods. The first is liquid chromatography-mass spectrometry (LC-MS) to confirm and quantify production. The bioactivity of erythromycin A will also be confirmed through use of a bioassay in which the antibiotic activity is tested against Bacillus subtilis. The assessment assays establish erythromycin A biosynthesis from E. coli and set the stage for future engineering efforts to improve or diversify production and for the production of new complex natural compounds using this approach.

The Logic, Experimental Steps, and Potential of Heterologous Natural Product Biosynthesis Featuring the Complex Antibiotic Erythromycin A Produced Through E. coli

The heterologous biosynthesis of erythromycin A through E. coli includes the following experimental steps: 1) genetic transfer; 2) heterologous reconstitution; and 3) product analysis. Each step will be explained in the context of the motivation, potential, and challenges in producing therapeutic natural products using E. coli as a surrogate host.

을 통해 생산 단지 항생제 에리스로 마이신을 자랑하는 논리, 실험 단계, 그리고 Heterologous 자연 제품 생합성의 잠재적<em&gt; E. 대장균</em

The heterologous production of complex natural products is an approach designed to address current limitations and future possibilities.  It is ...

생물학

리슈마니아증 치료를 위한 테트라사이클린 제어 합성 회로 설계

Immunometabolic Circuits in Infection for Advancing Host Directed Therapies

Immuno-metabolism is a pivotal determinant in the progression of leishmaniasis. Synthetic biology-based approach has garnered significant attention as a step toward therapeutic intervention targeting host-associated factors that drive leishmaniasis. Synthetic biology entails the engineering of genetic components in an orthogonal and modular manner to precisely modulate biological systems, imparting novel functions to cells. In the presented study, elucidation of a systematic pipeline for the development of an inducible tetracycline-controlled (TetON)-based synthetic circuit was aimed at delivering succinate dehydrogenase as a therapeutic agent to facilitate the elimination of intracellular Leishmania parasites. The outlined protocol describes the designing of a synthetic circuit and its subsequent validation. The proposed strategy also concentrates on the incorporation of synthetic circuits in the plasmid backbone as a delivery vehicle. Additionally, delivery machinery employing polyplexes-based nano-particles for the delivery of synthetic circuits was used in murine macrophage cell lines without compromising the cellular morphology. Standardization of the method was conducted for selecting transfected cells and determining optimal induction concentration for synthetic circuit expression. Observations reveal a distinct reduction in intracellular parasite burden in transfected cells compared to infected cells. Pro-inflammatory cytokines were expressed post-infection in synthetic circuit transfected and induced cells as a mechanism to promote parasite elimination. This underscores the synthetic biology-based method as a potent approach in leishmaniasis by targeting host factors associated with disease progression.

저자 스포트라이트: 리슈마니아 주요 감염에서 혁신적인 치료법을 위한 시스템 및 합성 생물학 활용

Here, a protocol for designing, constructing, and delivering tetracycline-controlled based inducible synthetic circuit is presented. The effect of the synthetic circuits on parasite elimination and cytokine expression can be studied by channelizing the presented pipeline. This protocol is relevant for researchers studying synthetic circuit-based therapeutics in infectious diseases.

Immunometabolic Circuits in Infection for Advancing Host Directed Therapies(숙주 지향 치료법 발전을 위한 감염의 면역대사회로)

Immuno-metabolism is a pivotal determinant in the progression of leishmaniasis. Synthetic biology-based approach has garnered significant attention as a ...

에서 Polyketomycin를 사용하여 데모 : 그 생합성 유전자 클러스터에 천연 제품에서

요약

더 많은 비디오 탐색

이 비디오의 챕터