R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

The authors declare they have no competing financial interests

여기 프로토콜은 높은 처리량 시퀀싱 기술을 사용하여, 전체 단백질 포화 돌연변이 라이브러리의 관능 평가를 수행하기 위해 설명된다. 상기 방법의 중요한 특징은 클로닝 과정에서 직교하는 프라이머의 사용이다. 간단히, 각각의 아미노산 위치는 무작위 돌연변이 유발 PCR로되고, 시퀀스 길이 결합 높은 처리량 시퀀싱에 의해 수용되는 위치의 그룹으로 함께 혼합 하였다. 이러한 그룹은 직교 프라이밍 사이트 함께 혼합하고 선택 대상의 쌍을 포함하는 플라스미드 벡터로 클로닝하고, 직교 프라이머를 사용하여 디 멀티플렉싱하고,이어서 깊이 서열. 돌연변이 길이 제한 시퀀스 내의 판독 한정되기 때문에,이 방법은 유용 수가 긴 서열보다 크기가 유전자 돌연변이를 포함하는 길이가 읽혀 최대화한다. 또한,이 기술은 전체 mutatio 동시 또는 &quot;하나의 배치&quot;선택을 허용워크로드뿐만 아니라 돌연변이 선택 상이한 레벨을 경험할 가능성을 줄여 NAL 라이브러리. 실제로, 프로토콜 크게 우려 조직의 중요한 단계 : 복제 프로세스 (프로토콜 단계 2.3) 중 하나는 그룹으로 돌연변이 PCR 제품의 올바른 혼합하고 올바른 직교 프라이밍 사이트 벡터에 그 이후의 복제를 확인해야합니다; 서열 분석 용 시료의 제조 (프로토콜 단계 4.1) 중에 올바른 직교 프라이머뿐만 아니라 프라이머는 NNS 서브 라이브러리 그룹들 각각을 분리 및 인덱스 시퀀스를 추가하는 데 사용되어야한다. 프로토콜의 세 가지 단계 - 라이브러리 구성, 선택 및 시퀀싱 - 여러면에서 변형 될 수있다. 다양한 기술을 사용하여 돌연변이를 도입 할 수 라이브러리 건설 중 하나, 예를 들어, 오류가 발생하기 쉬운 PCR에 의해, 또는 대안적인 뉴클레오티드의 작은 부분에 도핑하여 합성 된 올리고 뉴클레오티드를 이용하여 유전자를 구성하여21이야. 하나는 단백질의 세그먼트 (즉, NNS 서브 라이브러리 그룹), 또는 다른 유전자형 배경 (22)에 내 두 번 이상 주문 돌연변이를 포함하는 라이브러리를 구성 할 수 있습니다. 중요한 것은, 도서관 건설 단계의 모든 수정 그러나 시퀀스와 시퀀스의 돌연변이의 위치 사이의 대응은 길이가 유지 읽기 기준을 만족해야한다. 이 기준에 따라서 단백질에서 여러 돌연변이의 광범위한 연구 향해 프로토콜의 적용을 제외한다. 프로토콜의 두번째 부분에 대한 변경은 다른 선택 조건을 포함한다 : (. 예를 들면, 온도, 영양 단계) 다른 β 락탐 종류 (또는 그 조합)와 농도, 외부 응력 조건을 호스트 유형 (예, 세균의 종류), 또는 다른 샘플링 시간 (일 시간). 예를 들어, 이전의 연구에서 우리는 하나의 아미노산 돌연변이의 피트니스 효과를 검토TEM-1 암피실린 상이한 농도 아래에서 그리고 3 세대 세 팔로 스포린 세포 탁심 13 미만. 프로토콜의 세 번째 단계에 관해서는, 우리는 현재 (재료의 표 참조) 여기에 사용 시퀀싱 플랫폼의 선택에서 일탈하지 않는 것이 좋습니다. 순서는 길이가 다른 플랫폼에서 현재 더 이상 참으로 읽는 동안, 수를 얻을 수있는 현재까지 낮은 읽고; 일반적으로, 돌연변이의 영향을 결정할 수되는 정밀도가 얻어 읽기 수 (프로토콜 단계 4.2.5의 식 참조)에 비례한다. 크게 간략화를 위해, 프로토콜은 그러나 여기서 설명하는 방법은 높은 처리량을 선택하거나 스크리닝 분석법 장소에있는 다른 시스템들로 확장 될 수 있으며, 모델 시스템으로 TEM-1 β - 락타 마제를 사용한다. 이러한 분석을 구축하는 것은 그러나 종종이 아닌 사소한 첫째, 함께 유전자 (돌연변이)과 단백질의 구획화위한 전략이 수립되어야한다셀 내에서의 (a 미세 유체 플랫폼에서와 같이) 액적, 또는 파지 디스플레이에 의​​해, 예를 들면. 두번째, 가장 중요한 것은, 단백질의 기능과 선택 표현형 적합성 간의 양적 연결이 확립되어야한다. 대사 또는 항생제 내성에 관여하는 효소, 영양소 탈락이나 항생 배지에서 성장하는 세포의 능력은 종종 효소 활성의 직접적인 함수이다. 더 합성 방법은 리포터 유전자에 결합 친 화성을 ​​단백질 - 단백질 결합에 의해, 예를 들어, 다른 시스템에서 사용될 수있다 (예., 형광 단백질) 박테리아에서 발현 또는 효모 11,23 또는 마이크로 유체 시스템 (24)의 형광 효소 기질을 사용하여 . 마지막으로, 이러한 분석은 전체 단백질 돌연변이 라이브러리의 크기를 해결하기 위해, 확장 가능해야한다. 요약하자면, 전체 단백질 포화 돌연변이 라이브러리의 기능 평가를위한 높은 처리량 시퀀싱 기반 접근법은 DESCR여기 ibed. 접근 방식의 핵심 유전자를 따라 세그먼트 내의 돌연변이 라이브러리의 건설, 다중화 및 역 다중화 라이브러리의 각 세그먼트에 태그를 직교 프라이머 바코드의 활용이다. 우리는이 프로토콜 용이 적절한 높은 처리량 스크린 선택 또는 개발되어있는 다른 단백질에 적용 할 수 있다고 예상된다.

돌연변이 긴 생물학적 시스템과 진화의 성질을 연구하고, 향상되며 신규 한 기능 돌연변이 단백질 또는 생물체를 생성하기 위해 실험에 사용되었다. 초기 접근 방식은 생물의 무작위 돌연변이를 생산하는 방법에 의존하지만, 재조합 DNA 기술의 출현은 사이트 별 방식으로 DNA에 대한 선택의 변화, 즉., 부위 특이 적 변이 1, 2를 소개하고 연구 할 수 있었다. 현재의 기술은, 일반적으로 중합 효소 연쇄 반응 (PCR) 돌연변이 유발에 올리고 뉴클레오티드를 이용하여, 주어진 유전자 돌연변이 3,4- 적은 수 (예., 점 돌연변이)를 작성하고 평가하기가 비교적 용이 한 것이다. 이것은 훨씬 더 어렵고 그러나 때 목표 방법, 예를 들면, 제작 및 평가 모두 가능한 단일 사이트 (또는 고차) 돌연변이. 많은 반면 m 다수의 평가하려 초기 연구에서 알게 된유전자 utations는 사용 된 기술은 5-7 균주 독립적 넌센스 감지기를 사용하여 각 돌연변이의 평가를 필요로하는, 예를 들면, 종종 힘들고되었는지 또는 인해 생거 시퀀싱 (8)의 저 시퀀싱 깊이로 그 정량 능력을 제한 하였다. 이러한 연구에서 사용 된 기술은 주로 높은 처리량 시퀀싱 기술 9-12를 이용하는 방법에 의해 대체되어왔다. 라이브러리 전의 이러한 개념적으로 간단한 접근 기능을위한 화면이나 선택에 라이브러리를 실시 돌연변이의 다수를 포함하는 라이브러리를 생성 수반하기 다음 깊은 시퀀싱 (예.,&gt; 10 6 서열의 순서 판독) 선택 후. 이러한 방식으로, 돌연변이 다수의 표현형 적합성 효과, 각 돌연변이의 인구 주파수의 변화로서 표현 동시에 더욱 정량적으로 평가할 수있다. 우리는 이전에 SIMP 소개(. 즉, 전체 단백질 포화 돌연변이 라이브러리) 단백질 모든 가능한 단일 아미노산 돌연변이 라이브러리를 평가하는 해당 긴 서열보다 길이 유전자를위한 제작 방법 길이 11,13 읽기 : 첫째, 각 아미노산 위치는 랜덤 화 에 의해 돌연변이 PCR을 현장 지시했다. 이 과정에서 유전자 시퀀싱 플랫폼에 의해 수용 총 길이 인접한 위치로 이루어지는 그룹들로 분할된다. 각 그룹의 돌연변이 PCR 제품은 결합하고, 각 그룹이 독립적으로 선택 및 높은 처리량 시퀀싱을 실시한다. 시퀀스 및 시퀀싱 판독 길이 돌연변이의 위치와의 대응 관계를 유지함으로써, 이러한 접근 방식은 최대화 시퀀싱 깊이의 장점을 갖는다 :. 하나는 단순히 그룹 (예를 들어, 표준 산탄 의해으로 분할하지 않고 짧은 창에서 그러한 라이브러리 시퀀스 수 있지만 시퀀싱 방법)이 대부분의 야생형 따라서 m 것이다 수득 읽기낭비 시퀀싱 처리량 ajority (80 최소 % 100 아미노산 (300 BP) 창에서 서열 500 아미노산 단백질의 전체 단백질 포화 돌연변이 라이브러리의 예는 야생형 서열 것이다 판독). 여기에서, 프로토콜은 (도 1에 설명) 상기 방법을 이용하여, 전체 단백질 포화 돌연변이 라이브러리의 기능 평가를위한 높은 처리량 시퀀싱을 활용하는 제시된다. 중요한 것은 선별 또는 선택을 동시에 행하여들이 하나의 라이브러리로 다중화 될 수 있도록 각 시퀀스 그룹을 바코드하도록 라이브러리 클로닝 과정에 직교하는 프라이머의 사용을 소개하고 깊은 시퀀싱 디 멀티플렉싱. 시퀀스 그룹이 독립적으로 선택을 실시하지 않기 때문에,이 부하를 감소시키고, 각 돌연변이의 선택의 동일한 레벨을 경험할 것을 보장한다. TEM-1 β-lactamase에, 높은 수준의 내성을 부여하는 효소β - 락탐 항생제 (예., 암피실린) 박테리아는 14-16 모델 시스템으로 사용된다. 프로토콜은 E.에서 TEM-1의 전체 단백질 포화 돌연변이 라이브러리의 평가에 대해 설명한다 암피실린 임상 용량 (50 μg의 / ㎖) (17, 18)에 대한 대략의 혈청 수준에서 선택 하에서 대장균.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

직교 프라이밍 사이트를 포함하는 다섯 가지 변형 인 pBR322 플라스미드의 플라스미드지도 (pBR322_OP1 - pBR322_OP5)는도 2a에 도시된다. 직교 프라이머의 PCR은 다섯 pBR322_OP1-5 플라스미드와 함께, 각각의 직교의 프라이머 각 쌍을 사용하여 수행하거나, 모든 플라스미드를 뺀 직교 프라이머 쌍을 일치 플라스미드하고, 특정 여부를 테스트한다. 일치하는 플라스미드가 포함 된 경우 올바른 제품은 획득하고, 어떤 크기의 어떤 제품은 그것의 부재 (그림 2B)에서 얻어진되지 않았다. 대표적인 실험이 텍스트 (도 1)에 기술 된 프로토콜은 다음을 수행 하였다. 처리는 다음 (프로토콜 4.2) 6.2 × 10 6은 예비 선택 상태로부터 판독 6.3 × 10 6를 50㎍ / ㎖의 암피실린 선택 컨디셔닝로부터 판독에 얻었다. 얻어진 각 카운트는 예비 선택 조건에서 산 돌연변이 특성 로그 정규 분포 (도 3a) (13)를 표시 아미노. 돌연변이의 98.9 %를 예비 선택 배양 서열에서 적어도 하나의 계수에 (465 미만 100 카운트가 하였다)을 얻었다 91.2 %로하고, 100보다 큰 카운트 (58에는 카운트가 없었다).도 3b는 상대 운동 효과를 나타낸다 () TEM-1의 각 위치에서 각각의 돌연변이에 대한; 도 3c에 도시되어 분포. 50 μg의 / ㎖의 암피실린의 선택에 따라, 대부분의 돌연변이는 (그림 3B 흰색 픽셀과 그림 3C에서 큰 피크에 해당하는 ≈ 0) 중립 또는 거의 중립적 인 피트니스 효과가 있습니다. 이 농도에서 돌연변이의 작은 분획 (도 3b 및도 3c에서 가장 왼쪽 끝의 청색 화소에 대응 &lt;&lt; 0) 체력에 상당한 영향을 미친다; 특급<html> ectedly, 이들은 고도의 보존 활성 부위 잔기 (S70, K73, S130, D131, N132, K234 및 G236) (13, 14) 내에서 돌연변이를 포함한다. 예상 할 수 있듯이 TEM-1 암피실린 가수 분해에 매우 효율적이기 때문에 대조적으로, 몇 가지 돌연변이는 상당히 ((그림 3B에서 빨간색 화소에 대응 &gt;&gt; 0) TEM-1의를 통해 체력을 증가 <img alt="식 (14)" src="/files/ftp_upload/54119/54119eg14.jpg" /> ≈ 10 7 M -1의-1) 14. <img alt="그림 1" src="/files/ftp_upload/54119/54119fig1.jpg" /> 그림 1. 암피실린 선택에서 TEM-1 β-lactamase를위한 전체 단백질 포화 돌연변이 유발 프로토콜의 개요. 프로토콜에 설명 된대로 작업은 굵은 글씨로 표시됩니다. 번호가 매겨진 프로토콜 단계는 본문에 참조, 왼쪽에 표시됩니다.K &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 2" src="/files/ftp_upload/54119/54119fig2.jpg" /> 그림 2. 직교 초벌 사이트 플라스미드 벡터의 검증. 직교 프라이밍 사이트 (- pBR322_OP5 pBR322_OP1)를 포함하는 다섯 수정 나 pBR322 플라스미드에 대한 (A) 플라스미드지도입니다. 직교 프라이밍 사이트의 위치와 방향이 표시됩니다. 여러 제한 부위의 위치가 표시되어 있습니다; (전체 TEM-1 유전자 및 프로모터를 포함한다)를 TEM-1 전체 단백질 포화 돌연변이 유발 라이브러리는 AatII과 AvrII 제한 부위 사이에-복제됩니다. 약어 : TET 테트라 사이클린 내성 유전자, 복제 기원 오라이 (B)과 직교 프라이머 (OP1-OP5)의 각 쌍 또는 모든 플라스미드를 뺀 각 플라스미드 다섯 pBR322_OP1-5 플라스미드 (+)를 포함하는 PCR 시험 하였다 (. ˗). 도시는 에티 디움 브로마이드스테인드 아가로 오스 겔 각 PCR 반응로드, 크기가 전기 영동에 의해 분리 (/ V w 1 %). 예상 된 크기의 생성물은 1628 bp의이고; 첫 번째 차선이 DNA 사다리이며, 관련 표준의 크기가 표시됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54119/54119fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/54119/54119fig3.jpg" /> TEM-1 β-lactamase를 전체 단백질 포화 실험 그림 3. 결과. (A) 히스토그램 예비 선택 상태에서 라이브러리의 높은 처리량 시퀀싱으로부터 얻은 각 아미노산 돌연변이를위한 계수의 분포를 나타내는. 단순화를 위해, 제로 카운트 (53 돌연변이)에 돌연변이가 하나의 수를 갖는으로 표시됩니다. 모든 단일 아미노산 돌연변이의 (B) 피트니스 효과를 TEM-1의 선택에 따라 / ㎖의 앰피 실린 50 μg의에서. 도시 된 데이터는푸른 나타내는 해로운 효과 비색 도시 상대 피트니스 효과 ()를 포함하는 행렬은 야생형에 긍정적 인 영향과 흰색없는 피트니스 효과 상대를 빨간색. 더 카운트가 사전 선택 문화에서 얻은되지 않았다하는 돌연변이는 블랙 색상이 지정됩니다. 행이 기본 시퀀스에 따라 위치를 묘사하고 열 스물 아미노산 중 하나에 돌연변이를 표시 또는 종결 코돈 (하나의 문자 코드로 나타낸을 중지 코돈 *이다); TEM-1의 2 차 구조는 오른쪽에 표시되어 활성 사이트 내 왼쪽과 몇 가지 매우 보존 모티브로 표시된다. (C) 히스토그램 상대 피트니스 효과의 분포를 나타내는. 사전 선택 문화를 시퀀싱에서 얻은&gt; 100 카운트 그 돌연변이 결과를 보이고있는 바와 같다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54119/54119fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:kEEP-와-next.within 페이지 = &quot;항상&quot;&gt; <tbody><tr><td> 시약 </td><td> 질량 또는 볼륨 </td><td> 댓글 </td></tr><tr><td> Typtone </td><td> 2g </td><td></td></tr><tr><td> 효모 추출물 </td><td> 0.5 g </td><td></td></tr><tr><td> 염화나트륨 </td><td> 0.06 g </td><td></td></tr><tr><td> 염화칼륨 </td><td> 0.02 g </td><td></td></tr><tr><td> 황산 마그네슘 </td><td> 0.24 g </td><td></td></tr><tr><td> 정제수 </td><td> 100 ㎖ </td><td></td></tr></tbody></table> 표 1. 슈퍼 최적의 국물 (SOB). 100 ml의 SOB (프로토콜 단계 1.1)의 제조에 사용되는 시약 이름과 수량. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 질량 권매화 </td><td> 댓글 </td></tr><tr><td> Typtone </td><td> 10g </td><td></td></tr><tr><td> 효모 추출물 </td><td> 5g </td><td></td></tr><tr><td> 염화나트륨 </td><td> 10g </td><td></td></tr><tr><td> 정제수 </td><td> 1 L </td><td></td></tr></tbody></table> 표 2. 루리아 - 베르 타니 국물 (LB). 시약 이름과 수량은 1 L LB (프로토콜 단계 1.1)의 제조에 사용됩니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 질량 또는 볼륨 </td><td> 댓글 </td></tr><tr><td> Typtone </td><td> 10g </td><td></td></tr><tr><td> 효모 추출물 </td><td> 5g </td><td></td></tr><tr><td> 염화나트륨 </td><td> 10g </td><td></td></tr><tr><td> 한천 </td><td> 15g </td><td></td></tr><tr><td> 정제수 </td><td> 1 L </td><td></td></tr></tbody></table> LB 한천 (프로토콜 단계 1.1)의 제조에 사용되는 표 3 LB 한천. 시약 이름과 수량. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </td></tr><tr><td> 5 배 PCR 버퍼 </td><td> 1,450 μL </td><td></td></tr><tr><td> PCR 첨가제 </td><td> 1,450 μL </td><td></td></tr><tr><td> 2 밀리미터의 dNTPs </td><td> 725 μL </td><td> 2 mM의 각 염기 </td></tr><tr><td> 50 μM의 AatII_F 또는 AvrII_R 프라이머 </td><td> 145 μL </td><td></td></tr><tr><td> 1 NG / μL pBR322_AvrII 플라스미드 </td><td> 145 μL </td><td></td></tr><tr><td> 2 단위 / μL DNA 중합 효소 </td><td> 72.5 μL </td><td></td></tr><tr><td> 물 </td><td> 363 μL </td><td></td></tr></tbody></table> 표 4. 1 라운드 변이원성 PCR 마스터 믹스. 제 1 라운드 돌연변이 PCR (프로토콜 단계 2.2.1)의 마스터 믹스를 준비하기위한 시약 이름과 수량. 총량 290 25 μL의 반응에 충분하다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </td></tr><tr><td> 5 배 PCR 버퍼 </td><td> 1,450 μL </td><td></td></tr><tr><td> PCR 첨가제 </td><td> 1,450 μL </td><td></td></tr><tr><td> 2 밀리미터의 dNTPs </td><td> 725 μL </td><td> 2 mM의 각 염기 </td></tr><tr><td> 50 μM AatII_F 프라이머 </td><td> 145 μL </td><td></td></tr><tr><td> 50 μM AvrII_R 프라이머 </td><td> 145 μL </td><td></td></tr><tr><td> 2 단위 / μL DNA 중합 효소 </td><td> 72.5 μL </td><td></td></tr><tr><td> 물 </td><td> 2973 μL </td><td></td></tr></tbody></table> 표 5. 두 번째 라운드 변이원성 PCR 마스터 믹스. 두 번째 라운드 돌연변이 PCR (프로토콜 단계 2.2.2)의 마스터 믹스를 준비하기위한 시약 이름과 수량. 총 수량은 290 25 ㎕의 반응에 충분하다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </td></tr><tr><td> 5 배 PCR 버퍼 </td><td> 20 μL </td><td></td></tr><tr><td> PCR 첨가제 </td><td> 20 μL </td><td></td></tr><tr><td> 2 밀리미터의 dNTPs </td><td> 10 μL </td><td> 2 mM의 각 염기 </td></tr><tr><td> 50 μM AvrII_F 프라이머 </td><td> 2 μL </td><td></td></tr><tr><td> 50 μM의 AatII_OP1_R - AatII_OP5_R 프라이머 </td><td> 2 μL </td><td> 각각의 플라스미드와 결합 반응 당 하나의 프라이머, </td></tr><tr><td> 1 NG / μL pBR322_OP1-5 플라스미드 </td><td> 2 μL </td><td> 반응 당 하나의 플라스미드 </td></tr><tr><td> 2 단위 / μL DNA 중합 효소 </td><td> 1 μL </td><td></td></tr><tr><td> 물 </td><td> 43 μL </td><td></td></tr></tbody></table> 표 6. 복제 벡터 PCR. 시약 이름과 클로닝 벡터 (프로토콜 단계 2.3.2)를 확인하기 위해 PCR을 제조하는 양. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </td></tr><tr><td> 10 배 제한 효소 완충액 </td><td> 5 μL </td><td></td></tr><tr><td> 4 단위 / μL AvrII </td><td> 2.5 μL </td><td></td></tr><tr><td> 20 단위 / μL AatII </td><td> 0.5 μL </td><td></td></tr><tr><td> 제한 다이제스트에 DNA </td><td> 500 NG에 대한 볼륨 </td><td></td></tr><tr><td> 물 </td><td> 50 ㎕의 총 부피로 </td><td></td></tr></tbody></table> 표 7. 제한은 소화. 시약 이름과 수량을 클로닝 벡터와 NNS 서브 라이브러리 그룹 (프로토콜 단계 2.3.3)의 제한 다이제스트에 대해. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </td></tr><tr><td> 배 T4 DNA 리가 아제 완충액 </td><td> 5 μL </td><td></td></tr><tr><td> 정제 제한 소화 NNS 서브 라이브러리 그룹 DNA </td><td> 48 NG에 대한 볼륨 </td><td></td></tr><tr><td> 정제 제한 소화 클로닝 벡터의 DNA </td><td> 52 NG에 대한 볼륨 </td><td></td></tr><tr><td> 400 유닛 / μL의 T4 DNA 리가 </td><td> 1 μL </td><td></td></tr><tr><td> 물 </td><td> 20 ㎕의 총 부피로 </td><td></td></tr></tbody></table> 3 벡터 : 1의 제한 소화 NNS 서브 라이브러리 그룹과 클로닝 벡터의 결찰 표 8. 결찰 시약 이름과 수량. 몰비 (프로토콜 단계 2.3.4)를 삽입합니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 음량 </td><td> 댓글 </st룽&gt; </td></tr><tr><td> 5 배 PCR 버퍼 </td><td> 55 μL </td><td></td></tr><tr><td> PCR 첨가제 </td><td> 55 μL </td><td></td></tr><tr><td> 2 밀리미터의 dNTPs </td><td> 27.5 μL </td><td> 2 mM의 각 염기 </td></tr><tr><td> 2 단위 / μL DNA 중합 효소 </td><td> 2.75 μL </td><td></td></tr><tr><td> 물 </td><td> 113 μL </td><td></td></tr></tbody></table> 표 9. PCR 시약 높은 처리량 시퀀싱에 대한 샘플을 준비합니다. NNS 서브 라이브러리 그룹 분리 직교 프라이머 (4.1.1)와 디 멀티플렉싱에 사용되는 PCR 마스터 믹스를 준비하기위한 시약 이름과 수량 (프로토콜 단계 4.1.2) 및 인덱싱 시퀀스 (프로토콜 단계 4.1.3)를 추가. 총량 11 25 μL 반응에 충분하다.

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

우리는 높은 처리량 시퀀싱을 이용하여 단백질의 종합적인 단일 사이트 포화 돌연변이 라이브러리의 기능 평가를위한 프로토콜을 제시한다. 중요한 것은,이 방법은 라이브러리 구축 및 시퀀싱을 다중화하는 직교 프라이머 쌍을 사용한다. 암피실린의 임상 적 투여 량에서 선택 TEM-1 β-lactamase를를 사용하는 대표적인 결과가 제공된다.

높은 처리량 시퀀싱을 활용하여 전체 - 단백질 포화 돌연변이 유발 도서관의 기능 평가를위한 프로토콜

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

a-protocol-for-functional-assessment-whole-protein-saturation

Nanyang Technological University

Research

JoVE Journal

Biology

10.8K 조회수.  University of Texas Southwestern Medical Center.  우리는 높은 처리량 시퀀싱을 이용하여 단백질의 종합적인 단일 사이트 포화 돌연변이 라이브러리의 기능 평가를위한 프로토콜을 제시한다. 중요한 것은,이 방법은 라이브러리 구축 및 시퀀싱을 다중화하는 직교 프라이머 쌍을 사용한다. 암피실린의 임상 적 투여 량에서 선택 TEM-1 β-lactamase를를 사용하는 대표적인 결과가 제공된다. 

비디오: A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying potassium (referred to as GIRK) channels, which are important for regulating the excitability of neurons. There are four different mammalian GIRK channel subunits (GIRK1-GIRK4) - we focus on GIRK2 because it forms a homotetramer. Stimulation of different types of G protein-coupled receptors (GPCRs), such as the muscarinic receptor (M2R), leads to activation of GIRK channels. Alcohol also directly activates GIRK channels. We will show how to mutate one amino acid by specifically changing one or more nucleotides in the cDNA for the GIRK channel. This mutated cDNA sequence will be amplified in bacteria, purified, and the presence of the point mutation will be confirmed by DNA sequencing. The cDNAs for the mutated and wild-type GIRK channels will be transfected into human embryonic kidney HEK293T cells cultured in vitro. Lastly, whole-cell patch-clamp electrophysiology will be used to study the macroscopic potassium currents through the ectopically expressed wild-type or mutated GIRK channels. In this experiment, we will examine the effect of a L257W mutation in GIRK2 channels on M2R-dependent and alcohol-dependent activation.

We will demonstrate how to study the effect of a single point mutation on the function of an ion channel.

이온 채널의 돌연변이 유발과 기능 분석 Heterologously 포유 동물 세포에 표현

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

연구

생물학

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel production 1. Chemical methods to modify or degrade cellulose typically require strong acids and high temperatures. As such, enzymatic methods have become prominent in the bioconversion process. While the identification of active cellulases from bacterial and fungal isolates has been somewhat effective, the vast majority of microbes in nature resist laboratory cultivation. Environmental genomic, also known as metagenomic, screening approaches have great promise in bridging the cultivation gap in the search for novel bioconversion enzymes. Metagenomic screening approaches have successfully recovered novel cellulases from environments as varied as soils 2, buffalo rumen 3 and the termite hind-gut 4 using carboxymethylcellulose (CMC) agar plates stained with congo red dye (based on the method of Teather and Wood 5). However, the CMC method is limited in throughput, is not quantitative and manifests a low signal to noise ratio 6. Other methods have been reported 7,8 but each use an agar plate-based assay, which is undesirable for high-throughput screening of large insert genomic libraries. Here we present a solution-based screen for cellulase activity using a chromogenic dinitrophenol (DNP)-cellobioside substrate 9. Our library was cloned into the pCC1 copy control fosmid to increase assay sensitivity through copy number induction 10. The method uses one-pot chemistry in 384-well microplates with the final readout provided as an absorbance measurement. This readout is quantitative, sensitive and automated with a throughput of up to 100X 384-well plates per day using a liquid handler and plate reader with attached stacking system.

This protocol describes a high throughput screen for cellulolytic activity from a metagenomic library expressed in Escherichia coli. The screen is solution based and highly automated, and uses one-pot chemistry in 384 well microplates with the final readout as an absorbance measurement.

Metagenomic 도서관에서 Cellulase 활동 Biomining에 대해 높은 처리량 화면

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

에서 단백질의 감독 진화에 대한 돌연변이 유발 및 기능 선택 프로토콜 E. 대장균</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

Competitive Genomic Screens of Barcoded Yeast Libraries

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment.

We have developed comprehensive, unbiased genome-wide screens to understand gene-drug and gene-environment interactions. Methods for screening these mutant collections are presented.

Barcoded 효모 게놈 라이브러리의 경쟁력 화면

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Lipidic Mesophases의 막 단백질의 높은 처리량을 결정하기위한 로봇의 사용

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

The nematode C. elegans has emerged as an important model for the study of conserved genetic pathways regulating fat metabolism as it relates to human obesity and its associated pathologies. Several previous methodologies developed for the visualization of C. elegans triglyceride-rich fat stores have proven to be erroneous, highlighting cellular compartments other than lipid droplets. Other methods require specialized equipment, are time-consuming, or yield inconsistent results. We introduce a rapid, reproducible, fixative-based Nile red staining method for the accurate and rapid detection of neutral lipid droplets in C. elegans. A short fixation step in 40% isopropanol makes animals completely permeable to Nile red, which is then used to stain animals. Spectral properties of this lipophilic dye allow it to strongly and selectively fluoresce in the yellow-green spectrum only when in a lipid-rich environment, but not in more polar environments. Thus, lipid droplets can be visualized on a fluorescent microscope equipped with simple GFP imaging capability after only a brief Nile red staining step in isopropanol. The speed, affordability, and reproducibility of this protocol make it ideally suited for high throughput screens. We also demonstrate a paired method for the biochemical determination of triglycerides and phospholipids using gas chromatography mass-spectrometry. This more rigorous protocol should be used as confirmation of results obtained from the Nile red microscopic lipid determination. We anticipate that these techniques will become new standards in the field of C. elegans metabolic research.

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

We present robust biochemical and microscopic methods for studying Caenorhabditis elegans lipid stores. A rapid, simple, fixing-staining procedure for fluorescent lipid droplet imaging leverages the spectral properties of the lipophilic dye Nile red. We then present biochemical measurement of triglycerides and phospholipids using solid phase extraction and gas chromatography-mass spectrometry.

에서 지방 질량의 생화학 및 높은 처리량 미세 평가<em&gt; Caenorhabditis Elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

집에서 만든 듀얼 글로우 루시 페라 제 분석 실험을 사용하여 높은 처리량 기능 검사

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

High Throughput Microinjections of Sea Urchin Zygotes

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of treatment solution is loaded into a microinjection needle that is used to physically inject individual immobilized cells or embryos. Despite the need for initial training to perform this procedure for high-throughput delivery, microinjection offers maximum efficiency and reproducible delivery of a wide variety of treatment solutions (including complex mixtures of samples) into cells, eggs or embryos. Applications to microinjections include delivery of DNA constructs, mRNAs, recombinant proteins, gain of function, and loss of function reagents. Fluorescent or colorimetric dye is added to the injected solution to enable instant visualization of efficient delivery as well as a tool for reliable normalization of the amount of the delivered solution. The described method enables microinjection of 100-400 sea urchin zygotes within 10-15 min.

Microinjection is a common technique used to deliver DNA constructs, mRNAs, morpholino antisense oligonucleotides or other treatments into eggs, embryos, and cells of various species.

성게 접합자의 높은 처리량 Microinjections

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

높은 처리량 시퀀싱에 의한 마이크로 RNA 정량을위한 작은 RNA 분자의 고효율 내고

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...