우리는도 초파리 그림에 대한 Polan 산토스와 대런 Obbard 감사합니다. (2A), 마르셀로 제이콥스 - 로레나 JHMRI의 insectary의 사용. 이 작품은 생명 과학 연구 재단의 교제 (HLT)에 의해 지원되었다, 대학 보조금위원회 홍콩 광역 / B-07 / 99 (MCF), 그리고 NIH가 NS096677, NS037402 및 NS083373 (JMH)를 부여합니다. 호 램 당나라는 생명 과학 연구 재단의 Shurl와 케이 쿠 르치 재단 연구원이다.

CaspaseTracker의 파리 1. 준비 <ol><li> 이 크로스를 수행 CaspaseTracker (DQVD)를 제조 실험을 위해 파리하려면 7-10 처녀 여성을 전송 (또는 남자), UBI-CaspaseTracker는 G-TRACE (유비가&gt; 중지&gt; GFP-NLS; UAS-FLP UAS-RFP를) × 카스파 바이오 센서 기판 mCD8-DIAP1-GAL4를 운반하는 남성 (또는 여성)의 동일한 번호로 유비퀴틴 프로모터 (35) 함께하여 G-의 동형 접합 조합의 치사율을 피하기 위해 두 번째 염색체 CYO 분산이 G-TRACE 파리를 중심 날아 TRACE (UAS-RFP, UAS-FLP, 그리고 유비는&gt; 중지&gt; GFP-NLS) 34. 장소는 단백질 소스로 신선한 효모 페이스트와 신선한 식품 유리 병에 날아간 다. </li><li> 5 ~ 7 일 (최대 이주)을 위해 18 ° C에서 파일을 품어 후 부모가 새로운 자손과 과밀 방지하기 위해, 새로운 사육 병을 설정 유리 병에서 파리 제거합니다. </li><li> 자손이 eclose 파리까지 18 ° C에서 배양을 계속합니다. 비 CYO을 선택 [비 다CaspaseTracker 및 G-TRACE 요소 (35)에 대한 형질 전환됩니다 CaspaseTracker의 정확한 유전자형의 urly 날개] 자손. </li><li> 동시에, 특정 CaspaseTracker의 RFP 및 GFP의 형광을 확인하기 위해 컨트롤 부모의 비 형질 전환 w118 파리와 카스파를 구분 (DQVA)를 병렬로 날아 생성합니다. </li><li> 프라이머를 사용하여 CaspaseTracker와 파일을 확인하기 위해 PCR의 유전자형을 수행합니다 : 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA을하는 3897 bp의 제품을 생산. G-추적 궤적을 유전형를 들어, GFP (474 ​​BP)에 대해 다음 프라이머를 사용, 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC의 GTC의 CAT GCC GAG AGT GAT C; RFP (258 BP)에 대한, 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; 및 Flpase (655 BP), 5&#39;- CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG에 대한 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C를 pUWR 벡터의 유전자형 GAL4 (554 BP), 5&#39;-GAA GCA CAC CTT CGC ATC의 GCT의 경우 CAGTCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT의 AGA. </li></ol> 2. 조직 준비, 염색 및 장착 <ol><li> 플라이 해부를 들어, 물에 용해 1 % 소 혈청 알부민 플라스틱 피펫 팁과 원심 분리기 튜브, 코트 팁 및 튜브 (BSA)에 달라 붙는 해부 조직을 방지 할 수 있습니다. </li><li> 해부는 집게를 사용하여 실리콘 쿠션에 날아갑니다. <ol><li> 조직의 절개를 수행 할 때 딱딱한 표면에 집게의 끝 손상을 방지하기 위해, 실리콘 표면에 절개를 수행합니다. 실리콘 해부 판을 들어, 제조업체 지침 (자료 목록)에 따라 상업 키트에 실리콘을 용융. 실리콘을 용융 한 후, 60mm 직경의 조직 배양 접시에 3 ~ 4 mL를 넣어. 실리콘 요리를 재사용 할 수 있습니다. </li><li> CO 2 플라이를 마취하고, 차가운 PBS 1 ml로 실리콘 플레이트에 옮긴다. 블로우 건을 이용하여 플라이를 함유하는 바이알에 이산화탄소를 도입하고 마취 플라이 t 전송할공동 2 공급 장치가 OA 패드. </li><li> 머리와 foregut 사이의 연결을 손상시키지 않고 덮고 몸에서 플라이 헤드를 분리 반대 방향으로 가슴을 끌어 플라이 머리를 잡아 포셉 한 쌍의와 집게의 두 번째 쌍을 사용합니다. </li><li> 흉부에서 날개와 다리를 제거하기 위해 집게 2 쌍을 사용합니다. </li><li> 흉부를 잡아 포셉 한 쌍을 사용하고 포셉의 다른 쌍은 foregut과 중장 사이의 연결을 손상시키지 않고 다시 가슴에서 분리하기 위해 복부를 당겨. </li><li> 이전에 입증 된 바와 같이 뇌, 창자, malpighian 세관 및 난소를 포함한 내부 장기를 해부하다. 39 ~ 41을 </li><li> 이 조직은 강한 형광도를 생산으로 집게로 표피의 모든 조각과 지방의 몸을 제거합니다. 인내와 연습과 같이 전체 기관의 시스템을 준비해야합니다. </li></ol></li><li> 1.5 ML의 원심 분리기 튜브에 해부 조직을 전송하고, 조직의 위스콘신 해결어둠 속에서 20 회전 30 분 동안 실온에서 PBS 중 4 % 파라 포름 알데히드 0.5 ㎖ (인산염 완충 식염수) 번째 조직에서 표백 RFP 및 GFP를 방지한다. 이후의 염색 결과를 손상시킬 수 장시간 고정을하지 마십시오. </li><li> 부드러운 피펫 팅하여 파라 포름 알데히드를 제거하고 실온에서 0.5 mL를 PBST (PBS + 0.1 % 트리톤 X-100)로 3 회 세척한다. </li><li> 부드러운 흔들림과 함께 밤새 4 ° C에서 0.5 mL의 PBST로 조직을 Permeabilize 하시려면. 짧은 배양이 완료되지 permeabilization과 타협 염색 결과가 발생할 수 있습니다. <ol><li> 그것은 배경의 얼룩을 감소시킬 필요가있는 경우, 대신 PBS 중 1 % BSA와 0.5 mL를 PBST로 조직 배양 고려한다. </li></ol></li><li> 0.5 mL의 PBST로 조직을 3 회 반복한다. </li><li> , 핵 및 사상 굴지 (F-액틴)를 얼룩 / mL의 훽스트의 33342 블루 핵 염료 및 0.3 μm의 알렉사 플 루어 633 Phalloidin의 F - 굴지 얼룩 10 μg의 0.5 mL의 PBST을 적용하고 실온에서 1 시간 w를위한 조직과 동시에 부화하기어둠 속에서 i 번째 부드러운 회전. 이 배경을 증가하므로 장시간 염색을 피하십시오. <ol><li> 면역 염색의 경우와 조직을 고정 투과성이 품어 0.1 % 트리톤 X-100, 0.5 mL의 PBS에서 밤새 4 ° C, 1 얼룩에 : 안티 - ELAV 항체 또는 1 100 희석 방지 카스파 제 -3의 200 희석 밤새 4 °의 C (300 μL). (100) 및 실온에서 1 ~ 3 시간 동안 배양 : 1 희석 해당하는 이차 항체에 의해 수행합니다. 특정 항체 정보 자료 목록을 참조하십시오. </li></ol></li><li> 부드러운 회전에 0.5 mL의 PBST에서 5 분 동안 조직 3 회, 각각을 씻으십시오. </li><li> 피펫으로, 모든 PBST를 제거하고 완전히 하룻밤 실온에서 1-3 시간 또는 4 ° C에 대한 조직을 충당하기 위해 (자료 참조) 200 μL 방지 표백제 장착 에이전트를 추가 할 수 있습니다. 완전히 부착 제를 흡수 한 최적의 조직이 튜브 바닥에 가라 앉을 것이다. </li><li> 사전 깨끗한 물 또는 70 % 에탄올로 유리 슬라이드를하고 GLAS에 에이전트를 설치하여 조직을 전송의 슬라이드. </li><li> 조심스럽게 조직 위에 유리 커버 슬립을 배치합니다. 유리 슬라이드와 overcompression하여 조직을 파괴하지 않도록 커버 슬립에 바셀린을 적용합니다. 휴지와 추가 장착 에이전트를 제거합니다. </li><li> 조직에서 에이전트를 실장 누설을 방지하기 위해 모든 커버 슬립의 가장자리 매니큐어를 적용하여 커버 슬립을 밀봉. </li></ol> 3. 공 초점 현미경 <ol><li> 반전 된 공 초점 에피 형광 현미경을 사용합니다. 그러나, 최대 현미경 바로 사용할 수도있다. 타일링을 이용하여 화상 조직에 의한 부품의 열팽창 및 수축에 초점 XY 평면의 시프트의 편차를 방지하는 안정 실온을 유지한다. 환경 제어 시스템과 포커스 드리프트 보정 시스템 인해 현미경 시스템의 열 평형이 손실이 문제를 방지하는 것을 돕는다. </li><li> 현미경의 무대에 슬라이드를 놓습니다. 낮은 해상도로 여러 시험 화상을 (125 X 125 픽셀)을이자 (ROI)의 전체 영역을 커버하는 데 필요한 타일의 적절한 수를 결정할 거라고. </li><li> 스캔 해상도 등의 500 X 500 픽셀의 이미지를 캡처하는 현미경 검사 시스템을 설정한다. 이미지 (타일)의 각각은 모든면에서 20 % 정도 겹치도록, 같은 20X NA 0.8 커버 글라스를 통해 조직을 분석하기위한 63X NA 1.4 계획 - 고차 색지움 목표로 목표를 선택합니다. </li><li> 긴 파장의 빛이 낮은 사진 표백 원인으로, 여기 파장을 최단하기 위해 긴에서 이미지 순서를 설정합니다. 여기 파장을 최단하는 최장의 순서는 (ⅰ) Phalloidin의 F 액틴 및 활성 카스파 항체 633 nm의 RFP 대 (II) 561 nm의 GFP에 대한 (Ⅲ) 488 nm의, 그리고 (ⅳ) 405 nm의 대 훽스트 핵 얼룩. </li><li> 촬상 동안 조직의 고품질 화상을 얻을 수있는 레이저 강도를 감소시킴으로써 포토 블리 칭을 방지 프로세스를 영상화하는 동안 형광 레이저 여기에 세포의 노출을 최소화한다. </li><li> 전 후마법사 현미경 소프트웨어를 사용하여 이미지를 병합 수집된다. </li></ol>

The authors have nothing to disclose.

여기에서 우리는 건강한 조직에서 광범위한 기초 카스파 활동의 검출을 용이하게 CaspaseTracker의 건설 및 내부 동작을 보여줍니다. 생체 내에서 비 - 아폽토시스 카스파 제 활성을 검출하기위한 중요한 단계는 1) 2) 적절한 컨트롤 카스파 특정 리포터 기능 검증 3) 박리 기술을 실시하는 것은 성인 초파리의 모든 내부 기관계를 관찰하여, 상기 바이오 센서 트랜스와 파리 생성 autofluorescent 유물에서 4) 구별 바이오 센서 활동. 카스파 특정 센서로 사용되는 천연 카스파 분해 가능한 폴리 펩타이드는 바이오 센서에 의한 카스파 제 저해 활성을 방지하기 위해 수정되었습니다. 또한 변형 급속한 GAL4 전사 인자의 열화 및 에피토프 태그의 삽입을 방지하도록 하였다. 우리는 또한 온 몸의 장기 파리의 해부, 면역, 설치 및 비행 조직의 공 초점 현미경을 설명S는 비 - 아폽토시스 카스파 제 활성을 검출한다. CaspaseTracker이 카스파 제 활성의 낮은 수준으로 생존 세포를 검출하기위한 이상적이지만 몇 시간이 바이오 센서에 회전하는 데 필요한, 그것은 실시간 효소 활성 리포터 아니다. 그러나, 우리는 여기에 설명 된 응용 프로그램에 필요한 것보다 훨씬 짧은 가능성이 검출 최소 시간을 결정하지 않았습니다. 이들이 세포 사멸을 연구하기 위해 주로 설계된대로 CaspaseTracker 달리, 다른 카스파 바이오 센서의 주요 제한은 카스파 제 활성의 낮은 레벨을 탐지하는 그들의 없다는 것이다. 카스파의 활동은. 따라서, 카스파 제 활성화의 검출은 종종 가정 49 특정 세포 죽음의 마커가 될 수 있습니다. 이상 30 분에서 대규모 세포 파괴를 일으키는 세포 사멸 자극 다음 증폭 50, 51 그러나 증거를 장착하면 카스파가있는 것을 나타내는 비 세포 사멸, 건강한 세포도 비 degradative 기능. 7-21 presu하루-작업을 수행 카스파의 공간적으로 일시적으로 제한 효소 활성의 의대 낮은 수준은 가능한 기술에 의해 탐지 아래의 가능성이있다. 이 문제는 아마도 강력한 신호를 생성하기 위해 몇 가지 카스파 절단 이벤트를 요구 CaspaseTracker 의해 극복되고, 영구적으로 생체 내에서 이들 세포를 라벨 진행 카스파 제 효소 활성을 필요로하지 않는다. 제시된 증거는 우리가 다른 정체 불명의 ASP 특정 단백질 분해 효소가 CaspaseTracker를 활성화 할 수 있다는 가능성을 배제 할 수 없지만 CaspaseTracker이, 카스파에 대한 특정 있음을 나타냅니다. 그러나 공급은 카스파 제 억제제 펩티드 블록 CaspaseTracker 활동의 칵테일 (미 출판)로 운항하는 항공사. 또한 자신이 카스파 제를 억제하는 바이오 센서를 회피의 중요성을 강조하고, 제어 바이오 센서 및 비 형질 파리의 중요성은 곤충 표피 고유 형광도에 의한 내부 지방 증언을 잘못 결론을 피하기음식이나 다른 혼란 변수를 섭취, 앉아있다. 또 다른 문제는 카스파의 프로 죽음과 비 사망 기능을 구별합니다. 프로 사망 비 죽음 기능은 암을 예방하기 위해 이러한 세포 감염과 후속 제거를 격퇴 예를 들어, 적절한 타이밍 사형 정상적인 생리 상태 사이에서 면역 세포의 확장 셀을 전환하기위한 목적으로 진화 적으로 연결될 수있다. 따라서, 우리는 내부 장기의 관찰 기저 카스파 제 활성의 일부 대신 수십억 세포 사망 추정 수십 인체 매일 발생 겉으로 일치 세포사를 촉진하기위한 시도이다 가능성을 제거 할 수있다. (52) 그러나, 건강 형태를 바이오 센서를 발현하는 세포의 강력 CaspaseTracker가 카스파의 정상적인 하루 작업을위한 카스파 제 활성을 검출 할 수 있음을 나타냅니다. 카스파 제는 세포 비 데스 역할을하도록 제안분아 증식. 이 안정적으로 결합 바이러스 단백질을 발현하는 포유 동물 세포주를 생성하고 직접 휴대 카스파 제를 억제하는 초기 시도 (예를 들어,은 CrmA)과 일치한다. 세포 식민지 수백 빈 제어 벡터와 약물 선택시 발생하지만, 예기치 않게 제로 식민지는 벡터 표현 카스파 제 억제제 (미 출판)로 형질 병렬 문화 형성. 따라서, 카스파 가능성이 현재 과소 평가되는 정상 세포의 광범위한 기능을 가지고 있습니다. 이는 상기 CaspaseTracker 플라이에 기초 바이오 활성이 정상적인 건강한 파리 뉴런을 포함한 대부분의 기관계에 걸쳐 많은 세포 유형에서 검출 된 발견에 의해지지된다. 신경 세포의 건강 카스파 활동은 세포 사멸시와 동일한 기판을 절단하여 정상적인 뇌 기능을 촉진하기 위해 시냅스 엔딩을 해체하거나, 자신의 하루 작업 기능은 세포 사멸과 같은 활동에서 완전히 구별 할 수있다. 활성이 높은 효소 수준에 비해 낮은 반면카스파는이 가능성을 지원하는 특정 카스파 uncleavable 기판을 몇 쫓고 돌연변이 동물이, 하루 작업 및 세포 죽음 사이의 중요한 구별 할 수있다. 17,53 그러나, 최근의 진보는 카스파 제 8 RIPK를 절단에 의해 가능 necroptosis을 억제을 나타냅니다, (54) 시냅스 우울증과 AMPA 수용체의 세포 내 이입이 주사위 놀이의 카스파 제 절단에 의해 조절 될 수있다 Gap43, 55 마이크로 RNA 처리의 카스파 제 절단에 의해 조절 될 수있다. 14,15,56 이 바이오 센서의 많은 추가 응용 프로그램이 있습니다. 카스파는 특정 시간 또는 특정 조직에서, 바이오 센서의 발현을 용이 (Gal80ts를 사용하는 예) 시간적으로 조절 될 수 있고 특정 유형의 세포 (예를 들어, 특정 후각 GAL4 드라이버)의 활성화 여부를 결정한다. caspas 것을 나타내는, 성인의 출현은 아직 널리 바이오 센서 활동의 결과 날아까지 바이오 센서의 발현을 억제하는 Gal80ts를 사용하여ES 성인 단계 (도 6c 및 d)에서 활성화 될 수있다. (35)를 다른 카스파 특정 바이오 센서를 포함하는 다른 카스파 기판, 다른 애플리케이션과 DIAP1 단편을 대체함으로써 특정 기판의 절단을 검출. CaspaseTracker 바이오 센서는 비 - 아폽토시스 카스파 활동의 역할에 대한 이해를 향상시킬 것이다.

카스파는 키 아스 파르 테이트 잔류 후 많은 세포 내 단백질을 절단하여 사멸 세포 사멸을 매개 시스테인 프로테아제이다. 예를 들어, 개시제 카스파는 효과기 카스파, derepress DNA의 뉴 클레아 제, 쪼개짐 세포 골격 성분을 활성화하고 신속하게 세포를 분해하고, 셀 시체 처리 인접 셀하여 인식 말림을 자극하는 세포막의 지질 조성 변화. 1-4 이것은 추정 세포의 수십억 인간의 몸에서 하루에 사망하고, 세포 사멸 화학 요법에 의한 종양 세포 사멸의 중요한 메커니즘이다. 5 카스파의 다른 세트는 선천성 면역을 자극하는 독특한 비 세포 사멸 과정에 의해 세포 사멸의 원인이 될 수 있습니다. (6) 따라서, 카스파 대부분의 연구는 직업 죽음의 기능에 초점을 맞추고있다. 흥미롭게도, 현장에서 초기 증거 홍보 세포 죽음에 책임이있는 같은 카스파도 아닌 죽음의 F를 밝혀unctions. 선구적인 연구는 카스파는 배아 동안 세포 증식 및 이동의 규제를 포함하여 건강한 세포에서 다양한 세포 기능에 관여하고 있음을 증명하고있다. 7-9 카스파가 다른 necroptotic 세포 사멸 경로를 차단, 초파리 10, 11에 spermatid 개별화 필요 마우스 (12, 13), 그리고 마이크로 RNA 프로세싱에 C. 간스. 14, 15 아마도에서 가장 오래 살았다 세포, 신경 세포, 카스파 및 기타 세포 사멸 기계가 시냅스 엔딩을 치기에 의해 신경 세포 활동의 조절에 관여하는, 생각하는 과정은 학습과 기억에 대한 다른 시냅스를 강화하는 것이 중요합니다. 16 18 카스파가 전체 세포 죽음없이 작은 신경 돌기의 미니 고사의 유형에 의해 시냅스 가지 치기를 촉진하는 것이 가능하다. (19) 그러나, 카스파는 세포 사멸과 같은 이벤트에 관련이없는 다른 기능을 가질 수있다. (20, 21) 이중 역할삶과 죽음에들 카스파에 고유하지 않습니다; 증명되지 않았지만 BCL-2 패밀리 단백질, 시토크롬 C는 건강한 세포의 세포 에너지 분야에서 역할을 가질뿐만 아니라, 세포 스트레스의 많은 유형에 의해 활성화되는 코어 사멸 경로의 일부이다. 22-25, 그것은 진화 일 연결된 것으로 논리적 보인다 부적합 또는 바람직하지 않은 세포의 적시 제거를 위해 동일한 분자 내 죽음 작업에 -jobs. 현재, 비 - 아폽토시스 카스파 제 활성의 분자 메커니즘 이해되지 않으며, 배아 발달 동안 성인 조직에서 비 - 아폽토시스 카스파 제 활성의 정도는 알려져 있지 않다. 주요 과제는 카스파의 죽음 작업에서 매일 작업을 구별에 어려움이다. 카스파 제 활성은 단백질 분해 케스케이드 의해 증폭되고 세포 자멸사 및 pyroptosis, 대조적으로, 카스파의 하루 작업은 많은 가능한 TECHN하여 검출 가능성이 아래 효소 활성의 훨씬 낮은 레벨을 발생 예상ologies. 여기에 제시된 작업 이전에, 나머지는 다른 목적을 위해 카스파 다양한 바이오 센서를 개발했다. SCAT 바이오 센서 (예를 들어, ECFP - DEVD - 금성) 빠르게 FRET를 사용하여 배양 세포 및 동물 조직에서 실시간 카스파 활동을 감지합니다. (26, 27)를 카스파 제 절단시, Apoliner (mCD8-RFP-DQVD-의 핵 타겟 GFP 부분 nucGFP)는 자사의 플라즈마 막 밧줄이 카스파에 의해 절단되는 분 이내에 세포 내 relocalization을 겪는다. (28) 마찬가지로, ApoAlert - pCaspase3 - 센서 (NES-DEVD-YFP-NLS)는 카스파 제 절단시 핵 세포질에서 relocalizes. 29, 30을 더 최근 iCasper의 발색단은 세라 초파리 배아 뉴런 실시간 바이오 활성의 검출을 허용, 카스파 제에 의해 분해되지만, 주로 발달 세포 죽음과 연관 될 때 형광을 위해 설계되었다. 후각 뉴런 31 카스파 따라 사망했다 노화 동안에 demonstCPV 바이오 센서 (예를 들어, mCD8-PARP-비너스)의 카스파 제 절단 형태의 면역 검출에 의해 평가. (32, 33) 중요한 것은, 카스파 제 -3의 활성화 된 형태의 척추에 민감한 발현 사이 세포 죽음의 부재에서 발견 된 배양 뉴런 및 소마 핵 CellEvent 리포터 염료의 카스파 종속 형광을 사용하지만, 세포 사멸은 척추 제거 이후까지 지연되었지만 어려움으로 인해 광 독성 발생 하였다 인치 (19)은 따라서 새로운 카스파 바이오 센서가 감지 할 필요 및 생체 내에서 기저 카스파 제 활성을 갖는 세포를 추적. 이러한 어려움을 극복하기 위해, 우리는 CaspaseTracker 지정된 신규 이중 색상 카스파 바이오 센서를 생성. 이 전략은 영구적 라벨 및 생체 내에서 세포를 추적 초파리 G-TRACE FRT 재조합 효소 시스템 (34)과 초파리 카스파 Apoliner 민감한 바이오 센서 (28)의 수정 된 버전을 결합한다. &lt;SUP&gt; 35 GAL4 활성화 된 G-TRACE 시스템. 카스파의 매우 낮은 수준의 적 카스파 활동을 경험 한 모든 세포의 세포질과 영구적 인 핵 타겟 GFP 발현에 RFP 발현의 결과로, CaspaseTracker 활성화 할 수 있습니다 (35)이 시스템은 레이블을 지정할 수 있습니다 초파리 melanogaster의, 카스파 제 및 세포 사멸 연구에 대한 취급 용이하고 널리 사용되는 모델 시스템을 사용하여 전체 동물의 일생 동안 세포. 36-38

<table border="0" cellpadding="0" cellspacing="0" width="949">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">CONSUMABLES AND REAGENTS</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td style="width:223px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vectashield</td>
			<td style="width:229px;">Vector Products</td>
			<td style="width:225px;">H-1000</td>
			<td>Mounting medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forceps</td>
			<td style="width:229px;">Ted Pella</td>
			<td style="width:225px;">#505 (110mm, #5)</td>
			<td>Dumont tweezer biology grade, stainless steel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hanging Drop Slides</td>
			<td style="width:229px;">Fisher Scientific</td>
			<td style="width:225px;">12-565B</td>
			<td>Glass slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoechst 33342</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">H1399</td>
			<td>DNA stain</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor 633 Phalloidin</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">A22284</td>
			<td>Actin stain</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">Rat-Elav-7E8A10 anti-elav antibody</td>
			<td style="width:229px;">&#160;Developmental Studies Hybridoma Bank (DSHB)</td>
			<td style="width:225px;">Antibody Registry ID:&#160; AB_528218&#160;</td>
			<td>Stain for Drosophla pan-neuronal ELAV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Cleaved caspase-3 (Asp175) antibody</td>
			<td style="width:229px;">Cell Signaling Technology</td>
			<td style="width:225px;">#9661</td>
			<td>Stain for active fragment of caspase-3</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ProLong Gold antifade reagent</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36934</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">ProLong Diamond Antifade Mountant</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36961</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">SylGard 182 Silicone Elastomer Kit</td>
			<td style="width:229px;">Dow Corning&#160;</td>
			<td style="width:225px;">Product code: 0001023934</td>
			<td>for dissection plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">EQUIPMENT</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LSM780 confocal microscope</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Carl Zeiss Stereomicroscope Stemi 2000&#160;</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Drosophila dissection</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150W</td>
			<td style="width:229px;">AmScope</td>
			<td style="width:225px;">WBM99316&#160;</td>
			<td>Light source</td>
		</tr>
	</tbody>
</table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

CaspaseTracker 정상적인 건강한 세포 (그림 1a)에서 카스파 제의 활동을 감지 할 수 있도록 두 가지 주요 구성 요소가 있습니다. 이들 중 첫 번째는 카스파 바이오 Apoliner (도 1b) 본뜬 146 아미노산 카스파 절단 폴리펩티드이다. 이러한 폴리펩티드는 일반적으로 아폽토시스 동안 절단되는 단일 천연 카스파 부위를 포함 DIAP1 (아폽토시스 초파리 억제제)에서 파생 28 카스파에 의해 DrICE. 42, 43 DrICE은 카스파 제 -3 포유 동물 및 절단 가장 알려진 휴대 기판에서와 동일합니다., DIAP1 및 파생 폴리 펩타이드가 특정 아스파르트 산 후 절단되어, Asp20 카스파 인식에 위치한 카스파의 4,32 특성 순서 17 DQVD-20, 그리고 알라 (DQVA)에 의무적 Asp20 잔기의 돌연변이는 폐지 절단. Apoliner, 28와 마찬가지로 42, 43를이 DIAP1 단편 ancho입니다마우스 CD8 (알파 사슬의 아미노산 1-220), 초파리에서 일반적으로 사용되는 도구를 통해 세포막의 세포질에서 빨간색. CD8 막 앵커 카스파 제 활성의 부재의 핵 전좌의 (Apoliner의 경우 nucGFP) 핵 전좌 서열을 함유하는 테더화물을 방지한다. 28 CaspaseTracker의 두번째 주요 성분은 초파리 G-TRACE 시스템이다 어느에서 효모 전사 인자 GAL4는 flippase (FLP) 재조합 효소의 발현을 유도 (동시에 RFP는 유도). (34) Flippase이 nucGFP의 영구적 인 표현을 선도 코돈 정지를 소비세. 카스파 활동에 G-TRACE는 응답하려면, 그것은 Apoliner (그림 1a)의 세포막 - 고정 카스파 제 절단 DIAP1 조각에 G-TRACE를 활성화하는 데 필요한 GAL4를, 테 더링으로 Apoliner 시스템과 결합되었다. (35) 우리는 추가 modif했다CaspaseTracker의 Apoliner 구성 요소에 ications 유틸리티를 향상시킬 수 있습니다. 가장 중요한 카스파 바이오 센서 자체가 잠재적 그렇지 않으면 죽을 것 세포를 보존, 카스파을 저해하지 않는 것이 중요합니다. 강력한 카스파 제 억제제의 예상되는대로 Apoliner의 유전자는 초파리 (28)에 명백한 표현형을 유발하지 않았지만, 세포의 경우에도 가끔 보존 카스파 활동으로 정상 세포를 식별의 목적을 물리 칠 것이다. 그러나 Apoliner에서 DIAP1 조각은 이후 강력하게 DrICE, Asp20. 43 카스파 제 억제 메커니즘에서 절단 DIAP1이 결정 구조에 의해 밝혀졌다 동일한 카스파 제를 억제하는 것으로 나타났다 모티브 (135 DICG-138)를 포함하는 DIAP1에서 Asp135는 카스파 기판 모방과 DrICE 활성 부위에 결합된다 (그러나 절단되지 않음). (43) 생화학 분석 Asp135에서의 Arg의 교체를 DrICE-억제 기능을 폐지 것을 보여 주었다. (43)를 따라서, CaspaseTracker은 카스파 제 저해 Apoliner 마찬가지로 (도 1B). (35)을 방지하기 위해 동일한 D135R 변이 설계되었다 Asp20의 절단 이후 새로이 N 말단에 자연적으로 발생 DIAP1 ASN-의 ASN 시퀀스 CaspaseTracker에서의 Gly-브로로 변경 카스파 제 절단시의 N 엔드 규칙 GAL4의 열화를 방지하는 (도 1B). (28) 또, CaspaseTracker 발현 준비 검출 GAL4의 C 말단에 myc의 태그를 융합. 필요성 35 Apoliner 자신 RFP 및 nucGFP 카세트는 RFP 및 nucGFP가 포함되어 G-TRACE와 호환되도록하기 위해 삭제되었습니다. 28,35 GAL4는 자신의 핵 지역화 신호를 곰과 초파리에서 다른 유전자, GAL4의 REL의 아마 몇 분자에 융합 할 때 강력하게 목표의 DNA 응답 요소 (UAS)을 통해 전사를 활성화하기 때문에세포질 카스파에 의해 완화 몇 시간 (예상 ≤12의 시간) 내에서 RFP 발현을 켭하기에 충분하다. 바이오 센서 활동 드 노보 전사 및 RFP의 변환을 필요로하기 때문에, 실시간으로 효소 활성을보고하지 않는다. 카스파 활동 중단 후 CaspaseTracker의 RFP가 크게 일 이내에 가능성이 저하 될 수 있지만, nucGFP은 세포와 그 자손의 수명에 대한 유비퀴틴 프로모터에 의해 표현 될 것입니다. 첫 번째 CaspaseTracker는 생체 내에서 카스파 제 활성화에 응답이 있음을 입증하기 위해, 성인 CaspaseTracker 바이오 센서 파리는 죽음을 유발 자극을 세포에 노출되었다. 초파리 난소 계란 챔버 동물이 생산 자손 환경 조건에 일치하는 추정 메커니즘 스트레스 프로그램 된 세포 사멸을 겪는다로서 잘 연구 된 세포 죽음 모델이다. 37,44,45 세포 사멸을 유도하기 위해, 바이오 센서 파리 초기 충격을 받았다 1 시간에서 -7° C는 (동물을 냉동), 및 난소는 살아있는 동물 다음날 (그림 2a)에서 해부했다. 미처리 바이오 파리 대조적으로, 저온 충격 후 난자 챔버 현저히 작았 및 (병합도 2b)는 세포 사멸 자극 후 바이오 센서의 작동을 검증 (최근) 강력한 적색 및 녹색 (영구) 바이오 센서의 활성을 나타냈다. 바이오 활성 만 처리 파리에서, 두 생식 세포의 핵 (간호사 세포 모세포) 및 계란 챔버에서 체세포 (모낭 세포)에서 검출되었다. 아폽토시스 35 모폴로지 특성은 용이하게 바이오 양성 계란 챔버에서 관찰 핵 분열, DNA 응축 및 분해 (파란색 얼룩의 손실)을 포함. 바이오 센서의 활동은 모두 핵 응축 (훽스트) 및 활성 카스파 (발현 사이)와 같은 세포에서 발견하지만, 활성 카스파의 가장 강렬한 염색은 지역 핵 DNA 모두와 caspas에서 발생 될 수있다즉 바이오 센서 신호 감소 또는 저하 (도 2b). 초기 충격 이후에 발생하는 46, 47 세포 사멸 메카니즘이 잘되지 않는 특징 및 다른 사멸 메카니즘의 플레이에있을 수 있었다. 그러나, 유사한 결과 세포 사멸을 일으키는 것으로 알려진 아미노산 고갈, 다음을 얻었다. 35 CaspaseTracker 비 세포 사멸 카스파의 활동을 감지 할 수 있는지 확인하려면 건강한 1 일 된 파리의 내부 장기는 꼼꼼하게 autofluorescent 표피와 지방을 제거하여 해부했다. 하나의 대표 파리에서 조직은 근육 세포를 감지하는 핵 및 F - 굴지에 대한 Phalloidin의 얼룩을 표시 훽스트 염색, 장착, 고정되었다. 바이오 센서의 작동이없는 건강한 달걀 챔버 달리 달걀 챔버 사이 F 액틴 염색 근육 세포가 적색 및 녹색 모두 바이오 활동 (도 3a, 인셋)를 가졌다. 그러나 가능하다는 biosensor는 다른 세포 레이블. 다른 많은 건강한 조직과 최적 사육 1 일된 파리 기관 아마 기저 비 아폽토시스 카스파 기능 (도 3a)을 반영 띄는 카스파 바이오 활성을 나타내었다. 바이오 센서 양성 세포는 형태 학적으로 정상 나타나 세포의 특정 부분 집합이 hindgut (그림 3a, 삽입)를 포장 바이오 센서 양성 세포의 예 줄무늬를 들어, 카스파를 활성화 할 것을 제안 조직에서 조직적인 패턴으로 발생했습니다. CaspaseTracker는 카스파 특정 리포터임을 최선 증거 (DQVA에 DQVD 변경, 의무적 인 카스파 제 절단 부위에서 하나의 Asp 알라 아미노산 돌연변이를 제외 CaspaseTracker 동일 제어 바이오 센서를 발현하는 파리의 신호의 부족 그림 1b 및도 3b). 예외적으로 희귀 세포 (그림 3B, 녹색 화살표), 유일한 신호 observ 제외DQVA 제어 바이오 센서 파리에서 에드는 입 부분 (그림 3b) 및 다른 곳에서 섭취 작물의 음식과 (그림 3b, 4), 또한 카스파 바이오 센서 부족 비 형질 전환 부모 파리에서 관찰되는 등 autofluorescent 구조입니다. 35 CaspaseTracker 표지 세포가 malpighian (신장) 세관을 따라 일정한 간격으로 발생하며 종종 동시에 최근 (빨간색)와 과거 (녹색) 카스파 제 활성화 둘을 전시하는 동안 뇌의 많은 세포, 광학 로브, 문부, 자르기, 중장과 난관은 빨간색 또는 녹색 (도 4 및도 5a)입니다. 수명이 긴 세포가 카스파 활동을 살아남을 수 있다는 증거를 들어, 광학 엽이 팬 신경 마커 ELAV (배아 치명적인 이상 비전)에 대한 면역 염색 하였다. (48) 많은 신경 세포의 핵이 두 번 CaspaseTracker 및 ELAV에서 핵 타겟 GFP로 표지 하였다, 수명이 긴 가전과 일치LLS가 아닌 죽음의 기능에 대한 사용 카스파 (그림 5b). 바이오 센서 (Gal80ts 사용) 10 일 동안 꺼져있는 경우 또한, 바이오 센서 양성 세포가 다른 장소 장내 기간 (도 6a 및 b), 뇌 및 지속 (도시하지 않음). 카스파 CaspaseTracker 바이오 센서를 사용하여, 우리는 전체 동물 기저 카스파 제 활성의 개요를 제공한다. <img alt="그림 1" src="/files/ftp_upload/53992/53992fig1.jpg" /> 도 1 : 비 - 아폽토시스 카스파 제 활성을 검출하는 바이오 센서 CaspaseTracker 시스템. (a) 초파리 카스파 바이오 센서 부품. (b) CaspaseTracker 바이오 센서 시스템의 카스파 제 절단 부분 세포막 앵커 (mCD8)로 구성되어, 자연 카스파 절단 사이트 Asp20 함유 DIAP1의 단편이 GAL4의 전사 융합 C- 말단 배-myc의 태그 요소와 유비퀴틴 프로를 통해 표현프로모터. 카스파 제 절단은 G-TRACE 시스템을 유도하는 핵에 GAL4의 전위를 초래한다. 제어 바이오 센서에서, 상기 4 아미노산 카스파 제 절단 부위 (DQVD)에 필요한 Asp20 잔기는 카스파 제 절단 폐지의 Ala (DQVA)로 변경된다. 형질 전환 CaspaseTracker 파리 4 유전자가 포함되어 있습니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53992/53992fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53992/53992fig2.jpg" /> 그림 2 : CaspaseTracker는 세포 사멸 동안 카스파에 의해 활성화된다. (a)는 저온 충격에 의한 세포 사멸에 대한 초파리의 난소 및 흐름도의 개략도. 초파리의 난소 (Polan 산토스에 의해) 도면 및 (대런 Obbard에 의해) 초파리의 이미지를 허락 없이는 사용하실 수 없습니다. (b)는 계란 챔버 6의 난소에서 일 여성 CaspaseTracker 승 공급 (으)로 운항하는 항공사<html> 육일 (치료) 또는 저온 충격 후 1 일 동안 i 번째 정상 플라이 음식 (-7 이어서 25 ° C, 1H, 24 시간 동안 ° C)는 계란 챔버에서 카스파 제 활성화를 유도합니다. 저온 처리 된 난소 (오른쪽 아래 프레임)의 확대 한 핵 응축 (위 계란 실), 핵 분열 (중간 계란 챔버 세트) 및 분해 (낮은 계란의 증거 (약 수직 중심) 체인을 ovariole 개발 한 세 개의 달걀 챔버를 표시 챔버) 훽스트의 DNA 얼룩 (파란색)을 기반으로. 활성 카스파 (안티 카스파 제 -3, 마젠타)는 중간 및 하부 계란 챔버에서 검출된다. RFP 및 GFP 바이오 센서 활동 (빨강, 녹색, 노란색 화살표)는 종종 확산 활성 카스파 (세트)와 얼룩 핵 DNA의 응축 세포에서 발생합니다. 흰색 화살표는 바이오 센서의 활동과 활성 카스파의 발현 사이 모두 부족 핵을 표시합니다. * 자기 형광 신호. 이 데이터는 탕 등. 2015 년 과학 담당자의 허가로 재생된다.source.jove.com/files/ftp_upload/53992/53992fig2large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/53992/53992fig3.jpg" /> 그림 3 : 광범위한 생리 카스파 활동에 대한 증거. (a)는 18 ° C에서 제기 한 새로 eclosed 파리에서 CaspaseTracker (DQVD) RFP 및 nucGFP의 공 초점 이미지를 병합, 해부 및 F - 굴지 (핑크)에 대한 핵 및 Phalloidin의에 대한 H33342로 염색하고, DIC와 함께 몇 군데. Phalloidin의이. 전용 계란 챔버의 삽입 (b)에 나타나있다 동일한 절차 및 이미징 조건을 제어 CaspaseTracker 추적 관찰 (DQVA는) 파리. * Autofluorescent 구조. 이 데이터는 당나라 등의 등의 허가를 재현., 과학 공화국 2015 년이 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53992/53992fig3large.jpg" target="_blank">의 더 큰 버전을 보려면 여기를 클릭하십시오</a>이 그림. <img alt="그림 4" src="/files/ftp_upload/53992/53992fig4.jpg" /> 그림 4 :. 많은 조직에서 기저 카스파 활동 DIC의 높은 배율과 GFP (과거) 및 RFP (최근) CaspaseTracker (DQVD) 활동의 형광 공 초점 이미지 뇌, 분 문부, 자르기, 중장, Malpighian 세관에 핵을 훽스트가 묻은 그리고 그림 3a에서 난관. * Autofluorescent 구조. 이러한 데이터는 당나라의 허가를 재현 외., 과학 공화국 2015 년은 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53992/53992fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53992/53992fig5.jpg" /> 그림 5 : 비 세포 사멸 카스파 활동 초파리의 신경 세포에 </em&gt; 광학 로브. (A) DIC와 뇌의 RFP (최근)과 GFP (과거) CaspaseTracker (DQVD) 활동과 훽스트 묻은 핵와 공 초점 이미지. RFP + GFP 듀얼 라벨 세포 (노란색 화살표). (나) NucGFP 뇌를 조종 CaspaseTracker (DQVD)의 광학 엽의 팬 신경 세포의 핵 ELAV 단백질 발현 사이에 colocalizes. NucGFP 및 ELAV의 공동 현지화 된 신호와 신경 세포 (흰색 화살표) 표시됩니다. RFP 표지 뉴런이 특정 필드에 존재하지 않는, 참고. 이러한 데이터는 당나라의 허가를 재현 외., 과학 공화국 2015 년은 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53992/53992fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

카스파 제 활성의 낮은 농도를 포함하는 전체 동물의 건강한 세포를 검출하기 위해, CaspaseTracker 지정된 고감도 바이오 센서 초파리에 대해 생성 하였다. 카스파 따라 바이오 활성 데스 자극의 부재 하에서 최적 조건 하에서 사육 성인 동물의 내부 장기에 걸쳐 긴 수명이 건강한 세포에서 검출된다.

생체 내에서 바이오 센서는 초파리에서 비 세포 사멸 카스파 활동을 추적

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Nanyang Technological University

Research

JoVE Journal

Biology

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

9.0K 조회수.  Johns Hopkins University Bloomberg School of Public Health.  카스파 제 활성의 낮은 농도를 포함하는 전체 동물의 건강한 세포를 검출하기 위해, CaspaseTracker 지정된 고감도 바이오 센서 초파리에 대해 생성 하였다. 카스파 따라 바이오 활성 데스 자극의 부재 하에서 최적 조건 하에서 사육 성인 동물의 내부 장기에 걸쳐 긴 수명이 건강한 세포에서 검출된다. 

비디오: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

에 대한 Mesoscopic 형광 Tomography 인 - 생체내</em개발> 이미징 Drosophila</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

연구

생물학

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

The morphogenesis of the Drosophila embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell shape changes during embryonic development. One of the challenges faced in studying this structure is that the lumen of the heart tube, as well as the membrane features that are crucial to heart tube formation, are difficult to visualize in whole mount embryos, due to the small size of the heart tube and intra-lumenal space relative to the embryo. The use of transmission electron microscopy allows for higher magnification of these structures and gives the advantage of examining the embryos in cross section, which easily reveals the size and shape of the lumen. In this video, we detail the process for reliable fixation, embedding, and sectioning of late stage Drosophila embryos in order to visualize the heart tube lumen as well as important cellular structures including cell-cell junctions and the basement membrane.

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

We describe a process for fixation, embedding, sectioning, and imaging of late stage Drosophila embryos for Trasmission Electron Microscopy of the embryonic heart tube. This technique allows for the visualization of the heart tube lumen as well as the basement membrane, which lines the lumen of the heart.

의 전자 현미경을위한 배아의 준비 Drosophila 태아의 심장 관

The morphogenesis of the Drosophila  embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell ...

In-vivo Centrifugation of Drosophila Embryos

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species.

In-vivo Centrifugation of Drosophila Embryos

We describe a method to separate organelles by density in living Drosophila embryos. Embryos are embedded in agar and centrifuged. This technique yields reproducible separation of major organelles along the anterior-posterior embryo axis. This method facilitates colocalization experiments and yields organelle fractions for biochemical analysis and transplantation experiments.

Drosophila의 배아들 중에서 - 생체내의 원심 분리

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

서브 세포 해상도 손상 Drosophila의 애벌레의 생체내 이미징에서

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

이온 채널 유학을위한 패치 클램프 및 재관류 기법으로 표현 Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

생활의 이미징 셀 모양 변경 Drosophila 태아

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

사멸 세포 간극의 이미지를하는 동안 라이브<em&gt; 초파리</em&gt; 배아

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to assemble. Therefore, to identify these functional protein complexes, it is important to stabilize them in vivo before cell lysis and subsequent purification. Here we describe a method used to isolate large bona fide protein complexes from Drosophila embryos. This method is based on embryo permeabilization and stabilization of the complexes inside the embryos by in vivo crosslinking using a low concentration of formaldehyde, which can easily cross the cell membrane. Subsequently, the protein complex of interest is immunopurified followed by gel purification and analyzed by mass spectrometry. We illustrate this method using purification of a Tudor protein complex, which is essential for germline development. Tudor is a large protein, which contains multiple Tudor domains - small modules that interact with methylated arginines or lysines of target proteins. This method can be adapted for isolation of native protein complexes from different organisms and tissues.

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Multi-component protein complexes play crucial roles during cellular function and development. Here we describe a method used to isolate native protein complexes from Drosophila embryos after in vivo crosslinking followed by purification of the crosslinked complexes for subsequent structure-function analysis.

생체</em에서 단백질 복합체를 분리> 가교 접근 초파리 태아

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Described here is a rapid and effective procedure for functional reconstitution of purified wild-type and mutant CFTR protein that preserves activity for this chloride channel, which is defective in Cystic Fibrosis. Iodide efflux from reconstituted proteoliposomes mediated by CFTR allows studies of channel activity and the effects of small molecules.

정제 된 야생형과 돌연변이 체 CFTR 단백질의 기능의 재구성 및 채널 활동 측정

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Measurement of Larval Activity in the Drosophila Activity Monitor

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This protocol repurposes an instrument often used to measure adult activity, the TriKinetics Drosophila activity monitor (MB5 Multi-Beam Activity Monitor) to study larval activity. The instrument can monitor the movements of animals in 16 individual 8 cm glass assay tubes, using 17 infrared detection beams per tube. Logging software automatically saves data to a computer, recording parameters such as number of moves, times sensors were triggered, and animals&#8217; positions within the tubes. The data can then be analyzed to represent overall locomotion and/or position preference as well as other measurements. All data are easily accessible and compatible with basic graphing and data manipulation software. This protocol will discuss how to use the apparatus, how to operate the software and how to run a larval activity assay from start to finish.

Measurement of Larval Activity in the Drosophila Activity Monitor

This report describes a method for measuring Drosophila larval activity using the TriKinetics Drosophila Activity Monitor. The device employs infrared beams to detect movements of up to 16 individual animals. Data can be analyzed to represent motion parameters including rates and the positions of the animals within the assay chambers.

에서 애벌레 활동의 측정<em&gt; 초파리</em&gt; 활동 모니터

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This ...

생체 내에서 바이오 센서는 초파리에서 비 세포 사멸 카스파 활동을 추적

요약

더 많은 비디오 탐색

이 비디오의 챕터

에 대한 Mesoscopic 형광 Tomography 인 - 생체내 이미징 Drosophila

의 전자 현미경을위한 배아의 준비 Drosophila 태아의 심장 관

Drosophila의 배아들 중에서 - 생체내의 원심 분리

서브 세포 해상도 손상 Drosophila의 애벌레의 생체내 이미징에서

이온 채널 유학을위한 패치 클램프 및 재관류 기법으로 표현 Xenopus oocytes

생활의 이미징 셀 모양 변경 Drosophila 태아

사멸 세포 간극의 이미지를하는 동안 라이브

생체 가교 접근 초파리* 태아*

정제 된 야생형과 돌연변이 체 CFTR 단백질의 기능의 재구성 및 채널 활동 측정

에서 애벌레 활동의 측정

생체 내에서 바이오 센서는 초파리에서 비 세포 사멸 카스파 활동을 추적

요약

더 많은 비디오 탐색

이 비디오의 챕터

에 대한 Mesoscopic 형광 Tomography 인 - 생체내 이미징 Drosophila

의 전자 현미경을위한 배아의 준비 Drosophila 태아의 심장 관

Drosophila의 배아들 중에서 - 생체내의 원심 분리

서브 세포 해상도 손상 Drosophila의 애벌레의 생체내 이미징에서

이온 채널 유학을위한 패치 클램프 및 재관류 기법으로 표현 Xenopus oocytes

생활의 이미징 셀 모양 변경 Drosophila 태아

사멸 세포 간극의 이미지를하는 동안 라이브

생체 가교 접근 초파리 태아

정제 된 야생형과 돌연변이 체 CFTR 단백질의 기능의 재구성 및 채널 활동 측정

에서 애벌레 활동의 측정

생체 가교 접근 초파리* 태아*