This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).

아스피린 - 푸마 레이트 전구 약물 GTCpFE 1. 합성 <ol><li> 메탄올 0.81 ㎖ (20 밀리몰)을 측정하고, 둥근 바닥 플라스크에서 10 ㎖의 물에 혼합 플라스틱 플런저 주사기를 사용. 빙수 욕에 플라스크를 놓고 0 ° C로 생성 된 혼합물을 냉각. 4- 히드 록시 벤질 알코올 (2.48 ㎎, 20 밀리몰)를 첨가하고, 용액이 깨끗해질 때까지 반응 혼합물을 교반 하였다. </li><li> O의 -acetylsalicyloyl 클로라이드의 정량을 계량하고, 분리 플라스크 내의 용매에 용해시켜, 무수 톨루엔 (10 mL) 중의 O의 -acetylsalicyloyl 클로라이드의 용액 (3.77 ㎎, 19 밀리몰)을 준비한다. 플런저 플라스틱 주사기를 사용하여, 단계 1.1에서 제조 한 혼합물에이 용액을 첨가하고, 0 ℃에서 교반하여 반응을 떠난다. </li><li> 박층 크로마토 그래피 (TLC)를 사용하여 반응을 모니터한다. TLC 판은 고정 위상 실리카가 있어야합니다. <ol><li> 20:80 에틸 아세테이트 (아세트산 에틸) / 헥산으로 이루어진 이동상을 준비한다. TLC 챔버 내의(또는 작은 용기)는 상기 챔버의 바닥을 덮 이동상 5 mL를 추가한다. 주 : 이동상의 양은 선택된 챔버에 의존한다. 항상 아래쪽을 덮도록 충분한 추가하지만, TLC가 내부에 배치되면, 용제 라인 화합물이 발견되는 높이를 능가한다. </li><li> 주사기 (0.2 ㎖)과의 반응의 샘플을 작은 바이알에 넣어 보관하고, 에틸 아세테이트 (3 방울)로 희석. TLC의 감시인으로 조심스럽게 희석 된 반응 혼합물의 샘플을 채취하고, TLC에 자리. 참고 : 관광 명소 1-2mm를해야하며, 이것은 TLC 판의 하부 1/4 인치에서 수행해야합니다. </li><li> 동일한 TLC에, 비교 O - 아세틸 클로라이드의 용액의 스폿 (아세트산 에틸 0.5 ㎖ 중의 0.2 mg)을 배치했다. 반점이 건조되면, 챔버에 배치하고, 용매를 전면는 TLC의 상단에 도달 거의 때까지 그것을 실행하자. </li><li> 의 TLC를 가져가 건조하게하고 UV 램프 아래로 시각화. REAC오 -acetylsalicyloyl 염소 자리는 반응 혼합물로부터 사라지면 기이 완료됩니다. </li><li> 반응이 완료되면, 빙수 욕을 제거하고 반응물을 20 시간 동안 실온에서 교반한다. </li></ol></li><li> 매체의 다공성 프릿 디스크 흐너 깔때기를 사용하여 침전물을 필터. 섬광 바이알에있는 고체를 올려 실온에서 밤새 건조기에서 진공 하에서 화합물을 떠난다. 건조제로 오산화 인 (P 2 O 5)를 사용합니다. </li><li> 이 반응을 설정하기 전에 적어도 이틀 동안 80 ℃에서 오븐에 배치하여 둥근 바닥 플라스크를 건조. 대안 적으로, 격막 플라스크를 밀봉하고, 진공 펌프 시스템에 연결된 바늘을 관통. 에 진공 펌프를 켜고 열 총을 사용하여 플라스크를 건조. 냉각 할 수 있도록 허용하고,이 단계를 2 회 이상 반복한다. </li><li> 아르곤 가스를 이용하여 풍선을 팽창하고, 그 플런저 H 플라스틱 주사기 (에 연결바늘로) 제거로. 진공 펌프를 끄고 이제 건조 된 둥근 바닥 플라스크에 삽입에 연결된 바늘을 제거합니다. 둥근 바닥 플라스크를 밀봉 격막을 통해 아르곤 풍선에 연결된 바늘을 삽입합니다. <ol><li> (무수 테트라 히드로 푸란을 용해, 분리 플라스크에 2- acetyloxybenzoic 산 (100 ㎎, 0.349 밀리몰), 4- 디메틸 아미노 피리딘 (4 ㎎, 0.033 mmol) 및 트리 에틸 아민 (53 ㎎, 0.523 밀리몰) (5) 4- 히드 록시 메틸 에스테르를 추가 ㎖). 바늘에 부착 된 플라스틱 주사기, 밀봉 된 둥근 바닥 플라스크에이 솔루션을 추가 할 수 있습니다. 빙수 욕에 플라스크를 놓고 0 ° C에 이르기까지 혼합물을 냉각. </li></ol></li><li> 이전의 혼합물에 무수 테트라 히드로 푸란 (5 mL) 중 에틸 니코틴산 클로라이드의 용액 (68 ㎎, 0.419 밀리몰)을 추가하고, 적가 10 분에 걸쳐. 2-4 시간 동안 0-5 ℃에서 얻어진 용액을 교반한다. </li><li> 에틸 아세테이트 (100 mL) 및 염수 (50ml)로 반응 혼합물을 추출 하였다. &lt;BR /&gt; 주 : 염수는 염화나트륨 포화 용액이다. 그것을 준비하기 위해, 그것은 더 이상 용해되지 않을 때까지 염화나트륨을 (교반) 추가하기 시작 깨끗한 유리 용기에 200 ml의 물을 넣습니다. <ol><li> 추출 후, 수성 상을 분리하고, 후자 단계를 두 번 더 반복한다. </li><li> 유리 제품을 교반 할 때, 고체가 응집하지 않을 때까지, 유기 상을 황산 나트륨을 첨가하여 혼합물을 건조. 프릿 디스크 다른 흐너 깔때기를 사용하여, 그 후, 황산나트륨을 제거 40 ° C로 설정 온도를 갖는 회전 증발기를 사용하여 증발 건고하는 둥근 바닥 플라스크에 상기 혼합물을 필터. </li></ol></li><li> TLC를 사용하여 컬럼 크로마토 그래피에 사용하기 적합한 이동상을 결정한다. 참고 : 본 실험 20:80 아세트산 에틸 / 헥산의 구배를 사용 하였다. </li><li> 실리카 겔 적절한 용매 상에 열을 준비합니다. 화합물을 첨가 한 후, PR 황산나트륨 (모래)의 층을 추가otect 용매로 열이 추가됩니다. <ol><li> 열이 실행되면, TLC에 의해 용출액을 모니터링 할 수 있습니다. 그들이 컬럼으로부터 수집 될 때마다 다른 시험관 스팟. 관심있는 제품이 용출되면 큰 둥근 바닥 플라스크에 순수한 생성물을 함유하는 모든 샘플을 혼합하고 40 ℃로 설정된 욕 온도로 회전 증발기를 사용하여 건조. 참고 : 제품은 백색 고체로 나타납니다. </li></ol></li><li> GTCpFE의 구조를 확인하려면 (각각 1 H 및 13 C) 제조업체의 지침에 따라 핵 자기 공명 (NMR) 스펙트럼을 양성자와 탄소를 수집합니다. 참고 : 본 연구에서 400 MHz의 FT NMR 분광계는 1 H, 13 C 스펙트럼을 수집 하였다. 충분한 데이터의 해상도를 얻기 위해, 실온에서 적어도 25 스캔을 실행. 관찰 NMR 피크가 다음, 1 H NMR (CDCl3 중)를 같았다 : 1.29 (t, 3H, 3J = 7.0 ㎐, CH 3) δ; 2.31 (S, 3H, CH 3); 4.26 (Q, 2H, 3J = 7.0 ㎐, COOCH 2); 5.25 (S, 2 H, OCH 2); 6.89 (S, 2H, HC는 = CH); 7.19 (m, 3 H, AR); 7.42 (m, 3 H, AR); 7.65 (m, 1 H, AR); 8.22 (일, 1 H, 3J = 7.8, 4J = 1.2 Hz에서, AR). 13 C NMR (CDCl3 중)은 δ : 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15를. </li><li> 또한, 제조자의 지시에 따라, 정확한 중량 측정을위한 이온 트랩과 시간의 비행 기술 (LCMS-IT-TOF)와 함께 액체 크로마토 그래피 질량 분석법을 이용한 고해상도 질량 스펙트럼을 수집한다. 참고 : 본 연구에서는 (M + NH 4 +) 계산 : 430.1496을; 관찰 : 430.1477. </li></ol> 2. GTCPFE은 유방암 세포에 NFĸB 활성을 억제 <ol><li> 문화 조건 셀 <ol><li> 인간 유방암 세포주 유지 표준 셀 막힌 따라, MCF-7 및 MDA-MB-231스트럭처 기술 및 5 % CO 2, 37 ℃의 가습 인큐베이터 내에서 전파. <ol><li> 로스웰 파크 메모리얼 연구소 (RPMI) 10 % 소 태아 혈청 (FBS)으로 보충 된, 페놀 레드, 1 % 비 필수 아미노산, 2 mM L- 글루타민, 1 % 항생제 페니실린 - 스트렙토 마이신 1640 배지에서 MCF-7 세포의 배지를 준비 및 6 NG / ㎖ 인슐린. 5 % FBS, 1 % 비 필수 아미노산, 2 mM L- 글루타민, 1 % 항생제 페니실린 - 스트렙토 마이신이 보충 향상 최소 필수 중간 (IMEM)에서 MDA-MB-231 세포 배지를 준비한다. </li></ol></li></ol></li><li> NFκB-RE 루시 페라 제 리포터 분석 <ol><li> 37 ° C에서 5 분 동안 0.25 % 트립신을 이용하여를 Trypsinize 유방암 MCF-7 세포 수동 웰 당 90,000 세포의 밀도로 24 웰 플레이트에서 혈구 및 시드를 사용하여 계산. </li><li> NFκB 응답 요소 (NFκB-RE) 루시 페라 구조, 1 μg의의 플라스미드 DNA와 다음 날, 공동 트랜 세포 / 웰, 알옹 promoterless 레 닐라 루시퍼 라제 구조, 0.2 μg의와 / 웰. 세중의 각 치료 그룹에 대한 형질을 수행합니다. <ol><li> PBS로 두 번 세포를 씻으하고, 플라스미드 DNA의 혼합물 및 무 혈청 배지에서 형질 전환 시약 (예를 들어, 리포 펙 타민)의 웰 당 1 μL에 품어. 6 시간 후, 일반 배지 1 ㎖에 (항생제 페니실린과 스트렙토 마이신없이) 매체를 변경합니다. </li></ol></li><li> 16 시간 후, 각 웰에 차량 또는 GTCpFE의 다른 주식 솔루션 또는 ASA 약 1 μl를 추가합니다. 1000 배 농도로 디메틸 술폭 시드 약물 스톡 용액 (100, 50, 20, 10 및 1 mm)를 녹인다. 약을 추가 한 후, 37 ℃에서 2 시간 동안 세포를 배양한다. </li><li> NFκB 경로를 활성화하려면, 10 NG / ㎖의 최종 농도 각 우물에 친 염증성 사이토 카인 TNFα (10 μg의 / ㎖ 원액)를 추가하고 4 시간 동안 배양한다. TNFα 혼자 컨트롤을 포함합니다. 배지를 흡인하고, 세포를 저장할-80 ° C에서의. </li><li> 제조자의 지시에 따라 루시퍼 라제 리포터 분석 시스템을 사용하여 루시 페라 제를 측정한다. 주 : 처음 루시퍼 라제 분석 시스템 (예를 들어 이중 루시퍼 라제 분석 시스템)을 사용하는 경우, 완충액 10 ㎖에 재 현탁하고 1 mL의 분취 액으로 -80 ℃에서 저장하여 루시퍼 라제 분석 시약의 용액을 제조 하였다. <ol><li> 물로 5 배 스톡 버퍼 희석 1X 용해 버퍼를 준비한다. 각 웰 사용하여 100 ㎕의 1 배 용해 버퍼를 Lyse 세포. 중간 속도에서 15 분 동안 궤도 통에 번호판을 품어. </li><li> 샘플 당 1.5 ml의 튜브 라벨. 실온 (샘플 당 50 μL가 필요합니다)와 호일을 유지하기위한 해동 루시 페라 제 분석 시약. 유리 병에 1 배 담금질 시약을 준비, 버퍼와 소용돌이에 1시 49분 희석은 (샘플 당 50 μL가 필요합니다). </li><li> 레이블의 microcentrifuge 튜브에 세포 용 해물 10 μl를 추가합니다. 그 후 루시퍼 라제 분석 시약 50 μL를 추가 한부드럽게 소용돌이. 직후 홀더에 튜브를 배치하고 루미의 이중 루시페라아제 프로그램을 통해 발광을 측정한다. 선택하고 다음을 누릅니다 실행 메가 프로토콜 → 듀얼 저런 형광을 → OK. </li><li> 시험관 부드럽게 소용돌이에 담금질 시약의 50 μl를 추가합니다. 발광을 측정합니다. 각 샘플에 대해 이러한 단계를 반복합니다. </li><li> 레 닐라 내부 통제 (NFκB-RE / 레 닐라)에 NFκB-RE를 정상화하여 스프레드 시트를 사용하여 데이터를 분석 할 수 있습니다. TNFα 억제제 전용 제어 데이터 (TNFα가 100 %로 설정)과 비교. </li></ol></li></ol></li><li> NFκB-대상 유전자의 전사 <ol><li> 종자 MCF-7 2.1 절에 기술 된 바와 같이 제조 된 2 ml의 매체 볼륨에 잘 당 250,000 세포에서 6 웰 플레이트 세포. </li><li> 다음 날, 이전에 또 다른 2 시간 동안 TNFα 10ng / ㎖를 추가로 2 시간 동안 다른 GTCpFE 1000 배 주식 (100, 50, 20, 10, 1 ㎜) 2 μl를 추가합니다. 모든 치료를 실행세중있다. 차량과 TNFα 혼자 컨트롤을 포함합니다. </li><li> RNA는 제조업 자 (22)의 지시에 따라 구 아니 디늄 티오 시아 네이트 - 페놀 - 클로로포름 추출 방법을 사용하여 격리. RNA 농도 (디 에틸 피로 카보에서 (DEPC) 처리 된 물) 및 분광 광도계를 사용하여 RNA의 순도를 결정합니다. -80 ° C에서 얼음 또는 상점에 RNA 샘플을 보관하십시오. RNA를 처리 할 때 만의 RNase없는 장벽 팁을 사용합니다. </li><li> 몰 로니 뮤린 백혈병 바이러스 (M-MLV) 역전사 효소의 시판되는 키트를 사용하여 0.5 μg의 총 RNA를 역 전사. 참고 :이 키트는 5 배는의 dNTP 혼합물, 랜덤 헥사 혼합물과 함께, 버퍼 및 디티 오 트레이 톨 (DTT)를 포함한다. <ol><li> M-MLV 200 단위, 0.5 밀리미터의 dNTPs, 최종 10 ㎕의 반응 볼륨 랜덤 헥사 100 NG, 10 mM의 DTT, 1X 버퍼와 DEPC 물에 RNA 0.5 μg의 추가. 37 ° C에서 50 분에 대한 PCR 클러를 사용하여 역전사 반응을 수행 한 후 70 ℃에서 15 분간# 176; C는-열 불 활성화 효소를합니다. </li></ol></li><li> 이중 증류수 100 μL로 생성 된 cDNA 생성물을 희석하고, 각각의 후속 정량 중합 효소 연쇄 반응 (PCR) 반응을 2 μL를 사용한다. <ol><li> 앞으로 믹스와 1.25 μM 농도 각에서 관심의 유전자 프라이머 역. 이중 가닥 DNA의 검출을 가능하게하기 위해, 2 μL를 두 번 증류수로 1.25 μM 프라이머 믹스 1 μL와 염료의 2 배의 5 μl를 마스터 믹스를 준비합니다. 96 웰 PCR 플레이트로 cDNA를 2 μL 마스터 믹스의 8 μl를로드합니다. </li></ol></li><li> 데이터 제조업체의 지시에 따라 수동 분석 (40 사이클, 95 내지 60 °의 C)을 실시간 PCR 시스템을 이용하여 정량적 PCR을 수행한다. 주 : 검증 이전에보고되었다 (23)에 사용 된 모든 PCR 프라이머. </li><li> 리보솜 단백질 (36)과 함께 ΔΔCt 방법을 통해 스프레드 시트를 사용하여 유전자 발현 배의 변화를 계산내부 통제 (23)의 역할 B4의 mRNA. </li></ol></li></ol> 3. GTCpFE는 시험관에서 유방암 줄기 세포를 금지합니다 <ol><li> Mammosphere 형성의 분석 <ol><li> 둘 베코의 변형 이글 중간을 보완하여 mammosphere (MS) 매체를 준비 : 1 %의 메틸 셀룰로오스와 영양 혼합물 F-12 (DMEM / F12) 페놀 레드 무료 매체. 부드러운 4 ℃에서 밤새 흔들어 용해 할 수 있습니다. 필터 매체를 살균 및 B27 (1X), 1 % 페니실린 스트렙토 마이신, 5 μg의 / ㎖ 인슐린, 1 μg의 / ㎖의 하이드로 코르티손, 20 NG / ml의 재조합 인간 상피 성장 인자로 보충. </li><li> 단층 배양 (37 ℃에서 5 분 동안 트립신, 0.25 %)의 소화를 트립신 MDA-MB-231 세포주의 단일 셀을 준비하고 메쉬 체를 통해 필터링. 수동 / 잘 400 셀의 밀도로 96 웰 매우 낮은 부착 판에 하나의 해리 세포와 플레이트를 계산합니다. 다음 날, GTCp의 다른 농도를 추가FE (예 GTCpFE 최종 농도 : 1, 10, 20, 50 μM) 최종 부피는 100 μL이다. 세중의 모든 치료를 실시한다. </li><li> 인큐베이터에서 배양 7 일 후, 거꾸로 현미경을 사용하여 이미징 소프트웨어를 통해 이미지를 수집. 수동으로 직경이 수 MS&gt; 75 μm의를 계산합니다. 차량 제어에 대한 약물 치료를 비교. 주 : MS&gt; 75 ㎛의 직경이 상기 영상 소프트웨어를 사용하여 결정된다. </li></ol></li><li> CD44 + CD24 - CSC 면역 표현형 <ol><li> 37 ° C에서 5 분 동안 0.25 % 트립신으로 MDA-MB-231 세포를 Trypsinize. 2.1 절에 설명 된대로 10 ml의 매체에 접시 당 3 백만 세포에서 10cm 접시에서 혈구와 씨앗을 사용하여 계산합니다. 72 시간 동안 세포 차량 (10 μL 디메틸 설폭 사이드) 또는 GTCpFE (50 mM의 주식의 10 μl를) 추가합니다. </li><li> 차량이나 GTCpFE 치료 그룹의 경우를 Trypsinize (단계 3.2.1에서와 같이) 세포 및 테스트 &amp; # &#39;에 100 만 세포를 배포39; 또는 1X 행크의 균형 잡힌 염 용액 (HBSS) 2 ㎖을 함유 통제 &#39;5 ㎖ 폴리스틸렌 튜브는 2 % FBS가 보충 버퍼입니다. </li><li> 표면 마커 CD44 및 CD24, 아래로 스핀 세포 염색 및 최종 100 μL 전체 볼륨에 튜브를 테스트하기 위해 20 각 복합 항체의 μL 및 HBSS + 2 % FBS를 추가하려면 (1 : 5 희석). 튜브를 제어하는 ​​HBSS + 2 % FBS 100 μl를 추가합니다. CD44-APC 결합 된 항체 및 CD24-PE 항체 단일 얼룩 컨트롤 또는의 IgG immunoisotype 컨트롤을 포함합니다. </li><li> 30 분 동안 4 ° C에서 어둠 속에서 세포를 품어. 400 XG에서 5 분 동안 세포를 스핀 다운 2 % FBS 200 μl를 HBSS 버퍼에 재구성. 어둠 속에서 얼음에 세포를 유지합니다. </li><li> 제조자의 지시에 따라 FACS 분석 기기를 사용하여 살아있는 세포의 형광 - 활성화 세포 분류 (FACS)를 수행한다. 각각의 튜브에 대한 최소 50,000 이벤트를 수집합니다. 세중에서 실행 트리트먼트. 참고 : 게이팅은 공동 (아무 염색에서 컨트롤을 기반으로ntrol 관), IgG의 immunoisotypes 및 CD44-APC 및 CD24-PE 단일 얼룩. </li><li> 가능한 유동 세포 계측법 소프트웨어를 사용하여 데이터를 분석한다. 참고 : GTCpFE-처리 된 CD44 + CD24와 세포의 비율 (%) - 면역 표현형 추정 및 차량 제어에 비교된다. </li></ol></li></ol>

<ol>
	<li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Cuzick, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspirin+and+non-steroidal+anti-inflammatory+drugs+for+cancer+prevention:+an+international+consensus+statement.">Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement.</a> Lancet Oncol. 10, 501-507 (2009).</li><li>Terry, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+frequency+and+duration+of+aspirin+use+and+hormone+receptor+status+with+breast+cancer+risk.">Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk.</a> JAMA. 291, 2433-2440 (2004).</li><li>Wang, D., Dubois, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclooxygenase-2:+a+potential+target+in+breast+cancer.">Cyclooxygenase-2: a potential target in breast cancer.</a> Semin Oncol. 31, 64-73 (2004).</li><li>Howe, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+and+breast+cancer.+Cyclooxygenase/prostaglandin+signaling+and+breast+cancer.">Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer.</a> Breast Cancer Res. 9. 9, 210 (2007).</li><li>Kopp, E., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+NF-kappa+B+by+sodium+salicylate+and+aspirin.">Inhibition of NF-kappa B by sodium salicylate and aspirin.</a> Science. 265, 956-959 (1994).</li><li>Yin, M. J., Yamamoto, Y., Gaynor, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+anti-inflammatory+agents+aspirin+and+salicylate+inhibit+the+activity+of+I(kappa)B+kinase-beta.">The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta.</a> Nature. 396, 77-80 (1998).</li><li>Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salicylates+inhibit+I+kappa+B-alpha+phosphorylation,+endothelial-leukocyte+adhesion+molecule+expression,+and+neutrophil+transmigration.">Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration.</a> J Immunol. 156, 3961-3969 (1996).</li><li>Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NFkappaB+affects+estrogen+receptor+expression+and+activity+in+breast+cancer+through+multiple+mechanisms.">NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms.</a> Mol Cell Endocrinol. 418, 235-239 (2014).</li><li>Perkins, N. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diverse+and+complex+roles+of+NF-kappaB+subunits+in+cancer.">The diverse and complex roles of NF-kappaB subunits in cancer.</a> Nat Rev Cancer. 12, 121-132 (2012).</li><li>DiDonato, J. A., Mercurio, F., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+and+the+link+between+inflammation+and+cancer.">NF-kappaB and the link between inflammation and cancer.</a> Immunol Rev. 246, 379-400 (2012).</li><li>Scarpignato, C., Hunt, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsteroidal+antiinflammatory+drug-related+injury+to+the+gastrointestinal+tract:+clinical+picture,+pathogenesis,+and+prevention.">Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention.</a> Gastroenterol Clin North Am. 39, 433-464 (2010).</li><li>Sostres, C., Gargallo, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrointestinal+lesions+and+complications+of+low-dose+aspirin+in+the+gastrointestinal+tract.">Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract.</a> Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+Fumarate+Inhibits+the+Nuclear+Factor+kappaB+Pathway+in+Breast+Cancer+Cells+by+Covalent+Modification+of+p65+Protein.">Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.</a> J Biol Chem. 291, 3639-3647 (2016).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+aspirin+prodrug+inhibits+NFkappaB+activity+and+breast+cancer+stem+cell+properties.">A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties.</a> BMC Cancer. 15, 845 (2015).</li><li>Cao, Y., Luo, J. L., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IkappaB+kinase+alpha+kinase+activity+is+required+for+self-renewal+of+ErbB2/Her2-transformed+mammary+tumor-initiating+cells.">IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells.</a> Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+NF-kappaB+pathway+governs+mammary+tumorigenesis+in+transgenic+mice+and+tumor+stem+cell+expansion.">The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion.</a> Cancer Res. 70, 10464-10473 (2010).</li><li>Korkaya, H., Liu, S., Wicha, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+cancer+stem+cells+by+cytokine+networks:+attacking+cancer's+inflammatory+roots.">Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots.</a> Clin Cancer Res. 17, 6125-6129 (2011).</li><li>Hinohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ErbB+receptor+tyrosine+kinase/NF-kappaB+signaling+controls+mammosphere+formation+in+human+breast+cancer.">ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer.</a> Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).</li><li>Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canonical+and+non-canonical+NF-kappaB+signaling+promotes+breast+cancer+tumor-initiating+cells.">Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells.</a> Oncogene. 33, 1297-1305 (2014).</li><li>Yamamoto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+non-cell-autonomously+regulates+cancer+stem+cell+populations+in+the+basal-like+breast+cancer+subtype.">NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype.</a> Nat Commun. 4, 2299 (2013).</li><li>Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+RNA+using+TRIzol+(TRI+reagent).">Purification of RNA using TRIzol (TRI reagent).</a> Cold Spring Harb Protoc. , (2010).</li><li>Frasor, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positive+cross-talk+between+estrogen+receptor+and+NF-kappaB+in+breast+cancer.">Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer.</a> Cancer Res. 69, 8918-8925 (2009).</li><li>Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+identification+of+tumorigenic+breast+cancer+cells.">Prospective identification of tumorigenic breast cancer cells.</a> Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).</li><li>Vandermeeren, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+is+an+inhibitor+of+cytokine-induced+nuclear+translocation+of+NF-kappa+B1,+but+not+RelA+in+normal+human+dermal+fibroblast+cells.">Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells.</a> J Invest Dermatol. 116, 124-130 (2001).</li><li>Loewe, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+TNF-induced+nuclear+entry+of+NF-kappa+B/p65+in+human+endothelial+cells.">Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells.</a> J Immunol. 168, 4781-4787 (2002).</li><li>Seidel, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+NF-{kappa}B+function+at+multiple+levels+to+limit+airway+smooth+muscle+cell+cytokine+secretion.">Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion.</a> Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).</li><li>Wilms, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+microglial+and+astrocytic+inflammation+by+suppressing+the+synthesis+of+nitric+oxide,+IL-1beta,+TNF-alpha+and+IL-6+in+an+in-vitro+model+of+brain+inflammation.">Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation.</a> J Neuroinflammation. 7, 30 (2010).</li><li>Peng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+fumarate+inhibits+dendritic+cell+maturation+via+nuclear+factor+kappaB+(NF-kappaB)+and+extracellular+signal-regulated+kinase+1+and+2+(ERK1/2)+and+mitogen+stress-activated+kinase+1+(MSK1)+signaling.">Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling.</a> J Biol Chem. 287, 28017-28026 (2012).</li><li>Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer-stimulated+mesenchymal+stem+cells+create+a+carcinoma+stem+cell+niche+via+prostaglandin+E2+signaling.">Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling.</a> Cancer Discov. 2, 840-855 (2012).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+resistance+of+tumorigenic+breast+cancer+cells+to+chemotherapy.">Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy.</a> J Natl Cancer Inst. 100, 672-679 (2008).</li><li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells.">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458, 780-783 (2009).</li><li>Hollier, B. G., Evans, K., Mani, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-to-mesenchymal+transition+and+cancer+stem+cells:+a+coalition+against+cancer+therapies.">The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies.</a> J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).</li><li>Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+breast+cancer+stem+cells+in+metastasis+and+therapeutic+implications.">The role of breast cancer stem cells in metastasis and therapeutic implications.</a> Am J Pathol. 179, 2-11 (2011).</li><li>Dontu, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+propagation+and+transcriptional+profiling+of+human+mammary+stem/progenitor+cells.">In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells.</a> Genes Dev. 17, 1253-1270 (2003).</li><li>Charafe-Jauffret, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+breast:+current+opinion+and+future+challenges.">Cancer stem cells in breast: current opinion and future challenges.</a> Pathobiology. 75, 75-84 (2008).</li><li>Clayton, H., Titley, I., Vivanco, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+differentiation+of+progenitor/stem+cells+derived+from+the+human+mammary+gland.">Growth and differentiation of progenitor/stem cells derived from the human mammary gland.</a> Exp Cell Res. 297, 444-460 (2004).</li><li>Ginestier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALDH1+is+a+marker+of+normal+and+malignant+human+mammary+stem+cells+and+a+predictor+of+poor+clinical+outcome.">ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome.</a> Cell Stem Cell. 1, 555-567 (2007).</li><li>Rosen, J. M., Jordan, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+increasing+complexity+of+the+cancer+stem+cell+paradigm.">The increasing complexity of the cancer stem cell paradigm.</a> Science. 324, 1670-1673 (2009).</li><li>Visvader, J. E., Lindeman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+solid+tumours:+accumulating+evidence+and+unresolved+questions.">Cancer stem cells in solid tumours: accumulating evidence and unresolved questions.</a> Nat Rev Cancer. 8, 755-768 (2008).</li></ol>

The authors have nothing to disclose.

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NF&#312;B activity in breast cancer cells. GTCpFE is an effective NF&#312;B inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NF&#312;B signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other malignancies where multiple inflammatory pathways are active and contribute to the pathology. Therefore, GTCpFE may be the prototype for developing new fumarate-based anti-inflammatory and anti-CSC class of drugs. Besides ASA, other non-steroidal anti-inflammatory drugs may also be used. In this case, the synthetic route should be re-designed as well. Ensuring that the new prodrug maintains its anti-NF&#312;B and anti-cyclooxygenase activity via the assays describe herein is critical. 
GTCpFE abrogated MS formation and inhibited the CD44+CD24- immunophenotype. Together these findings suggest that GTCpFE may also be a promising, clinically relevant anti-inflammatory molecule for eradicating breast CSCs by exploiting CSC's reliance on multiple inflammatory pathways, including the NF&#312;B pathway and the cyclooxygenase 2-prostaglandin E2 axis16-21,30. Targeting breast CSCs is important because they are thought to contribute to therapy resistance, recurrence and metastasis31-34. 
The anti-CSCs properties described here, the mammosphere formation and the CD44+CD24- immunophenotype, are based on typical in vitro assays to assess effect on stemness. Mammosphere formation is a functional assay because it exploits the unique property of stem-like/progenitor cells to survive and grow in serum-free suspension, while more differentiated cells undergo anoikis and die in these conditions35,36. However, because a reduction in mammosphere formation may represent (i) increased apoptosis, (ii) decreased proliferation of early progenitor cells or stem cells, (iii) a reduction in stem cell self-renewal, or (iv) interference with anchorage-independent growth, it is best used in conjunction with other anti-CSC assays. The choice of the well-established breast CSC CD44+CD24- immunophenotype is based on the pioneering study by Clarke and colleagues who used breast cancer xenografts to isolate a population of cells capable of initiating tumors in immunodeficient mice24. Similar to the CD44+CD24- immunophenotype, expression of other cell surface markers can be used to isolate stem cells via flow cytometry, but the choice of marker can greatly vary depending on tissues or species (human vs murine model). Alternative assays to measure effects on breast CSCs in vitro are (i) the side population technique, which is based on the ability of stem cells to exclude vital dyes via transmembrane transporters37, and (ii) the ALDEFLUOR assay, which is based on the enzymatic activity of aldehyde dehydrogenase 1 (ALDH1)38. Lastly, a suppression of pluripotency genes, transcription factors, or key stemness pathways may also be indicative of anti-CSCs effects. Promising in vitro anti-CSC properties should be followed up by in vivo characterization. The "gold standard" for assaying anti-CSC properties is in vivo tumorigenicity, wherein the ability of drug-treated cells to initiate or seed a xenograft tumor is examined39,40.

염증은 전이 1 입사 및 승진, 결국 진행으로 종양의 여러 측면을, 기초가 품질 증명이다. 유방암이 더욱 전이 및 재발 모두 유방암 발병률 감소, 위험과 연관된다 (살리실산, ASA 아세틸) 고전적인 비 스테로이드 성 항 염증 약물 아스피린의 일정한 사용을 나타내는 역학 관측에 의해지지된다 2,3. ASA 주로 종종 유방암 4,5-에서 상향 조절된다 사이클로 옥 시게나 제 -2 활성을 억제함으로써 작용한다. 그러나, ASA의 항암 효과는 비정상적인 핵 인자 κB (NFκB) 6-8 시그널링의 억제에 의해 매개 될 수있다. 규제 완화 NFκB 경로는 치료 9-11로 종양 세포의 생존, 증식, 이동, 침윤, 혈관 신생, 및 저항을 촉진하기 때문에 중요하다. NFκB 경로의 활성화는 또한 장착 중요하다면역 반응. 따라서, 장기간 NFκB의 억제가 요구되는 항암 치료를 들어, 하나의 긴 지속 면역 억제와 관련된 해로운 부작용을 고려해야한다. 따라서, 치료는 ASA 최적화를위한 좋은 출발점이 될 수있다. 암 치료에 ASA 응용 프로그램에 대한 하나의 한계는 궤양과 위가 12, 13 출혈로 위장 독성과 관련된 사이클로 옥 시게나 제 2, NFκB 억제에 필요한 높은 용량입니다. 그러나, 에스테르 전구 약물로 ASA 변환, ASA의 위장 독성을 감소시킬 수있다. 상기 효능을 향상 및 / 또는 기능을 추가하는 추가적인 구성 요소 또는 부수적 인 약물 조제도 에스테르 프로 드럭 디자인에 혼입 될 수있다. 그러한 pharmacophore는 NFκB 경로가 푸마 레이트 인에 대해 우리가 이전에 NFκB 경로 억제 14,15 중요한 것으로 나타났습니다있는 ASA의 힘을 강화했다. (15), GTCpFE 및 하이브리드 분자가 아직 NFκB 경로에 대한 강력한 안전 할 것이라는 가설을 세웠다. 우리는 유방암 세포에서의 항 NFκB 활성 및 NFκB 생존 및 성장을 위해 16-21 신호에 의존 유방암 줄기 세포 (CSC 추가) (15)을 차단하는 능력을 시험 하였다. 우리는 NFκB 경로에 대한 GTCpFE의 힘이 크게 ASA (15)을 통해 향상된다 찾을 수 있습니다. 또한, GTCpFE 블록 mammosphere 형성 및 CSC 표면 마커 CD44 + CD24 감쇠 - GTCpFE가 된 CSC (15)를 퇴치 할 수있는 것을 나타내는, 면역 표현형한다. 이러한 결과는 유방 암줄 기세포를 타겟팅 할 수있는 효과적인 소염제로서 아스피린 - 푸마 레이트의 전구 약물을 설정합니다. 유방암 치료의 관점에서, GTCpFE 공격적인 치명적인 질병을 치료할 수있는 가능성을 가지고있다.

<table><tbody><tr><td>RPMI 1640 Red Medium</td><td>Life Technologies&amp;nbsp;</td><td>11875-093</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>IMEM</td><td>Corning</td><td>10-024-CV</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>DMEM / F12 Medium</td><td>ThermoFisher</td><td>21041-025</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>MEM NEAA 10 mM 100x</td><td>Life Technologies&amp;nbsp;</td><td>11140</td><td></td></tr><tr><td>Penicillin Streptomycin</td><td>Life Technologies&amp;nbsp;</td><td>15140-122</td><td></td></tr><tr><td>L-Glutamine 100x</td><td>Life Technologies&amp;nbsp;</td><td>25030-081</td><td></td></tr><tr><td>Insulin</td><td>Sigma-Aldrich</td><td>I-1882</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlanta Biologicals</td><td>S11150</td><td></td></tr><tr><td>Trypsin 2.5% 10x</td><td>Invitrogen</td><td>15090046</td><td></td></tr><tr><td>Methyl Cellulose</td><td>Sigma&amp;nbsp;</td><td>M0262</td><td></td></tr><tr><td>B27 Supplement 50x</td><td>Gibco</td><td>17504-044</td><td></td></tr><tr><td>EGF</td><td>Gibco</td><td>PHG0311L</td><td></td></tr><tr><td>NF&amp;kappa;B-RE Luciferase Construct&amp;nbsp;</td><td>Clontech&amp;nbsp;</td><td>pGL4.32</td><td></td></tr><tr><td>Renilla Luciferase Construct&amp;nbsp;</td><td>Promega</td><td>pGL4.70</td><td></td></tr><tr><td>Lipofectamine 2000</td><td>ThermoFisher</td><td>11668-019</td><td></td></tr><tr><td>Dual-Luciferase Reporter Assay&amp;nbsp;</td><td>Promega</td><td>120000032</td><td></td></tr><tr><td>NanoDrop Spectrophotometer</td><td>ThermoFisher</td><td></td><td></td></tr><tr><td>Eppendorf Mastercycler&amp;nbsp;</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>StepOne Real Time PCR System</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>Eclipse Microscope</td><td>Nikon</td><td></td><td></td></tr><tr><td>CyAn ADP Analyzer&amp;nbsp;</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>QCapture Software</td><td>QImaging</td><td></td><td></td></tr><tr><td>Summit Software</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>GraphPad Software</td><td>Prism</td><td></td><td></td></tr><tr><td>TRIzol</td><td>ThermoFisher</td><td>15596-018</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Invitrogen</td><td>28025-013</td><td></td></tr><tr><td>100 mM dNTP Set</td><td>Invitrogen</td><td>10297-018</td><td></td></tr><tr><td>Random Hexamers&amp;nbsp;</td><td>Invitrogen</td><td>48190-011</td><td></td></tr><tr><td>Fast SYBR Green Master Mix</td><td>ThermoFisher</td><td>4385612</td><td></td></tr><tr><td>Costar 96W, ultra low attachment&amp;nbsp;</td><td>Corning</td><td>3474</td><td></td></tr><tr><td>HBSS, 1x</td><td>ThermoFisher</td><td>14025134</td><td></td></tr><tr><td>CD44-APC conjugated antibody&amp;nbsp;</td><td>BD Pharmingen</td><td>560990</td><td>Store at 4 &amp;deg;C, protect from light</td></tr><tr><td>CD24-PE antibody</td><td>BD Pharmingen</td><td>560991</td><td>Store at 4 &amp;deg;C, protect from light</td></tr><tr><td>Recombinant Human TNF&amp;alpha;</td><td>Fisher</td><td>210TA100&amp;nbsp;</td><td></td></tr><tr><td>CCL2 Primer Forward Sequence</td><td></td><td></td><td>AGAATCACCAGCAGCAAGTGTCC</td></tr><tr><td>CCL2 Primer Reverse Sequence</td><td></td><td></td><td>TCCTGAACCCACTTCTGCTTGG</td></tr><tr><td>ICAM1 Primer Reverse Sequence</td><td></td><td></td><td>TGACGAAGCCAGAGGTCTCAG</td></tr><tr><td>ICAM1 Primer Forward Sequence</td><td></td><td></td><td>AGCGTCACCTTGGCTCTAGG</td></tr><tr><td>TNF Primer Forward Sequence</td><td></td><td></td><td>AAGGGTGACCGACTCAGCG</td></tr><tr><td>TNF Primer Reverse Sequence</td><td></td><td></td><td>ATCCCAAAGTAGACCTGCCCA</td></tr><tr><td>36B4 Primer Forward Sequence</td><td></td><td></td><td>GTGTTCGACAATGGCAGCAT</td></tr><tr><td>36B4 Primer Reverse Sequence</td><td></td><td></td><td>GACACCCTCCAGGAAGCGA</td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881-500G</td><td></td></tr><tr><td>4-Hydroxybenzyl Alcohol</td><td>Sigma-Aldrich</td><td>20806-10G</td><td></td></tr><tr><td>&lt;em&gt;O&lt;/em&gt;-Acetylsalicyloyl Chloride</td><td>Sigma-Aldrich</td><td>165190-5G</td><td></td></tr><tr><td>Phosphorous Pentoxide</td><td>Sigma-Aldrich</td><td>79610-100G</td><td></td></tr><tr><td>Ethyl Fumaroyl Chloride</td><td>Sigma-Aldrich</td><td>669695-1G</td><td></td></tr><tr><td>Sodium Sulfate</td><td>Sigma-Aldrich</td><td>246980-500G</td><td></td></tr><tr><td>4-Dimethylaminopyridine</td><td>Sigma-Aldrich</td><td>714844-100ML</td><td>0.5&amp;nbsp;M in tetrahydrofuran</td></tr><tr><td>Triethylamine</td><td>Sigma-Aldrich</td><td>T0886-100ML</td><td></td></tr><tr><td>Toluene</td><td>Sigma-Aldrich</td><td>244511-100ML</td><td></td></tr><tr><td>Ethyl Acetate</td><td>Sigma-Aldrich</td><td>270989-100ML</td><td></td></tr><tr><td>Tetrahydrofuran</td><td>Sigma-Aldrich</td><td>401757-2L</td><td></td></tr><tr><td>400 MHz FT NMR spectrometer&amp;nbsp;</td><td></td><td></td><td>See Bruker&amp;rsquo;s Avance User&amp;rsquo;s Manual, version 000822 for details</td></tr></tbody></table>

synthesis and characterization of an aspirin-fumarate prodrug that inhibits nf&#954;b activity and breast cancer stem cells

염증 전이에 암 발생 및 홍보, 결국 진행의 기초가 암의 특징이다. 따라서, 표준 암 연대에 소염제를 추가하는 것은 환자의 결과를 향상시킬 수있다. 그러한 약물 아스피린 (아세틸 살리실산, ASA)은, 암 화학 예방법 및 항 종양 활성에 대해 탐구되었다. 시클로 옥 시게나 제 2 축 프로스타글란딘 억제 외에 ASA의 항암 활동은 핵 인자 ĸB (NFĸB) 억제에 기인하고있다. ASA 장시간 사용이 위장관 독성을 유발할 수 있기 때문에, 프로 드럭 전략이 성공적으로 구현되었다. 이 전구 약물에 ASA의 카르 복실 산 마스크 추가 약물 조제가 통합되어 설계. 이 프로토콜은 우리가 아스피린 푸마르산 전구 약물 GTCpFE 합성 및 유방암 세포에서 NFĸB 경로의 억제를 그 특징으로하며 암의 감쇠 줄기 등 적절한 방법을 설명넥타이, 중요한 NFĸB 의존 표현형. ASA는 ASA 구조에 추가 푸마 상당히 활성에 기여하고 있음을 나타내는 임의의 억제 활성이 결여 반면 GTCpFE 효과적으로 유방암 세포주에서 NFĸB 경로를 억제한다. 면역 표현형 - 또한, GTCpFE는 mammosphere 형성을 차단하고 암 줄기 세포 관련 CD44 + CD24를 감쇠에 의해 상당한 항암 줄기 세포의 활동을 보여줍니다. 이들 결과는 화학적 예방 및 암 치료를위한 개선 된 항 - 염증 약물의 개발이 가능한 전략을 수립.

도 1에있어서, 사이토 카인에 대한 아스피린 푸마르산 전구 약물 GTCpFE, 그 저해 활성의 화학적 구조는 유방암 세포에서 NFĸB 경로를 유발하는 표시된다. GTCpFE는 세포 간 접착 분자 1 (ICAM1), 케모카인 CC 모티브 리간드 2 (CCL2), 및 종양 괴사 인자 (TNF) (그림으로 NFĸB 대상 유전자의 두 NFĸB 엔드 포인트, NFĸB-RE 루시 페라 제 활동 (그림 1B) 표현을 억제 MCF-7 유방암 세포에서 1C). 50 % 저해 농도를 계산 양쪽 엔드 포인트 (IC 50)의 값은 ~ 20 μM이다. IC 50 값은 그래프 소프트웨어를 사용하여 계산된다. 비교 ASA 자체도 200 μM (10 배 GTCpFE의 IC 50) 유방암 세포에는 저해 활성 (그림 1B, 파란색 선)를 보여줍니다으로. 이것은 ASA의 significa에 푸마 레이트 pharmacophore 추가의 전구 약물 전략을 나타낸다ntly 안티 - NFĸB 활동을 향상시킵니다. 안티 CSC의 활동을 측정하기 위해, 우리는이 분석을 사용하십시오 mammosphere (MS) 형성 분석 및 CD44 + CD24 발현하는 세포의 인구 - 면역 표현형, 유방암 (24)의 선의의 CSC 표면 마커를. GTCpFE는도 2a에 도시 된 용량 의존적으로 MDA-MB-231 유방암 세포의 MS의 형성을 억제한다. 접착 문화 NFĸB 경로 억제 마찬가지로, mammosphere 형성 용 IC 50 값은 20 μM ~하다. 이러한 일관성은 암줄 기세포가 NFĸB이 생존과 번식 16-21에 대한 신호에 의존 주어진 예상된다. MDA-MB-231 세포 집단 (도 2B) - 또한 GTCpFE 사전 처리는 CD44 + CD24의 상당한 붕괴 결과. 함께, 이러한 결과는 효과적으로 유방 암줄 기세포를 대상으로 GTCpFE의 기능을 설정합니다. <img alt="그림 1" src="/files/ftp_upload/54798/54798fig1.jpg" /> 그림 1 : GTCpFE이 유방암 세포의 NFĸB 경로를 억제한다. (A) 아스피린 푸마 레이트 전구 약물 GTCpFE의 화학 구조. (B - C) MCF-7 세포는 전처리 2-4 시간 동안 TNFα로 처리하여 다양한 GTCpFE, ASA의 농도, 또는 차량 (10 NG / mL)로 2 시간이었다. (B) NFκB-RE 활성 이중 루시페라아제 리포터 분석법으로 측정 하였다. NFκB의 표적 유전자, ICAM1, TNF 및 CCL2의 (C) 발현은 RT-QPCR 측정 하였다. 약물 저해 활성 혼자 TNFα의 %로 꾸몄다. 데이터는 SEM ± 평균으로 표시하고 있습니다. 이 수치는 기준 (15)에서 수정되었습니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54798/54798fig1large.jpg" target="_blank">이 figu의 더 큰 버전을 보려면 여기를 클릭하십시오</a>레. <img alt="그림 2" src="/files/ftp_upload/54798/54798fig2.jpg" /> 도 2 - 유방암 세포의 면역 표현형 GTCpFE는 mammosphere 형성과 CD44 + CD24을 억제한다. MDA-MB-231 세포 (A) Mammosphere (MS)가 형성 GTCpFE의 다양한 농도로 처리 한 후에 측정 하였다. MS의 성장 (왼쪽)와 20 배에서 MS의 대표 사진의 정량 (오른쪽) 표시됩니다. GTCpFE의 효과 % 차량 제어로 도시된다. (B)가 CD44 + CD24 - 인구는 72 시간 동안 50 μM GTCpFE 처리 MDA-MB-231 세포를 FACS 분석에 의해 측정 하였다. FACS (오른쪽) 각 인구 비율 (왼쪽)와 대표 산포도의 정량이 표시됩니다. 데이터는 SEM 및 통계 분석이 일원 분산 분석 FOLL의 ± 평균으로 표시하고 있습니다Tukey에의 사후 검사에 의해 빚진. *** P &lt;0.001. 이 수치는 기준 (15)에서 수정되었습니다.

Watch this Scientific Journal Video about Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFÎºB Activity and Breast Cancer Stem Cells at JoVE.com

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&#954;B Activity and Breast Cancer Stem Cells

This procedure will demonstrate how we synthesized and characterized the anti-NF&#954;B and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

NFκB 활동과 유방암 줄기 세포를 금지합니다 합성 및 아스피린 - 푸마 레이트의 전구 약물의 특성

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an ...

synthesis-characterization-an-aspirin-fumarate-prodrug-that-inhibits

Nanyang Technological University

Research

JoVE Journal

Cancer Research

12.2K 조회수.  University of Illinois at Chicago. This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

비디오: Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells

Polymalic Acid-based Nano Biopolymers for Targeting of Multiple Tumor Markers: An Opportunity for Personalized Medicine?

Tumors with similar grade and morphology often respond differently to the same treatment because of variations in molecular profiling. To account for this diversity, personalized medicine is developed for silencing malignancy associated genes. Nano drugs fit these needs by targeting tumor and delivering antisense oligonucleotides for silencing of genes. As drugs for the treatment are often administered repeatedly, absence of toxicity and negligible immune response are desirable. In the example presented here, a nano medicine is synthesized from the biodegradable, non-toxic and non-immunogenic platform polymalic acid by controlled chemical ligation of antisense oligonucleotides and tumor targeting molecules. The synthesis and treatment is exemplified for human Her2-positive breast cancer using an experimental mouse model. The case can be translated towards synthesis and treatment of other tumors.

An example of a nano drug based on polymalic acid is presented towards the rational design of personalized medicine that is applicable to cancer. It describes the synthesis of a nano drug to treat Her2-positive human breast cancer in a nude mouse.

여러 종양 마커의 대상으로하기위한 Polymalic 산 기반의 나노 생물 고분자 물질 : 개인화 된 약을위한 기회?

Tumors with similar grade and morphology often respond differently to the same treatment because of variations in molecular profiling. To account for this ...

연구

화학

Enhancement of Apoptotic and Autophagic Induction by a Novel Synthetic C-1 Analogue of 7-deoxypancratistatin in Human Breast Adenocarcinoma and Neuroblastoma Cells with Tamoxifen

Breast cancer is one of the most common cancers amongst women in North America. Many current anti-cancer treatments, including ionizing radiation, induce apoptosis via DNA damage. Unfortunately, such treatments are non-selective to cancer cells and produce similar toxicity in normal cells. We have reported selective induction of apoptosis in cancer cells by the natural compound pancratistatin (PST). Recently, a novel PST analogue, a C-1 acetoxymethyl derivative of 7-deoxypancratistatin (JCTH-4), was produced by de novo synthesis and it exhibits comparable selective apoptosis inducing activity in several cancer cell lines. Recently, autophagy has been implicated in malignancies as both pro-survival and pro-death mechanisms in response to chemotherapy. Tamoxifen (TAM) has invariably demonstrated induction of pro-survival autophagy in numerous cancers. In this study, the efficacy of JCTH-4 alone and in combination with TAM to induce cell death in human breast cancer (MCF7) and neuroblastoma (SH-SY5Y) cells was evaluated. TAM alone induced autophagy, but insignificant cell death whereas JCTH-4 alone caused significant induction of apoptosis with some induction of autophagy. Interestingly, the combinatory treatment yielded a drastic increase in apoptotic and autophagic induction. We monitored time-dependent morphological changes in MCF7 cells undergoing TAM-induced autophagy, JCTH-4-induced apoptosis and autophagy, and accelerated cell death with combinatorial treatment using time-lapse microscopy. We have demonstrated these compounds to induce apoptosis/autophagy by mitochondrial targeting in these cancer cells. Importantly, these treatments did not affect the survival of noncancerous human fibroblasts. Thus, these results indicate that JCTH-4 in combination with TAM could be used as a safe and very potent anti-cancer therapy against breast cancer and neuroblastoma cells.

We have synthesized a novel analogue of pancratistatin with comparable anti-cancer activity as native pancratistatin; interestingly, combinatory treatment with tamoxifen yielded a drastic enhancement in apoptotic and autophagic induction by mitochondrial targeting with minimal effect on noncancerous fibroblasts. Thus, JCTH-4 in combination with tamoxifen could provide a safe anti-cancer therapy.

인간 유방 선암과 Tamoxifen과 Neuroblastoma 셀의 7-deoxypancratistatin의 소설 합성 C-1 아날로그에 의한 Apoptotic 및 Autophagic 유도의 향상

Breast cancer is one of the most common cancers amongst women in North America. Many current anti-cancer treatments, including ionizing radiation, induce ...

의학

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major contributors to breast cancer initiation, relapse, metastasis and therapy resistance. It is imperative to understand the biology of breast cancer stem cells in order to identify novel therapeutic targets to treat breast cancer. Breast cancer stem cells are isolated and characterized based on expression of unique cell surface markers such as CD44, CD24 and enzymatic activity of aldehyde dehydrogenase (ALDH). These ALDHhighCD44+CD24- cells constitute the BCSC population and can be isolated by fluorescence-activated cell sorting (FACS) for downstream functional studies. Depending on the scientific question, different in vitro and in vivo methods can be used to assess the functional characteristics of BCSCs. Here, we provide a detailed experimental protocol for isolation of human BCSCs from both heterogenous populations of breast cancer cells as well as primary tumor tissue obtained from breast cancer patients. In addition, we highlight downstream in vitro and in vivo functional assays including colony forming assays, mammosphere assays, 3D culture models and tumor xenograft assays that can be used to assess BCSC function.

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

세포 및 조직 샘플에서 인간 유방암 줄기 세포의 분리 및 기능 평가

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major ...

암 연구학

Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of TGF-&#946; signaling can lead to breast cancer. TGF-&#946; elicits its effects on proliferation and differentiation via specific cell surface TGF-&#946; type I and type II receptors (i.e., T&#946;RI and T&#946;RII) that contain an intrinsic serine/threonine kinase domain. Upon TGF-&#946;-induced heteromeric complex formation, activated T&#946;RI elicits intracellular signaling by phosphorylating SMAD2 and SMAD3. These activated SMADs form heteromeric complexes with SMAD4 to regulate specific target genes, including plasminogen activation inhibitor 1 (PAI-1, encoded by the SERPINE1 gene). The induction of epithelial-to-mesenchymal transition (EMT) allows epithelial cancer cells at the primary site or during colonization at distant sites to gain an invasive phenotype and drive tumor progression. TGF-&#946; acts as a potent inducer of breast cancer invasion by driving EMT. Here, we describe systematic methods to investigate TGF-&#946; signaling and EMT responses using premalignant human MCF10A-RAS (M2) cells and mouse NMuMG epithelial cells as examples. We describe methods to determine TGF-&#946;-induced SMAD2 phosphorylation by Western blotting, SMAD3/SMAD4-dependent transcriptional activity using luciferase reporter activity and SERPINE1 target gene expression by quantitative real-time-polymerase chain reaction (qRT-PCR). In addition, methods are described to examine TGF-&#946;-induced EMT by measuring changes in morphology, epithelial and mesenchymal marker expression, filamentous actin staining and immunofluorescence staining of E-cadherin. Two selective small molecule TGF-&#946; receptor kinase inhibitors, GW788388 and SB431542, were used to block TGF-&#946;-induced SMAD2 phosphorylation, target genes and changes in EMT marker expression. Moreover, we describe the transdifferentiation of mesenchymal breast Py2T murine epithelial tumor cells into adipocytes. Methods to examine TGF-&#946;-induced signaling and EMT in breast cancer may contribute to new therapeutic approaches for breast cancer.

We describe a systematic workflow to investigate TGF-&#946; signaling and TGF-&#946;-induced EMT by studying the protein and gene expression involved in this signaling pathway. The methods include Western blotting, a luciferase reporter assay, qPCR, and immunofluorescence staining.

유방암과 정상 세포에서 TGF β 신호 및 TGF β 유도 된 상피 - 중간 엽 전환 연구

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of ...

Isolation of Primary Cancer-Associated Fibroblasts from a Syngeneic Murine Model of Breast Cancer for the Study of Targeted Nanoparticles

Cancer-associated fibroblasts (CAFs) are key actors in the context of the tumor microenvironment. Despite being reduced in number as compared to tumor cells, CAFs regulate tumor progression and provide protection from antitumor immunity. Emerging anticancer strategies aim to remodel the tumor microenvironment through the ablation of pro-tumorigenic CAFs or reprogramming of CAFs functions and their activation status. A promising approach is the development of nanosized delivery agents able to target CAFs, thus allowing the specific delivery of drugs and active molecules. In this context, a cellular model of CAFs may provide a useful tool for in vitro screening and preliminary investigation of such nanoformulations.
This study describes the isolation and culture of primary CAFs from the syngeneic 4T1 murine model of triple-negative breast cancer. Magnetic beads were used in a 2-step separation process to extract CAFs from dissociated tumors. Immunophenotyping control was performed using flow cytometry after each passage to verify the process yield. Isolated CAFs can be employed to study the targeting capability of different nanoformulations designed to tackle the tumor microenvironment. Fluorescently labeled H-ferritin nanocages were used as candidate nanoparticles to set up the method. Nanoparticles, either bare or conjugated with a targeting ligand, were analyzed for their binding to CAFs. The results suggest that ex vivo extraction of breast CAFs may be a useful system to test and validate nanoparticles for the specific targeting of tumorigenic CAFs.

This paper aims to provide a protocol for the isolation and culture of primary cancer-associated fibroblasts from a syngeneic murine model of triple-negative breast cancer and their application for the preclinical study of novel nanoparticles designed to target the tumor microenvironment.&#160;

표적 나노 입자의 연구를 위한 유방암의 합성 Murine 모형에서 1 차적인 암 관련섬유세포의 격리

Cancer-associated fibroblasts (CAFs) are key actors in the context of the tumor microenvironment. Despite being reduced in number as compared to tumor ...

<meta charset="utf8"></head><body>전이성 유방암 치료를 위한 발암성 miRNA-10b를 표적으로 하는 나노약물

Monitoring of Nanodrug Accumulation in Murine Breast Cancer Metastases

Metastatic breast cancer is a devastating disease with very limited therapeutic options, calling for new therapeutic strategies. Oncogenic miRNAs have been shown to be associated with the metastatic potential of breast cancer and are implicated in tumor cell migration, invasion, and viability. However, it can be difficult to deliver an inhibitory RNA molecule to the tissue of interest. To overcome this challenge and deliver active antisense oligonucleotides to tumors, we utilized magnetic iron oxide nanoparticles as a delivery platform. These nanoparticles target tissues with increased vascular permeability, such as sites of inflammation or cancer. Delivery of these nanoparticles can be monitored in vivo by magnetic resonance imaging (MRI) due to their magnetic properties. Translation of this therapeutic approach into the clinic will be more accessible because of its compatibility with this relevant imaging modality. They can also be labeled with other imaging reporters such as a Cy5.5 near-infrared optical dye for correlative optical imaging and fluorescence microscopy. Here, we demonstrate that nanoparticles labeled with Cy5.5 and conjugated to therapeutic oligomers targeting oncogenic miRNA-10b (termed MN-anti-miR10b, or &#34;nanodrug&#34;) administered intravenously accumulate in metastatic sites, opening a possibility for therapeutic intervention of metastatic breast cancer.

<meta charset="utf8"></head><body>Murine Breast Cancer Metastases의 나노약물 축적 모니터링

Here, we describe the protocol for in vivo delivery of magnetic iron oxide nanoparticles carrying RNA oligomers to metastatic breast cancer in animal models, providing a clinically viable approach for the therapeutic silencing of oncogenic nucleic acids.

Murine Breast Cancer Metastases의 나노약물 축적 모니터링

Metastatic breast cancer is a devastating disease with very limited therapeutic options, calling for new therapeutic strategies. Oncogenic miRNAs have ...

Utilization of the Soft Agar Colony Formation Assay to Identify Inhibitors of Tumorigenicity in Breast Cancer Cells

Given the inherent difficulties in investigating the mechanisms of tumor progression in vivo, cell-based assays such as the soft agar colony formation assay (hereafter called soft agar assay), which measures the ability of cells to proliferate in semi-solid matrices, remain a hallmark of cancer research. A key advantage of this technique over conventional 2D monolayer or 3D spheroid cell culture assays is the close mimicry of the 3D cellular environment to that seen in vivo. Importantly, the soft agar assay also provides an ideal tool to rigorously test the effects of novel compounds or treatment conditions on cell proliferation and migration. Additionally, this assay enables the quantitative assessment of cell transformation potential within the context of genetic perturbations. We recently identified peptidylarginine deiminase 2 (PADI2) as a potential breast cancer biomarker and therapeutic target. Here we highlight the utility of the soft agar assay for preclinical anti-cancer studies by testing the effects of the PADI inhibitor, BB-Cl-amidine (BB-CLA), on the tumorigenicity of human ductal carcinoma in situ (MCF10DCIS) cells.

Here, we document the use of the soft agar colony formation assay to test the effects of a peptidylarginine deiminase (PADI) enzyme inhibitor, BB-Cl-amidine, on breast cancer tumorigenicity in vitro.

소프트 한천 콜로니 형성 분석의 활용은 유방암 세포에서 종양 유발의 억제를 확인하는

Given the inherent difficulties in investigating the mechanisms of tumor progression in vivo, cell-based assays such as the soft agar colony formation ...

Automated Preparation of [68Ga]Ga-3BP-3940 on a Synthesis Module for PET Imaging of the Tumor Microenvironment

A fast, efficient method has been developed on the GAIA synthesis module for automated gallium-68 radiolabeling of 3BP-3940, a molecular imaging probe targeting the fibroblast activation protein for positron emission tomography imaging of the tumor microenvironment. The reaction conditions involved acetate buffer (final concentration: 0.1 M), methionine as an anti-radiolysis agent (final concentration: 5.4 mg/mL), and 30 &#181;g of 3BP-3940, with heating for 8 min at 98 &#176;C. A final purification step on a C18 cartridge was necessary to obtain a radiolabeled product of high purity. In contrast, the generator-produced 68Ga was used directly without a concentration step on a cation exchange cartridge. The production of three validation batches confirmed the method&#39;s reliability, allowing the synthesis of [68Ga]Ga-3BP-3940 in 22.3 &#177; 0.6 min with high radiochemical purity (RCP), as determined by both radio-HPLC (99.1% &#177; 0.1%) and radio-TLC (99.2% &#177; 0.1%). The average radiochemical yield, based on RCP values measured by radio-HPLC, was 74.4% &#177; 3.3%. The stability of the radiolabeled product was demonstrated for up to 4 h after preparation. This protocol provides a reliable, rapid, and efficient methodology for the preparation of [68Ga]Ga-3BP-3940, which can easily be transposed to a clinical setting.

This research describes the automated process for [68Ga]Ga-3BP-3940 production with the GAIA V2 synthesizer, for PET imaging of fibroblast activation protein. The results of quality control tests performed on three test batches are also presented.

A fast, efficient method has been developed on the GAIA synthesis module for automated gallium-68 radiolabeling of 3BP-3940, a molecular imaging probe ...

NFκB 활동과 유방암 줄기 세포를 금지합니다 합성 및 아스피린 - 푸마 레이트의 전구 약물의 특성

요약

더 많은 비디오 탐색

이 비디오의 챕터

여러 종양 마커의 대상으로하기위한 Polymalic 산 기반의 나노 생물 고분자 물질 : 개인화 된 약을위한 기회?

인간 유방 선암과 Tamoxifen과 Neuroblastoma 셀의 7-deoxypancratistatin의 소설 합성 C-1 아날로그에 의한 Apoptotic 및 Autophagic 유도의 향상

세포 및 조직 샘플에서 인간 유방암 줄기 세포의 분리 및 기능 평가

유방암과 정상 세포에서 TGF β 신호 및 TGF β 유도 된 상피 - 중간 엽 전환 연구

표적 나노 입자의 연구를 위한 유방암의 합성 Murine 모형에서 1 차적인 암 관련섬유세포의 격리

Murine Breast Cancer Metastases의 나노약물 축적 모니터링

Murine Breast Cancer Metastases의 나노약물 축적 모니터링

Murine Breast Cancer Metastases의 나노약물 축적 모니터링

소프트 한천 콜로니 형성 분석의 활용은 유방암 세포에서 종양 유발의 억제를 확인하는

Automated Preparation of [⁶⁸Ga]Ga-3BP-3940 on a Synthesis Module for PET Imaging of the Tumor Microenvironment