Name: functional complementation analysis (fca): a laboratory exercise designed and implemented to supplement the teaching of biochemical pathways
Uploaded: 2016-06-24T14:00:00.000+00:00
Duration: 9 min 27 s
Description: Watch this Scientific Journal Video about Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways at JoVE.com

AOH 및 MAS는 과학의 대학 지원을위한 기술의 로체스터 연구소의 생명 과학의 토마스 H. Gosnell 학교를 인정한다. 이 작품은 미국 국립 과학 재단 (NSF) AOH MCB-1120541에 수상에 의해 부분적으로 지원되었다.

참고 : 저자는 관심이있는 개인을위한 교육 목적을위한 기능 보완 분석의 통합을 용이하게하기 위해 균주 및 재조합 플라스미드를 제공하고자합니다. 기능적 보완 실험을 용이하게하기 위해 사용 된 플라스미드는하기 표 1에 나열되어있다. 기능 보완을위한 플라스미드 1. 건설 <ol><li> 기능 보완을위한 디아 미노 아미노 전이 효소 (DAPL)의 클로닝. <ol><li> V.에서 DAPL 오픈 리딩 프레임 (ORF)를 증폭 A.에서 spinosum 등 및 cDNA를 장대와 C. PCR에 의한 reinhardtii에서. 15 초 동안 94 ° C의 30주기, 30 초 동안 60 ° C, 2 분 동안 72 ° C이어서 2 분 94 ° C에서 1주기를 사용합니다. 각각의 프라이머 12 pmole의 포함, 1 mM의 황산, 0.5 mM의 4 옥시 뉴클레오티드의 트리 포스페이트의 각, 그리고 템플릿 DNA의 0.5 NG와 PFX 1 부DNA 폴리머 라제. 참고 : 공장 A.로부터 3 DAPL의 orthologs의 재조합 복제에 관한 완전한 설명 장대 (-dapL에서), 박테리아 Verrucomicrobium spinosum 등 (대 -dapL)와 조류 인 Chlamydomonas reinhardtii에서 크롬 (Cr -dapL가) 이전에 출판되었습니다. 2,18-20 참고 : 다음과 같이 DAPL의 orthologs의 복제에 사용 된 프라이머는 다음과 같습니다 : DAPL F- 대 5&#39;- CCCCGAATTCATGGCCCTCATCAACGAAAACTTCCTCAAG-3 &#39; DAPL R 대 5&#39; CCCCGTCGACCTACTTCAGCGCGGCGATACGGCGGCAGAC-3 &#39; DAPL F-에서 5&#39;-GGGGCATTGGAAGGAGATATAACCATGGCAGTCAATACTTGCAAATGT-3 &#39; 에서 DAPL R-5&#39; GGGGGTCGACTCATTTGTAAAGCTGCTTGAATCTTCG-3 &#39; CR DAPL F-5&#39; CCCCCGAATTCATGCAGCTCAACGTGCGGTCCACCGCCAGC- 3 &#39; CR DAPL R -5&#39;- CCCCCAAGCTTCTAGTTACGCTTGCCGTAGGCCTCCTTAAA-3 &#39; </li><li> t로 PCR 단편을 복제그 pET30A이 재조합 플라스미드를 생산하는 플라스미드, pET30A :: 대 DAPL, pET30A :: DAPL 및 프라이머, 제한 효소와 T4 DNA 리가 아제를 사용 pET30A :: CR DAPL에서. <ol><li> 간단히 삽입의 50 NG와 1 배 리가 버퍼 벡터의 20 ng의 하룻밤 17 ° C에서 T4 DNA 리가 아제의 1 단위를 품어. E.으로 내고 변환 LB 플레이트에서 콜로니에 대한 대장균 DH5α 세포와 스크린은 24 시간 동안 37 ℃에서 배양하여 50 μg의 / ㎖ 카나마이신으로 보충 -1. 18-20 </li></ol></li><li> 제한이 pET30A :: CR DAPL 위해를 XbaI 및 SalI로과를 XbaI과 HindIII로 효소와 기능 보완을위한 플라스미드를 만들려면 DAPL 플라스미드에서 pET30A :: 대 DAPL 및 pET30A을 :: 소화. 플라스미드 : pBAD33 대 DAPL 생산 T4 DNA 리가 아제를 사용하여 플라스미드 내로 삽입 pBAD33을 결찰; pBAD33 :: DAPL 및 pBAD33 : CR DAPL에서. <ol><li> 삽입의 50 NG 20 NG를 품다1 배 리가 버퍼 벡터 하룻밤 17 ° C에서 T4 DNA 리가 아제의 1 단위의. E.으로 내고 변환 LB 플레이트에 식민지에 대한 대장균 DH5α 세포와 화면이 24 시간 동안 37 ° C를 배양하여 34 μg의 / ㎖ -1 카나마이신으로 보충. (20) </li></ol></li></ol></li><li> A.에서 티로신 아미노 전이 효소 (tyrB)의 클로닝 기능 보완을위한 장대. 참고 : A.에서의 cDNA의 복제에 관한 자세한 At5g36160은 전술 한 궤적 태그로 주석 장대. (4) <ol><li> PCR에 의해 cDNA를 증폭. 15 초 동안 94 ° C의 30주기, 30 초 동안 60 ° C, 2 분 동안 72 ° C이어서 2 분 94 ° C에서 1주기를 사용합니다. 각 프라이머 12 pmole을 포함 1mM의 황산, 0.5 mM의 네 개의 데 옥시 뉴클레오티드 트리 포스페이트를 각각, 및 주형 DNA 0.5 NG 및 PFX DNA 중합 효소 1 단위. 주 : CL에 사​​용되는 프라이머다음과 같이 At5g36160의 oning은 다음과 같습니다 : tyrB F-에서 5&#39;-CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3 &#39; AttyrB R-5&#39; CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3 &#39; </li><li> EcoR1 및 Sal1 함께 PCR 단편을 절단함으로써 재조합 플라스미드 pET30A :: At5g36160를 생산하는 플라스미드 pET30A로 단편 클론; 후술 T4 DNA 리가 아제를 사용 pET30A에 단편에 결찰. (4) </li><li> 상기 기능성 보완 플라스미드를 작성 제한를 XbaI 및 HindIII로 효소로 pET30A :: At5g36160 다이제스트와 T4 DNA 리가 아제를 이용하여 재조합 플라스미드 pBAD33 :: At5g3160 생산 동일한 제한 효소 부위를 사용 pBAD33에 삽입물을 결찰한다. <ol><li> 삽입의 50 NG와 1 배 리가 버퍼 벡터의 20 ng의 하룻밤 17 ° C에서 T4 DNA 리가 아제의 1 단위를 품어. E.으로 내고 변환 LB 플레이트에 식민지에 대한 대장균 DH5α 세포와 화면이 34 μg의 / ㎖ -1 chlo 보충24 시간 동안 37 ° C를 배양하여 ramphenicol. (4) </li></ol></li></ol></li><li> 의 클로닝은 UDP N V.에서 -acetylmuramoyl-L-알라 닐 D-글루탐산 염 메소 -2,6- 디아 미노 리가 (무레) 기능 보완을위한 spinosum 등. 참고 : V.에서 무레 ORF의 복제 spinosum 등은 이전에 설명되었다. 18 <ol><li> PCR에 의한 오픈 리딩 프레임을 증폭한다. 15 초 동안 94 ° C의 30주기, 30 초 동안 60 ° C, 2 분 동안 72 ° C이어서 2 분 94 ° C에서 1주기를 사용합니다. 각 프라이머 12 pmole을 포함 1mM의 황산, 0.5 mM의 네 개의 데 옥시 뉴클레오티드 트리 포스페이트를 각각 주형 DNA 0.5 NG 및 PFX DNA 중합 효소 1 단위. 그런 다음 플라스미드 pET100D :: 대 무레를 생산하는 플라스미드 pET100D으로 복제. 주 : 다음과 같이 대 무레의 클로닝을 위해 사용 된 프라이머는 : 무레 F-5&#39; CACCATGACCATTTTGCGCGATCTTATCGAGGGT 대 -3 &#39; 대무레 R-5&#39; GTCGACTCACTGACGGTCATCCCTCCTTTGGCGTGC-3 &#39; </li><li> , 기능 보완을위한 플라스미드를 생산하는 pET100D을 소화하려면 :: 대 무레를 제한과를 XbaI 및 Sal1 효소 재조합 플라스미드 : pBAD33 대 무레 T4 DNA 리가 제를 사용하여 생산 pBAD33 내로 삽입 결찰. <ol><li> 하룻밤 17 ° C에서 T4 DNA 리가 아제의 1 단위와 함께 삽입의 50 NG와 1 배 리가 버퍼 벡터의 20 NG를 품어. E.으로 내고 변환 24 시간 동안 37 ° C를 배양하여 34 μg의 / ㎖ -1 클로람페니콜 보충 LB 플레이트에 식민지에 대한 대장균 DH5α 세포와 화면. (8) </li></ol></li></ol></li><li> 기능 보완을위한 Novosphingobium 특검팀에서 RELA / s의 냄비 (RSH)의 클로닝. 참고 :. Novosphingobium 특검팀에서 RSH의 복제는 이전에 기술 된 17. <ol><li> 599 뉴클레오티드의 upst 외에 RSH의 ORF를 증폭PCR에 의해 종결 부위 하류 개시 시작 부위, 46 개 뉴클레오티드의 묶음. 15 초 동안 94 ° C의 30주기, 30 초 동안 60 ° C, 2 분 동안 72 ° C이어서 2 분 94 ° C에서 1주기를 사용합니다. 각 프라이머 12 pmole을 포함 1mM의 황산, 0.5 mM의 네 개의 데 옥시 뉴클레오티드 트리 포스페이트를 각각 주형 DNA 0.5 NG와의 Taq DNA 중합 효소 1 단위. 그런을 pCR2.1 :: NSP의 RSH를 생산하는 플라스미드을 pCR2.1에 클로닝. <ol><li> 증폭 된 PCR 단편의 1 μL,을 pCR2.1 벡터의 1 μL, 소금 용액 1 μL 및 물 1 μl를 품어. 5 분 및 결찰의 2 μL E.으로 25 ° C에서 품어 LB 플레이트에서 콜로니에 대한 대장균 세포 및 스크린 (37)을 배양함으로써 50 μg의 / ㎖ 카나마이신으로 보충 -1 24 시간 동안 C를 °. 주 : 다음과 같이 RSH의 클로닝을 위해 사용 된 프라이머는 : RSH F-5&#39; GTTGAAAAACGCCGAATAGC -3 &#39; RSH R-5&#39; GAGACCTGTGCGTAGGTGGT -3 &#39; </li><li> 기능적 보완 내용을 pCR2.1 플라스미드 : NSP는 EcoR1으로 rsh하여 다이제스트와 T4 DNA 리가 아제를 이용하여 재조합 플라스미드 RSH pRK290 :: NSP 생산 넓은 숙주 범위 pRK290 내로 삽입 결찰. <ol><li> 삽입의 50 NG와 1 배 리가 버퍼 벡터의 20 ng의 하룻밤 17 ° C에서 T4 DNA 리가 아제의 1 단위를 품어. E.으로 내고 변환 LB 플레이트에 식민지에 대한 대장균 DH5α 세포와 화면 (37)을 배양하여 10 μg의 / ㎖ -1 테트라 사이클린 보충 24 시간 동안 C를 °. (17) </li></ol></li></ol></li></ol></li></ol> 변환을 용이하게하기 위해 전기 관할 균체 2. 제조 참고 : 전기 유능한 세포의 제조는 작은 볼륨 (즉, 250 ㎖)까지 확장 할 수 있습니다 문화의 1.0 L의 프로토콜 26을 기반으로합니다. 이 프로토콜은 ㄱ 수 있습니다전자는 FCA를 용이하게하기 위해이 논문에서 설명하는 능력이 모든 변종을 만드는 데 사용. (22) <ol><li> 플라스크에 하나의 식민지로 액체 배지 50 ㎖를 접종하고이 단계 (표 2)를 시작하기 전에 돌연변이의 유전자형을 확인해야하고, 밤을 통해 성장한다. </li><li> 하루 두에서 하룻밤 문화의 50 ㎖와 적절한 배지 (LB 대장균 돌연변이 및 PD Novosphingobium 특검팀에 대한) 1.0 L를 접종하고, 30 ℃에서 (위상 로그인) 0.4-0.6로 OD 600로 증가 기음. </li><li> 4 ℃에서 15 분 동안 5000 × g으로 원심 분리에 의해 수확 된 세포 상등액을 가만히 따르다, 멸균 빙냉 순수한 H 2 O. 500ml에 펠렛을 재현 탁 </li><li> 원심 분리기는 세포는 4 ° C에서 20 분 동안 5,000 XG에서, 뜨는을 가만히 따르다 및 살균 얼음처럼 차가운 10 % 글리세롤 250 ㎖에 펠렛을 재현 탁. </li><li> 4에서 20 분 동안 5,000 XG에서 세포를 원심 분리기 ° C, 슈퍼를 가만히 따르다natant, 10 % 글리세롤, 2.0 ㎖에 펠렛을 재현 탁. </li><li> 드라이 아이스 - 에탄올 욕에서 튜브를 배치하여 즉시 동결 마이크로 원심 분리기 튜브에 50 μl를 전사함으로써 세포를 분취. 전기에 대한 -80 ° C에서 관할 세포를 저장합니다. </li></ol> 보완 플라스미드와 세균 세포의 3 Electroporation에 <ol><li> 일렉트로 들어 적격 세포의 분액 (50 μL)으로 재조합 플라스미드 1.0 μL (10-50 NG)를 첨가하고, 5 분 동안 얼음 상에 놓는다. </li><li> 일렉트로 큐벳에 피펫을 통해 혼합물을 전송하고 다음 설정에 전기 장치를 설정 : 25 μF의 용량, 2.5 kV로, 200 옴 저항 및 펄스를 제공합니다. </li><li> 15 ML 원뿔 튜브에 피펫을 사용하여 복구 일렉트로 큐벳에 미디어 (LB) 및 전송의 1.0 ML을 추가합니다. 진탕 배양기에서 60 분 동안 부드러운 회전을 복구 할 수 있습니다. </li><li> RECO에서 문화의 100 μl를 플레이트한천 플레이트 상에 매우 단계는 피펫에 의해 형질 전환 및 멸균 스프레더를 사용하여 확산을 위해 선택합니다. 주 : 적절한 한천 플레이트를 만들기 위해 항생제와 유전자형을 확인하려면이 단계를 시작하기 전에 표 1과 표 2를 확인해야합니다. </li></ol> AOH1 4. 형질 전환하여 보완 기능을 용이 1,1- 디아 미노 아미노 전이 효소 (DAPL) <ol><li> 보완 분석을 위해, 빈 벡터 (pBAD33)와 AOH1를 변환 및 3.0 절에 설명 된 전기 프로토콜을 사용하여 별도의 변환 이벤트에서 DAPL 발현 벡터와. </li><li> 50 μg의 / ㎖ -1 DAP, 34 μg의 / ㎖ -1 클로람페니콜 50 μg의 / ㎖ -1 카나마이신으로 보충 LB 한천 배지에 도금에 의해 형질 전환을 선택합니다. </li><li> LB 날에 줄무늬에 의해 복제 - 도금 식민지로 기능 보완을위한 테스트0.2 %와 50 μg의 / ㎖ -1 DAP, 34 μg의 / ㎖ -1 카나마이신없이 (w / v)의 아라비 노스와 dium. </li><li> 24 시간 동안 30 ° C에서 번호판을 품어하고 결과를 관찰합니다. 주 : 결과는 벡터만을 제어에 비해 돌연변이 만 DAPL 유전자 돌연변이 배경에서 발현되는 유일한 DAP없는 배지에서 성장할 수 있음을 표시한다. </li></ol> TKL-11 5. 변환은 UDP N의 -acetylmuramoylalanyl-D는 - 글루 타밀 -2,6- 메소 사용 보완 기능을 용이 -diaminopimelate 리가 제 (무레) <ol><li> 빈 벡터 (pBAD33)와 3.0 절에 설명 된 프로토콜을 사용하여 무레 발현 벡터 (pBAD33 :: VsmurE)와 돌연변이 변환. </li><li> LB 한천 배지에 플레이트를 선택 형질 전환 / ㎖ -1 클로람페니콜 50 μg의 / ㎖ -1 티민, 34 μg의 보충 및 24 시간 동안 30 ° C에서 접시를 품어. </li><li> 제어 및 두 개의 LB 매체 플러스 0.2 % (w / v)의 아라비 노스와 50 μg의 / ㎖ -1 티민 상 실험 변환 모두에서 식민지 줄무늬 또는 도금에 의해 보완하기위한 시험. </li><li> 시각적으로 성장 표현형을 평가 한 30 ° C에서 접시와 24 시간 동안 42 ° C에서 다른 품어. 주 : 결과는 돌연변이가 무레 유전자 벡터만을 제어에 비해 돌연변이 배경에서 발현되는 경우에만 42 ℃에서 성장할 수 있음을 표시한다. </li></ol> DL39 6. 변환 타이로신 아미노 전이 효소를 사용하여 보완 기능을 용이하게하기 위해 (tyrB) <ol><li> LB 한천 플레이트에 pBAD33 또는 pBAD33 :: At5g36160 중 하나와 DL39 변환, 선택 형질 전환 섹션에 설명 된 50 μg의 / ㎖ -1 티로신, 50 μg의 / ㎖ -1 페닐알라닌 및 프로토콜을 사용하여 34 μg의 / ㎖ -1 클로람페니콜 보충 3.0. </li><li> 레플리카50 μg의 / ㎖ -1 페닐알라닌과 50 μg의 / ㎖ -1 티로신, 50 μg의 / ㎖ -1 아스 파르 테이트, 50 μg의 / ㎖ -1 류신, 50 ㎍ / ml의 -1 발린 최소한의 (M9) 미디어 -plate 식민지, / ㎖ -1 이소류신 50 μg의, 10 ㎍ / ㎖의 -1 우라실 0.5 % 글리세롤 (/ V w), 0.2 % (w / v)의 아라비 노스. 두 판의 같은 식민지 줄무늬에 의해 페닐알라닌과 티로신 부족한 판에 또한 복제 판 식민지. </li><li> 성장 표현형을 관찰하기 위해 48 시간 동안 30 ℃에서 플레이트를 인큐베이션. 주 : 결과는 벡터만을 제어에 비해 돌연변이 만 돌연변이 배경에서 tyrB 유전자가 발현되는 경우에만, 페닐알라닌 및 티로신이없는 배지에서 성장할 수 있음을 표시한다. </li></ol> Hx699 7. 변환은 Hypomucoid 표현형 Novosphingobium의 SP의 기능 보완을 촉진합니다. 스트레인 Hx699 </P&gt; <ol><li> 3.0 절에 설명 된 변환 프로토콜을 사용하여 2 개의 별도 변환 이벤트에서 야생 형 변형 Novosphingobium 특검팀 변환. (Rr2-17)와 pRK290와 돌연변이 Hx699 및 pRK290 :: RSH NSP. </li><li> 감자 덱 스트로스의 변환 플레이트 (PD) 한천은 10 μg의 / ㎖ -1 테트라 사이클린 보충하고, 최소 24 시간 동안 또는 형질 전환이 나타날 때까지 배양한다. </li><li> 킬 모두 변환 신선한 PD 아가 플레이트에 &quot;X&quot;패턴 30 부화 적어도 4 일 동안 C를 °. 시각적 두 판의 성장 표현형을 조사하여 유일한 벡터 및 실험의 표현형을 관찰한다. 참고 : 결과는 RSH는 벡터 만 제어에 비해 돌연변이 배경으로 표현 될 때 저자 점액 표현형이 보완되는 것을 보여 주어야한다. </li></ol>

<ol>
	<li>Gillum, A. M., Tsay, E. Y., Kirsch, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+the+Candida+albicans+gene+for+orotidine-5'-phosphate+decarboxylase+by+complementation+of+S.+cerevisiae+ura3+and+E.+coli+pyrF+mutations.">Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations.</a> Mol Gen Genet. 198, 179-182 (1984).</li><li>Hudson, A. O., Singh, B. K., Leustek, T., Gilvarg, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+L,L-diaminopimelate+aminotransferase+defines+a+novel+variant+of+the+lysine+biosynthesis+pathway+in+plants.">An L,L-diaminopimelate aminotransferase defines a novel variant of the lysine biosynthesis pathway in plants.</a> Plant Physiol. 140, 292-301 (2006).</li><li>Jander, G., Joshi, V., Last, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspartate-derived+amino+acid+biosynthesis+in+Arabidopsis+thaliana.">Aspartate-derived amino acid biosynthesis in Arabidopsis thaliana.</a> The Arabidopsis Book. , (2009).</li><li>Prabhu, P., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+partial+characterization+of+an+L-Tyrosine+aminotransferase+from+Arabidopsis+thaliana.">Identification and partial characterization of an L-Tyrosine aminotransferase from Arabidopsis thaliana.</a> Biochemistry Research International. , 549572 (2010).</li><li>Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S. V., Machado , M. A., Toth, I., Salmond, G., Foster, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+pathogenic+bacteria+in+molecular+pathology.">Top 10 pathogenic bacteria in molecular pathology.</a> Molecular Plant Pathology. 13, 614-629 (2012).</li><li>McGroty, S. E., Pattaniyil, D. T., Patin, D., Blanot, D., Ravichandran, A. C., Suzuki, H., Dobson, R. C., Savka, M. A., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+Characterization+of+UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:+meso-2,6-diaminopimelate+ligase+(MurE)+from+Verrucomicrobium+spinosum+DSM+4136T.">Biochemical Characterization of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate: meso-2,6-diaminopimelate ligase (MurE) from Verrucomicrobium spinosum DSM 4136T.</a> PLoS ONE. 8 (6), e66458 (2013).</li><li>Hutton, C. A., Perugini, M. A., Gerrard, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+lysine+biosynthesis:+an+evolving+antibiotic+strategy.">Inhibition of lysine biosynthesis: an evolving antibiotic strategy.</a> Mol Biosyst. 3, 458-465 (2007).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical.">(p)ppGpp: still magical.</a> Annu Rev Microbiol. 62, 35-51 (2008).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74, 171-199 (2010).</li><li>Cashel, M., Gentry, D. J., Hernandez, V. J., Vinella, D., Neidhardt, F. C., Curtiss, R., Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., Umbarger, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+stringent+response.">The stringent response.</a> Escherichia coli and Salmonella typhimurium: cellular and molecular biology. , 1458-1496 (1996).</li><li>Chatterji, D., Ojha, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revisiting+the+stringent+response,+ppGpp+and+starvation+signaling.">Revisiting the stringent response, ppGpp and starvation signaling.</a> Curr. Opin. Microbiol. 4, 160-165 (2001).</li><li>Jain, V., Kumar, M., Chatterji, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp:+stringent+response+and+survival.">ppGpp: stringent response and survival.</a> J. Microbiol. 44, 1-10 (2006).</li><li>Kramer, G. F., Baker, J. C., Ames, B. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-UV+stress+in+Salmonella+typhimurium:+4-thiouridine+in+tRNA,+ppGpp,+and+pppGpp+as+components+of+an+adaptive+response.">Near-UV stress in Salmonella typhimurium: 4-thiouridine in tRNA, ppGpp, and pppGpp as components of an adaptive response.</a> J. Bacteriol. 170, 2344-2351 (1988).</li><li>Braeken, K., Moris, M., Daniels, R., Vanderleyden, J., Michiels, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+horizons+for+(p)ppGpp+in+bacterial+and+plant+physiology.">New horizons for (p)ppGpp in bacterial and plant physiology.</a> Trends Microbiol. 14, 45-54 (2006).</li><li>Joseleau-Petit, D., Vinella, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+alarms+and+cell+division+in+Escherichia+coli.">Metabolic alarms and cell division in Escherichia coli.</a> J. Bacteriol. 181, 9-14 (1999).</li><li>Mittenhuber, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+and+evolution+of+genes+encoding+bacterial+(p)+ppGpp+synthetases/hydrolases+(the+Rel,+RelA,+and+SpoT+proteins).">Comparative genomics and evolution of genes encoding bacterial (p) ppGpp synthetases/hydrolases (the Rel, RelA, and SpoT proteins).</a> J. Mol. Microbiol. Biotechnol. 3, 585-600 (2001).</li><li>Gan, H. M., Buckley, L., Szegedi, E., Hudson, A. O., Savka, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+an+rsh+Gene+from+a+Novosphingobium+sp.+Necessary+for+Quorum-Sensing+Signal+Accumulation.">Identification of an rsh Gene from a Novosphingobium sp. Necessary for Quorum-Sensing Signal Accumulation.</a> J. Bacteriol. 191, 2551-2560 (2009).</li><li>Nachar, V. R., Savka, F. C., McGroty, S. E., Donovan, K. A., North, R. A., Dobson, R. C., Buckley, L. J., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+and+biochemical+analysis+of+the+diaminopimelate+and+lysine+biosynthesis+pathway+in+Verrucomicrobium+spinosum:+Identification+and+partial+characterization+of+L,L-diaminopimelate+aminotransferase+and+UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate+ligase.">Genomic and biochemical analysis of the diaminopimelate and lysine biosynthesis pathway in Verrucomicrobium spinosum: Identification and partial characterization of L,L-diaminopimelate aminotransferase and UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate ligase.</a> Front. Microbiol. 3, 183 (2012).</li><li>Hudson, A. O., Gir&#242;n, I., Dobson, R. C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystallization+and+preliminary+X-ray+diffraction+analysis+of+L,L-diaminopimelate+aminotransferase+(DapL)+from+Chlamydomonas+reinhardtii.">Crystallization and preliminary X-ray diffraction analysis of L,L-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii.</a> Acta Cryst. 67, 140-143 (2011).</li><li>Dobson, R. C. J., Gir &#242;n, I., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=L,L-Diaminopimelate+Aminotransferase+from+Chlamydomonas+reinhardtii:+A+Target+for+Algaecide+Development.">L,L-Diaminopimelate Aminotransferase from Chlamydomonas reinhardtii: A Target for Algaecide Development.</a> PLoS ONE. 6 (5), e20439 (2011).</li><li>Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tight+regulation,+modulation,+and+high-level+expression+by+vectors+containing+the+arabinose+pBAD+promoter.">Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter.</a> J. Bacteriol. 177, 4121-4130 (1995).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A laboratory manual. , (2001).</li><li>Lugtenberg, E. J., van Schijndel-van Dam, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature-sensitive+mutants+of+Escherichia+coli+K-12+with+low+activity+of+the+diaminopimelic+acid+adding+enzyme.">Temperature-sensitive mutants of Escherichia coli K-12 with low activity of the diaminopimelic acid adding enzyme.</a> J. Bacteriol. 110, 41-46 (1972).</li><li>Mavrides, C., Orr, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multispecific+aspartate+and+aromatic+amino+acid+aminotransferases+in+Escherichia+coli.">Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli.</a> J. Biol Chem. 250, 4128-4133 (1975).</li><li>Gelfand, D. H., Steinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+mutants+deficient+in+the+aspartate+and+aromatic+amino+acid+aminotransferases.">Escherichia coli mutants deficient in the aspartate and aromatic amino acid aminotransferases.</a> J. Bacteriol. 130, 429-440 (1977).</li><li>Whitaker, R. J., Gaines, C. G., Jensen, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multispecific+quintet+of+aromatic+aminotransferases+that+overlap+different+biochemical+pathways+in+Pseudomonas+aeruginosa.">A multispecific quintet of aromatic aminotransferases that overlap different biochemical pathways in Pseudomonas aeruginosa.</a> J. Biol Chem. 257, 13550-13556 (1982).</li><li>Raskin, D. M., Judson, N., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+stringent+response+in+the+essential+function+if+the+conserved+bacterial+G+protein+CgtA+in+Vibrio+cholera.">Regulation of the stringent response in the essential function if the conserved bacterial G protein CgtA in Vibrio cholera.</a> Proc Natl Acad Sci, USA. 104, 4636-4641 (2007).</li><li>Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+DNA+cloning+system+for+Gram-negative+bacteria:+construction+of+a+gene+bank+of+Rhizobium+meliloti.">Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.</a> Proc Natl Acad Sci, USA. 77, 7347-7351 (1980).</li><li>Watanabe, A., Suzuki, M., Ujiie, S., Gomi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enzymatic+characterization+of+a+novel+&#946;-1,6-glucosidase+from+Aspergillus+oryzae.">Purification and enzymatic characterization of a novel &#946;-1,6-glucosidase from Aspergillus oryzae.</a> J Biosci Bioeng. , (2015).</li><li>Song, J. T., Lu, H., McDowell, J. M., Greenberg, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+key+role+for+ALD1+in+activation+of+local+and+systemic+defenses+in+Arabidopsis.">A key role for ALD1 in activation of local and systemic defenses in Arabidopsis.</a> Plant J. 40, 200-212 (2004).</li><li>Rost, B., Liu, J., Nair, R., Wrzeszczynski, K. P., Ofran, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automatic+prediction+of+protein+function.">Automatic prediction of protein function.</a> Celuular and Molecular Life Sciences. 60, 2637-2650 (2003).</li><li>Norris, S. R., Shen, X., Penna, D. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complementation+of+the+Arabidopsis+pds1+mutation+with+the+gene+encoding+p-Hyrdoxyphenylpyruvate+dioxygenase.">Complementation of the Arabidopsis pds1 mutation with the gene encoding p-Hyrdoxyphenylpyruvate dioxygenase.</a> Plant Physiol. 117, 1317-1323 (1998).</li><li>Mohler, W. A., Blau, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+and+cell+fusion+analyzed+by+lacZ+complementation+in+mammalian+cells.">Gene expression and cell fusion analyzed by lacZ complementation in mammalian cells.</a> Proc Natl Acad Sci, USA. 93, 12423-12427 (1996).</li></ol>

저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

기술의 로체스터 연구소의 생명 공학 및 분자 생명 과학 교과 과정에 필수적인 과정의 대부분은 과정의 강의 부분에 추가하여 실험실 구성 요소를 가지고있다. 학기 2014에서 2015 사이의 교과 과정은 약 60 %를 차지 실험실 성분을 포함 29있는 48 코스, 총이 포함되어 있습니다. 원칙과 사례 (BPP), 실험실 기초 과정 : 하나의 코스는 식물 생화학 및 병리학 (FPBP), 혼합 강의 / 실험 과정 및 Bioseparations의 기본이다. 각 과정의 실험 성분 강의 자료를 강화하도록 설계된다. 예를 들어, 생화학 적 경로 및 신진 대사가 크게 FPBP 및 BPP에서 강조된다. 주제 중 일부는 아미노산 대사, 펩티도 글리 생합성, 식물 이차 대사, 다른 사람의 사이에서 환경 틈새에 세균 응답을 포함한다. 저자는 기능 complem을 통합 한두 코스 실험실 운동으로 정해져있는은 강의 및 또는 사전 실험실 프리젠 테이션에서 설명하는 대사 경로의 이해를 강화합니다. 리스, PG, 티르, 프 박테리아의 엄격한 반응의 생화학 적 경로에 관여하는 유전자들의 기능을 분석하는 기능을 보완 실험을 사용하여 네 가지 예가 설명된다. 저자는 자신의 코스로이 실험 모듈을 통합 한 몇 가지 이유가 있습니다. 첫째, 기능 보완에 노출 분석은 강화 또는 유전학, 진화 유전체학, 생물 정보학 및 생화학 관련된 주제를 소개 할 수있는 훌륭한 도구입니다. 두 번째 실험은 손쉬운이며 물론 실험실 환경에서 수행 될 수있다. 사용되는 시약은 모두 안전하고 사용되는 박테리아는 바이오 안전성 레벨 1로 표시 및 병원성 아니다. 이와 같이, 저자는 플라스미드 및 Ba 등의 시약을 기꺼이자신의 교육 경험의 일부로서 기능 보완 통합에 관심이 누구나 사용할 수 cterial 균주. 박테리아 균주 (TKL-11과 DL39)의 두 가지가 대장균 유전자 증권 센터 (CGSC) (http://cgsc.biology.yale.edu/)에서 직접 얻어 주목해야한다. 이 기능 보완 프로토콜 여러 중요한 단계가 있음을 주목하는 것이 중요하다. 첫 번째 단계는 돌연변이 (들)이 어떤 실험을 시작하기 전에 배양 할 수 있는지 확인한다. 왜냐하면 표 2에 따라, 각각의 돌연변이와 연관된 여러 가지 유전자형이 있다는 것이다. 실험 전에 적격 세포를 준비하는 돌연변이를 성장하기 위해 함께 또는 PG 무레 변이체에 관한 필요한 화학 또는 온도 요구없이 돌연변이 성장보십시오. 이 돌연변이는 모든 실험 전에 진짜임을 입증 때문 또한 교시 모멘트이다. 이것이 유전자의 기능 (들)을 테스트하기위한 훌륭한 도구이지만,이 때문에 항상 관심 유전자 (들)가 적절히의 부족으로 변환 할 수없는 등의 코돈 사용과 같은 여러 가지 요인으로되지 않도록 유의해야한다 돌연변이 생물체의 해당 tRNA에. 그러나, 이것은 일반적으로 돌연변이 (들)의 코돈 사용에 맞게 뉴클레오티드를 변경하여 목적 유전자를 합성함으로써 수행되는 복제 단계 동안 오픈 리딩 프레임 또는 cDNA를 코돈 최적화에 의해 회피 될 수있다. 또 다른 문제는 몇몇 진핵 단백질 기능에 번역 후 변형을 필요로한다는 것이다. 번역 후 변형은 세균의 기능이되지 않고, 하나의 박테리아 변이주를 이용하여 유전자의 기능 (들)을 테스트하기 위해이 기술을 사용하지 못할 수도있다. 우리는 교육 과정에서 강조하는 기술의 중요성은 FCA는 생체 내에서 유전자의 기능을 테스트 할 수있는 좋은 방법은 것입니다.의 특성<html> 효소는 주로 효소 정제 및 기존의 효소 분석이 수행이다 시험관 연구를 기반으로합니다. (29) 또한 기존의 효소 분석 측정 또는 효소 활동을 감지 할 좋은, 하나는 수 종종 &quot;힘 피드&quot;아닌 시중에서 판매하는 기판과 효소 효소에 대한 순수한 자연. 30 FCA은 생리 학적 조건에서 일반적으로하지 않습니다는 시험 관내에 appose과 같은 생리 학적 조건 하에서 작동된다는 사실 주어진 유전자의 기능에 대한 더 확실한 증거를 제공하는 등의 생체 시스템.이 주어 많은 유전자의 기능 및 사실에 대한 정보 부족은 대부분 주석이 예측 (31)에 기초한다는 모호한 남거나 현재 간주되는 것과가 각종의 추정 기능을 가지고 많은 유전자의 기능을 규명하기위한 실험을 용이하게이 기술을 습득 공공 데이터베이스. jove_content &quot;&gt; 종종 유능한 세포의 준비에 경험 기술에 관한 문제 중 하나입니다. 하나는 세포가 세포를 확인하는 이외에 변환 할 수있는 충분한 셀이 있는지 확인하기 위해 제대로 준비가되어 있는지 확인해야합니다 일렉트로 과정 아치 않도록 물과 글리세롤 적절히 세정된다. 하나는 세포의 초기 성장 모두를 용이하게 할 수있는 적절한 화학 물질 또는 적절한 온도에서 성장하도록하여 변이체의 표현형을 인식되어야 기능 보완 분석을위한 돌연변이도. 이 기술을 습득하면, 연구자들은 오랫동안 이러한 분석을 용이하게하기 위해 사용할 수있는 유기체에 적합한 돌연변이가있는 한 유전자의 기능을 평가하는 기능을 보완 분석을 사용할 수있다. 이 원고의 프로토콜이 박테리아의 사용을 설명하는 유의하시기 바랍니다. 같은 그러나, 다른 생물식물과 동물 세포는 그 중에서도 유전자의 기능을 평가하기 위해 사용될 수있다. 32-33 한 바로 실험을 용이하게하기 위해 셀의 변형 및 또는 형질 감염을 최적화하는 적절한 벡터가 추가로 사용하고 있는지 확인해야 .

유전자의 기능 (들)을 해명 / 역할 (들)의 맥락에서 기능적 상보성은 상동 야생형 상태로 관찰 표현형으로 특정 돌연변이를 복원하는 특정 동종 또는 orthologous 유전자의 능력으로 정의된다 또는 orthologous 유전자 돌연변이 배경으로 시스 또는 트랜스에 도입된다. 이 기술은 넓게 분리 및 기능 (들)는 많은 유전자 / 역할 (들)을 식별하는 데 사용되어왔다. 하나의 특정 예는 S. URA3의 돌연변이를 사용하여 칸디다 알비에서 orotidine -5- 인산 라제의 분리 및 식별이며 cerevisiae의와 E.의 pyrF 돌연변이 대장균. 한 저자는 아미노산, 펩티도 글리 칸과 그 연구 프로그램에서 엄격한 반응의 대사에 관여하고 B에서의 교시 프로그램에이 기술을 도입 한 유전자의 기능을 규명하기 위해이 기술을 사용한iotechnology 및 분자 생명 과학 (BMB) 기술의 로체스터 대학 (RIT)에서 프로그램. 원칙과 사례 (BPP) (허드슨 / Savka)는 RIT에서 BMB 프로그램에서 두 개의 상 부문 과목 실험실 기초 과정 : 저자는 식물 생화학 / 병리학 (FPBP) (허드슨)와 Bioseparations의 기본을 가르친다. 과정에서 설명하는 주제 중 일부는 자신의 연구 분야에 소속되어 있기 때문에, 저자는이 두 실험실 기반의 과정으로 각각의 연구 프로그램에 사용되는 기술과 실험 도구의 대부분을 포함하고있다. 이러한 하나의 예는 식물, 펩티도 글리 칸과 세균에서 엄격한 반응 대사로부터 대사 산 아미노기에 관한 강의 자료를 강화 실험실 운동 기능성 보완한다. FPBB 과정에서 논의 식물에서 아미노산 경로의 세 가지가 있습니다 그 라이신 (리스)의 티로신(티르) 및 페닐알라닌 (프). 동물리스 드 노보 합성에 유전 장치가 부족하기 때문에리스 통로 때문에 모든 동물, 특히 인간을위한 필수 아미노산과 같은 아미노산의 중요성 과정에서 강조된다. 또한, 최근에는 식물 세균과는 크게 다르다리스의 합성을위한 경로를 사용하는 것이 발견되었다. 이 발견은 부분적 E. 기능적 보완에 의해 촉진 된 콜라이 디아 미노 (DAP) 모델 식물 애기 장대에서 효소 1,1- 디아 미노 아미노 전이 효소 (DAPL)를 코딩하는 유전자를 사용하여 돌연변이.이 중간체 디아 미노 통해리스의 합성 변형 경로가도 1에 도시되어있다. 또 ,리스의 합성 고도로 조절되는 아미노산 아스파르트 유도 패밀리를 통해 용이하게한다. 3 단백질 SYNT의 중요성에 더하여hesis, 티르와 프에 대한 경로는 phenylpropanoid 화합물의 동화에 대한 전구체 화합물로서 자신의 중요성을 같은 식물 방어 화합물의 합성에 관여 주어 강조 표시됩니다 :. 알칼로이드, 리그닌, 플라보노이드, 이소 플라보노이드, 다른 사람의 사이에서 히드 록시 산을 4 티르 및 프 경로는 또한 식물과 박테리아 신진 대사 경로의 차이를 보여주기 위해 강조 표시됩니다. 식물에서 효소 티르 및 프의 이화 작용에 주로 관여 이들 아미노산의 동화 작용에 관여되지 않은 반면, 박테리아, 효소 타이로신 아미노 전이 효소 (TyrB)은 두 아미노산의 동화 작용에 관여한다. (그림 2). (4) 그람 양성 및 그람 펩티도 글리 (PG)의 구조에 대한 음성 세균 사이의 차이는 FPBP 과정에서 강조 표시됩니다. 그람 음성 박테리아의 PG는 사실에 기초한 식물 병리학 관한 관심의 대부분이식물 병원균은 그람 음. 상위 10 세균 피토 - 병원균에 대한 최근 평가는 모든 그램 부정적인 것으로 나타났습니다. 박테리아는 장군으로부터있었습니다. 슈도모나스, Ralstonia, 아그로, 크 산토, 에르 위니아, Xylella, Dickeya 및 Pectobacterium 화학적 차이 5 1 그램 네거티브 및 그람 양성 세균의 PG 줄기 비교 가교 아미노 차이 인 두 가지 유형의 산. PG의 다른 가교의 초기 단계는 PG의 동화의 세포질 단계에서 발생하고 효소은 UDP N -acetylmuramoyl-L-알라 닐 D-글루탐산 염 메소 -2,6- 디아 미노 리가 아제에 의해 촉진된다 (무레) (그림 3A). 무레 대부분의 그람 음성 세균에서, 펩티드 줄기 번째 위치.도 6에서, 특정 디아민 화합물의 첨가 반응을 촉매, 끝에서 두 번째는리스 (메소 -diaminopimelate을 전구체 <em은&gt; m의 -DAP)의 역할 가교 아미노산 LYS 것은 대부분의 그람 양성균의 PG (도 3B)에서 동일한 역할 역할을한다. (7)이 m의 -DAP 및 LYS 모두 두 아민을 가지고 있다는 사실에 기인 그룹 및 펩타이드 줄기 가교 두 펩티드 결합을 형성 할 수있다. Bioseparations에서 : 원칙과 사례 (BPP) 과정으로 인해 환경 변화에 박테리아의 배양 방법과 영양 수준 모두 시스템에서 크게 변경됩니다 오픈과 폐쇄 시스템의 차이점은 설명합니다. 이 이벤트는 &quot;아래로 이동&quot;또는 &quot;최대 이동&quot;라고 규정 변경에 링크 된 기아 또는 아미노산 또는 에너지의 적절한 공급에 의해 트리거. 박테리아 문화가 하나의 탄소 소스와 화학적으로 정의 된 매체에 풍부하고 복잡한 매체에서 전송 될 때 &quot;아래로 이동&quot;응답이 발생할 수 있습니다. 환경의 변화는 급속한 cessa에 이르게의 tRNA와 rRNA의 합성 기. 아미노산의 생합성이 상향 조절 되더라도 리보솜 단백질 및 DNA 합성의 부족이 중단 결과. 은 &quot;다운 시프트&quot;반응에 따라, 기존의 변이는 중간 또는 환경에서 더 이상 사용할 수있는 아미노산을 합성하는 신규 효소를 생산하는 데 사용된다. 일정 기간 후, rRNA의 합성 및 새로운 리보솜 조립하고 박테리아 세포의 인구는 감소 속도 비록 성장하기 시작합니다. 사건의 과정은 &quot;엄격한 반응&quot;또는 &quot;엄격한 제어&quot;라고 글로벌 세포 조절의 예이며, 필요한 기질, 에너지 수요의 유용성을 보완하기 위해 셀의 생합성 장치를 조정하기위한 메커니즘으로 생각 될 수있다 . 8 엄격한 반응 따라서 환경의 영양소의 광속에 빠르게 응답하는 세균을 가능 기여 ENH영양소 및 또는 기판의 가용성에 관해서 빠르게 변화 할 수있는 환경에서 경쟁하는 박테리아의 능력을 또한 여러개. 8-9 엄격한 반응은 아미노산, 탄소, 질소, 인산, 및 지방산의 이용이 제한되어 유전자 발현에 필수적인 역할을 갖는다. 8,10-14이 엄격한 응답 개의 뉴클레오티드, 구아노 신 tetraphosphate 포스페이트 (ppGpp) 및 구아노 신으로 배위 pentaphosphate (pppGpp)는 일반적으로 alarmone (P) ppGpp으로 함께 언급했다. 예를 들어, 아미노산이 제한된있는 경우, 구아노 신 3 인산 5 인산의 동화에서 파생 된 구아노 신 3,5- (비스) 피로 인산 포스페이트 (ppGpp)는 (pppGpp)는 축적 단백질 합성 - 더 alarmone의 병목 현상으로 이어질 수 있습니다 셀이다. (p) ppGpp 레벨의 변화는 직접적으로 세포의 성장과 developmen는 관여하는 환경에서 기판의 부족을 극복하기 위하여 반응을 조절하는 유전자의 발현에 관여티. 이 과정에 관여하는 유전자 중 두 RELA 및 지점이라고합니다. RELA 아미노산 제한의 결과 비 대전 된 tRNA의 누적에 대한 반응에 관여하는 리보솜 연결된 (p) ppGpp 합성이다. 관능 성 (P) ppGpp 합성 및 가수 분해 효소 등의 스팟 기능. SPOT의 합성 효소 활성 탄소와 지방산 기아의 부족에 대한 응답에 참여하고있다. RELA / 스팟 동족체는 식물과 박테리아에서 광범위하고 R 영어 / S 냄비 시간 omologs에 대한 RSH라고합니다 8. 8, 10 -12,16 최근 원고 박테리아 Novosphingobium SP는 Rr을 2-17에서 이러한 alarmones 합성에 관여하는 특정 RSH 단백질이 있다는 것을 보여 주었다. 17 여기에서 우리는 기능 보완 분석에 닿는 네 생화학 적 경로를 제시한다. 이 논문에서 설명하는 보완 분석은 EXPL하는 수단을 제공합니다광석 알 / 추정 기능 (들) 또는 티칭 도구 생화학 적 경로의 가르침을 보충하면서 가질 것으로 예상되는 효소를 식별하거나 특징 짓는 수단으로서 본 생체 내 분석을 이용.

<table><tbody><tr><td>&lt;em&gt;E. coli&lt;/em&gt; mutants</td><td>Hudson/Savka lab or CGSC (http://cgsc.biology.yale.edu/)</td><td></td><td></td></tr><tr><td>Electroporator</td><td>Biorad-USA</td><td>1652100</td><td></td></tr><tr><td>Electroporation Cuvettes</td><td>Biorad-USA</td><td>1652082</td><td></td></tr><tr><td>Temperature controlled incubator</td><td>Generic</td><td></td><td></td></tr><tr><td>Microcentrifuge</td><td>Generic</td><td></td><td></td></tr><tr><td>Luria Agar</td><td>Thermofisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Luria Broth</td><td>Thermofisher Scientific</td><td>12795084</td><td></td></tr><tr><td>M9 Medium</td><td>Sigma-Aldrich</td><td>63011</td><td></td></tr><tr><td>Potato Dextrose Medium</td><td>Fisher Scientfic&amp;nbsp;</td><td>DF0013-15-8</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma-Aldrich</td><td>K1377</td><td></td></tr><tr><td>Diaminopimelate</td><td>Sigma-Aldrich</td><td>92591</td><td></td></tr><tr><td>Thymine</td><td>Sigma-Aldrich</td><td>T0376</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Tyrosine</td><td>Sigma-Aldrich</td><td>T3754</td><td></td></tr><tr><td>Phenlylalanine</td><td>Sigma-Aldrich</td><td>P2126</td><td></td></tr><tr><td>Aspartate</td><td>Sigma-Aldrich</td><td>A9256</td><td></td></tr><tr><td>Valine</td><td>Sigma-Aldrich</td><td>V0500</td><td></td></tr><tr><td>Leucine</td><td>Sigma-Aldrich</td><td>L8000</td><td></td></tr><tr><td>Isoleucine</td><td>Sigma-Aldrich</td><td>I2752</td><td></td></tr><tr><td>Uracil</td><td>Sigma-Aldrich</td><td>U0750</td><td></td></tr><tr><td>Gylcerol</td><td>Sigma-Aldrich</td><td>G5516</td><td></td></tr><tr><td>Arabinose</td><td>Sigma-Aldrich</td><td>A3256</td><td></td></tr><tr><td>Tetracyline</td><td>Sigma-Aldrich</td><td>87128</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>Thermofisher Scientific</td><td>10342-020</td><td></td></tr><tr><td>Platinum pfx DNA polymerase</td><td>Thermofisher Scientific</td><td>11708-013</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Thermofisher Scientific</td><td>15224-041</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Dh5-alpha</td><td>Thermofisher Scientific</td><td>18258012</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Top10</td><td>Thermofisher Scientific</td><td>C4040-03</td><td></td></tr><tr><td>pET100D/topo vector</td><td>Thermofisher Scientific</td><td>K100-01</td><td></td></tr><tr><td>pCR2.1 Vector</td><td>Thermofisher Scientific</td><td>K2030-01</td><td></td></tr></tbody></table>

functional complementation analysis (fca): a laboratory exercise designed and implemented to supplement the teaching of biochemical pathways

기능성 상보성 분석 (FCA)는 널리 유전자 / 효소의 기능 / 역할을 규명하기 위해 사용되는 생체 내 분석이다. 이 기술은 생화학, 유전학 및 기타 여러 분야에서 매우 일반적입니다. 기술의 포괄적 인 개요 펩티도 글리와 세균 엄격한 응답이 원고에보고 산, 아미노에 관련된 생화학 적 경로의 가르침을 보완합니다. 라이신 (L, L-디아 미노 아미노 전이 효소 (DAPL)과 티로신 및 페닐알라닌의 대사에 관여하는 티로신 아미노 전이 효소 (tyrB)의 대사에 관여하는 모델 식물 생물 애기 장대에서 두 cDNA를가 강조 표시됩니다. 또한, 세균 펩티도 글리 신진 대사 경로는 십자가에 포함 된 세균 Verrucomicrobium spinosum 등의은 UDP N -acetylmuramoyl-L-알라 닐 D-글루탐산 염 메소 -2,6- 디아 미노 리가 아제 (무레) 유전자의 분석을 통해 강조펩티도 글리의 -linking. 세균 엄격한 응답도. RSH (R 영어 / s의 냄비 시간 omolog) 박테리아 Novosphingobium 특검팀의 하이퍼 점액 표현형에 대한 책임 관능 성 유전자의 분석을 통해보고 FCA의 네 가지 예를 제시한다. 동영상 즉 리신, 펩티도 글리 칸과 반응 엄격한 이들 세에 초점을 맞출 것이다.

다양한 기능 보완 분석에 사용 된 균주는 표 2에 나열되어 있습니다. 기능 보완 분석 : L, L-디아 미노 아미노 전이 효소 (DAPL) E. 이중 돌연변이 대장균 AOH1 (Δ DAPD :: Kan2, dapE6)는 DAPE 유전자의 돌연변이 및 DAPD 유전자의 완전한 결실 (도 1) 항구. 이와 같이, 돌연변이 체는 DAP가 제공되지 않으면 증가 할 수 없다. 이러한 돌연변이로 인해, AOH1은 영양 요 간주된다. AOH1는 L의 기능을 보완 분석에 적합, DAPL으로 L-디아 미노 아미노 전이 효소 (DAPL) orthologs는 THDP는 PG 및리스 합성을 용이하게하기 위해 직접에서 L-디아 미노 (그림 L의 합성을 촉진 1). AOH1 돌연변이 표현 DapLs가 L에 성장할 수 있음을 보여 주어야한다 DAP /리스 경로에서 DAPD 및 DAPE 효소 단계를 우회 L-DAP (그림 5). 기능성 보완 분석 : UDP - -acetylmuramoyl N-L-D-알라 닐 글루탐산 메소 -2,6- 디아 미노 리가 아제 (무레) 메소 -diaminopimelate (m의 -DAP)는 그람 - 음성 세균 PG의 가교 결합 된 아미노산이다. 효소 -acetylmuramoylalanyl- D-2,6- 글루 타밀 메소 -diaminopimelate 리가 N은 UDP (무레)이 공정에서의 m -DAP 첨가 (- B도 3a)를 용이하게한다. E. 대장균 돌연변이 TKL-11은 무 항구(42)에서 성장하는 돌연변이의 능력 초래 무레 유전자 테이션 돌연변이 효소 온도에서 적절하게 접을 수 없다는 사실로 인해 C가 °. 결과는 대조군과 실험군 모두에서 30 ℃의 허용 온도에서 성장이 있음을 입증한다. 그러나, 무레 (실험)를 발현하는 세포 만이 (42)의 비 - 허용 온도에서 성장할 수있을 것이다 ° C (그림 6). 기능성 보완 분석 : 타이로신 아미노 전이 효소 (tyrB) 애기 장대의 At5g36160 (도 2)에 의해 주석 티로신 및 4- 히드 록시 페닐, 페닐알라닌 및 phenylpyruvate를 상호 변환 할 수있는 티로신 아미노 트랜스퍼 라제를 암호화한다. 4 E. 안부난 (DL39)은 페닐알라닌과 티로신을위한 영양 요구하게 tyrB 유전자의 돌연변이를 항구의 돌연변이. 24 ~ 26 돌연변이뿐만 아니라, 아미노산 티로신, 페닐알라닌, 아스 파르 테이트, 류신, 이소류신 및 발린을위한 영양 요 있음을 주목해야한다 다른 돌연변이로 인해. 균주 E.로부터 TyrB 효소 ortholog 때문에 tyrB orthologs의 기능을 평가하는데 적합 대장균의 단백질 합성을 촉진하는 티로신 및 페닐알라닌의 합성에 직접 관여한다. 결과는 DL39 변이주 M9에 티로신, 페닐알라닌이 제공되는 경우에만 성장할 수있을 것으로 보여 주어야한다. 그러나, A. 장대 (At5g36160)를 발현하는 균주 (F 효소 phenylpyruvate의 t에서 4- 히드 록시 페닐 및 페닐알라닌으로부터 티로신을 합성 할 수 있다는 것을 입증 티로신 및 페닐알라닌이 결여 된 M9 배지에서 성장할 수있다igure 7). (4) 기능성 보완 분석 : RSH (RELA 및 S 냄비 동족체) Novosphingobium 특검팀에서 RSH 단백질. (Rr2-17)는 N 말단 phosphohydrolase와 (P) ppGpp 합성 효소 도메인을 모두 포함하고, 따라서 E.의 자리 같은 제안 관능 성 역할을 대장균.이은 E.의 보완 분석을 사용하여 확인되었다 Novosphingobium 특검팀에서 RSH 유전자를 사용하여 RELA하고 자리에 돌연변이를 품고 대장균 이중 돌연변이, CF1693. Hx699 (RSH : EZ-TN5, 칸 R)라는 이름의 Rr2-17 RSH 돌연변이의 표현형,하는 저자 점액 결과이 아닌 기능 RSH 때문이다. Hx699의 저자 점액 표현형은에 의해 평가되었다 클로닝 네이티브 RSH NSP 유전자에 의해 용이하게 보완넓은 호스트 범위 벡터 pRK290에. 하이포 점액 표현형과 일치, 빈 벡터 pRK290을 품고 Hx699가 pRK290 또는 pRK290 :: RSH NSP을 포함 덜 용해 트랜스 보완 Hx699에 의해 생산 된 폴리 사카 라이드 (pRK290 :: RSH NSP)와 Rr2-17를 표시합니다 (그림 8) . <img alt="그림 1" src="/files/ftp_upload/53850/53850fig1.jpg" /> 그림 1. 중간 디아 미노 (DAP)을 통해 진행 아스파에서 리신 동화 경로의 변형이 경로는 (A) 아실 경로 (B)가 디아 미노 피멜 레이트 데 하이드로게나 제 (DDH) 경로 및 (C)가 L에 의해 주석된다 , L-디아 미노 아미노 전이 효소 (DAPL) 경로. 다음과 같이 효소의 약어 정의는 다음과 같습니다 아스 파르 테이트 키나제 (의 lysC), 아스파 테이트테이트 세미 알데히드 디 히드로게나 제 (ASD) tetrahydrodipicolinate 신타 (DAPA) tetrahydrodipicolinate 환원 (DapB) tetrahydrodipicolinate 아실 라제 (DAPD), N 아실 -2- 아미노 -6- ketopimelate 아미노 트랜스퍼 라 아제 (DAPC), N의 아실-L, L-2, 6 디아 미노 deacylase (DAPE), 디아 미노 에피 머라 아제 (DapF), 메조 -diaminopimelate 탈수소 효소 (DDH), 메조 -diaminopimelate 디카 르 복실 라 아제 (LysA), L, L-디아 미노 아미노 전이 효소 (DAPL)은 UDP N -acetylmuramoyl-L-alanyl- D-글루타메이트 :. 메소 -2,6- 디아 미노 리가 아제 (무레)와 리실-의 tRNA 합성 효소 (LysU) <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53850/53850fig2.jpg" /> 그림 2 : 아미노산 초심자를위한 단백 동화 경로사인 및 페닐알라닌. (A) 중간 chorismate 및 (B) 상기 중간 arogenate 통해 식물 경로를 통해 세균 (대장균) 통로. , chorismate 글루코사민 뮤 타제 / prephenate 탈수 효소를 (PHEA를) chorismate 글루코사민 뮤 타제, prephenate 탈수소 효소 (타이라)과 티로신 아미노 전이 효소 (TyrB) : 효소의 약어는 다음과 같습니다. 그림은 채택 형태 Prabhu 허드슨, 2010 년 4 수정 된 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하세요.</a> <img alt="그림 3" src="/files/ftp_upload/53850/53850fig3.jpg" /> 그림 3 : 펩티도 글리 합성의 세포질 단계 (A) 펩티도 글리 합성의 세포질 단계의 도식 표현.. 약어<html> 다음과 같이 효소입니다은 UDP N -acetylglucosamine enolpyruvyl 전이 (무라)은 UDP N의 -acetylenolpyruvoylglucosaminereductase (MurB)은 UDP N은 -acetylmuramate-L 알라닌 리가 아제 (MurC)은 UDP N 아세틸 - muramoylalanine-D -glutamate 리가 아제 (MurD)은 UDP N -acetylmuramoyl-L-알라 닐 D-글루타메이트 2,6- 메조 -diaminopimelate 리가 MurF (무레)은 UDP N -acetylmuramoyl - 트리 펩티드-D 알라-D 알라닌 리가 아제 ( ), D-D 알라닌 - 알라닌 리가 제 (DDL). (B) 이당류 N의 -acetylglucosamine (의 GlcNAc)를 보여주는 펩티도 글리의 단량체 단위의 도식 표현과 N -acetylmuramic (MurNAc)는 β-1,4 글리코 시드 결합을 통해 연결된. 스템 펩타이드의 3 번 위치의 아미노산은 대부분의 그람 양성균의 대부분 그람 음성균 및리스에서 메소 -diaminopimelate (m의 -DAP)으로 나타내는 가교에 참여하고있다.&quot;_blank&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 4" src="/files/ftp_upload/53850/53850fig4.jpg" /> 그림 4 :. 영양 불량 환경에 세균 엄격한 응답의 도식 모델 표현 노출 RSH (RELA 또는 자리) GTP (구아노 신 삼인산)에 인산기를 추가하여 alarmone (P) ppGpp (구아노 신 pentaphosphate)를 anabolize하도록 유도한다. 영양이 풍부한 환경에 노출 성장 억제제이다 (p) ppGpp 가수 분해 RSH의 발현을 유도한다. 다이어그램을 채택하고 라 스킨 등.에서 수정 된 2007 년 (27)는 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" sRC = &quot;/ 파일 / ftp_upload / 53850 / 53850fig5.jpg&quot;/&gt; 그림 5 :. AOH1 E.의 DAPL을 사용하여 기능 보완 기능 보완 V. 박테리아에서 L, L-디아 미노 아미노 전이 효소 (DAPL) 유전자와 대장균 돌연변이 spinosum 등 (대 DAPL), 식물 A. 장대 (DAPL에서)와 조류, C. reinhardtii에서 크롬 (Cr DAPL). 플라스미드, pBAD33, pBAD33 :: 대 DAPL, pBAD33 :: DAPL에 그리고 pBAD33 :: CR DAPL를 형질 변이체는 0.2 %로 보충 된 LB 아가 플레이트 상에 레플리카 - 플레이 팅 하였다 또는 50 ㎍ / ml의없이 아라비 (/ V w) L, L - 디아 미노 30에서 성장시켰다 24 시간 동안 C를 °. 다이어그램이 채택에서 Nachar 등. 수정 된 2012 년 (18)는 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 그림 6 :. TKL-11 E.의 무레를 사용하여 기능 보완 기능 보완 V.에서은 UDP N -acetylmuramoyl-L-알라 닐 D-글루탐산 염 메소 -2,6- 디아 미노 리가 아제 (무레) 유전자와 대장균 돌연변이 spinosum 등. 플라스미드 BAD33 또는 pBAD33 :: VsmurE 은닉 돌연변이는 0.85 %를 사용하여 10-2와 10-3을 OD 0.1 600 LB 배지에서 성장시키고, 직렬 10-1로 희석 염수 (/ V w) . (5) 다양한 희석액 ㎕의 0.2 % (w / v)로 아라비 보충 된 LB 배지에 복제 도금하고, 30 ° C, 42에서 평가 성장시켰다 ° C 24 시간 동안. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> </a&gt; <img alt="그림 7" src="/files/ftp_upload/53850/53850fig7.jpg" /> 그림 7 : DL39 E.의 기능 보완 A.에서 궤적 태그 At5g36160 의해 주석 티로신 아미노 트랜스퍼 라제 유전자와 함께 대장균 장대. 플라스미드 pBAD33 또는 pBAD33 :: At5g36160을 품고 돌연변이가 50 μg의 / ㎖ -1 티로신, 50 μg의 / ㎖ -1 페닐알라닌 보충 LB 한천 플레이트에 선택, 34 μg의 / ㎖ -1 클로람페니콜했다. 균주 식염수 (/ V W) 0.85 %를 사용하여 10-2와 10-3을 OD의 OD 1.0 600 LB 배지에서 성장시키고, 직렬 10-1로 희석 하였다. 다양한 희석액 5 ㎕를 다음를 50㎍ / ㎖로 보충 된 페닐 -1 M9 아가 플레이트 상에 레플리카 - 플레이 팅 하였다알라닌 50 μg의 / ㎖ -1 티로신, 0.5 % (w / v)의 글리세롤, 0.2 % (w / v)의 아라비 노스, 50 μg의 / ㎖ -1 아스 파르 테이트, 50 μg의 / ㎖ -1 류신, 50 μg의 / ㎖ -1 발린를 50㎍ / ㎖ -1 이소류신, 10 μg의, 또한 페닐알라닌 및 티로신이 부족한 48 시간 동안 30 ° C에서 배양 접시에 / ㎖ -1 우라실. 그림은 채택 형태 Prabhu 허드슨, 2010 년 4 수정 된 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하세요.</a> <img alt="그림 8" src="/files/ftp_upload/53850/53850fig8.jpg" /> 그림 8 : Novosphingobium 특검팀의 hypomucoid 표현형의 기능 보완. 돌연변이 균주 Hx699. 티그는 야생 형 변형 Novosphingobium 특검팀. (Rr2-17) 및 돌연변이 균주 Hx699는 pRK290 또는 pRK290 :: RSH NSP로 형질 전환 하였다. 균주는 &quot;X&quot;로 질주하고, 추가로 30 ° C에서 PD 한천에서 성장했다 표현형을 관찰 적어도 사일. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53850/53850fig8large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 보완 플라스미드 </td><td> 항생제 내성 마커 </td><td> 소환 </td></tr><tr><td> pBAD33 </td><td> 형상 관리 연구 </td><td> (21) </td></tr><tr><td> pBAD33 :: DAPL에서 </td><td> 형상 관리 연구 </td><td> 이 </td></tr><tr><td> pBAD33 :: CR DAPL </td><td> 형상 관리 연구 </td><td> (20) </td></tr><tr><td> pBAD33 :: 대 DAPL </td><td> 센티미터아르 자형 </td><td> (18) </td></tr><tr><td> pBAD33 :: At5g36160 </td><td> 형상 관리 연구 </td><td> 4 </td></tr><tr><td> pBAD33 :: 대 무레 </td><td> 형상 관리 연구 </td><td> (18) </td></tr><tr><td> pRK290 </td><td> 구정 연구 </td><td> (28) </td></tr><tr><td> pRK290 :: RSH NSP </td><td> 구정 연구 </td><td> (17) </td></tr></tbody></table> 표 1. 본 연구 기능 보완 분석에 사용 된 플라스미드 목록에 사용되는 기능성 보완 플라스미드. 형상 R 및 R 테트 각각 클로람페니콜 및 테트라 사이클린 내성을 나타낸다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 스트레인 이름 </td><td> 유기체 </td><td> 유전자형 </td><td> 표현형 </td><td> 출처 </td></tr><tr><td> AOH1 </td><td>대장균 </td><td> Δ DAPD :: Kan2, dapE6 </td><td> 디아 미노에 대한 영양 요 </td><td> 허드슨 연구소 </td></tr><tr><td> TKL-11 * </td><td> 대장균 </td><td> THR-1, leuB6 (암), murE1, fhuA21, codA1, lacY1, TSX-95, glnV44 (AS), λ - pyrF101, 그의-108, thyA6, argG66, ilvA634, 생-1, deoC1 </td><td> 성장에 민감한 표현형 변이는 42 ° C에서 30 ° C에서 성장하지만하지 않았다 </td><td> CGSC (# 5989) </td></tr><tr><td> DL39 * </td><td> 대장균 </td><td> 적층형, aspC13, FNR-25, RPH-1 ilvE12, tyrB507 </td><td> 아미노산에 대한 영양 요; 티로신, 페닐알라닌, 류신, 이소류신 및 발린 </td><td> CGSC (# 6913) </td></tr><tr><td> Rr2-17 </td><td> Novosphingobium 특검팀. (야생형) </td&gt; <td> - </td><td> 하이퍼 점액 </td><td> Savka 실험실 </td></tr><tr><td> Hx699 </td><td> Novosphingobium SP. </td><td> RSH : EZ-TN5, 칸 R </td><td> 저자 점액 </td><td> Savka 실험실 </td></tr></tbody></table> 표 2. 본 연구에서 사용 된 각각의 유전자형과 표현형 함께 균주 본 연구에 사용 된 균주 목록. 별표 (*)로 표시 균주 (TKL-11과 DL39)가 대장균 유전자 증권 센터 (CGSC) (http://cgsc.biology.yale.edu/)에서 직접 얻을 수 있습니다.

Watch this Scientific Journal Video about Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways at JoVE.com

Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

생화학 적 경로에 관여하는 효소 활성의 유효성 기능성 상보성 분석 (FCA)를 사용하여 설명 될 수있다. 아미노산, 세균 엄격한 반응 세균 펩티도 글리 칸의 생합성의 대사에 관여하는 효소의 효소 활성을 보여주는 FCA 분석이 논문에 설명한다.

기능 보완 분석 (FCA) : 설계 및 생화학 적 경로의 교육을 보완하기 위해 구현 된 실험실 운동

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very ...

functional-complementation-analysis-fca-laboratory-exercise-designed

Nanyang Technological University

Research

JoVE Journal

Biology

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

17.6K 조회수.  Rochester Institute of Technology.  생화학 적 경로에 관여하는 효소 활성의 유효성 기능성 상보성 분석 (FCA)를 사용하여 설명 될 수있다. 아미노산, 세균 엄격한 반응 세균 펩티도 글리 칸의 생합성의 대사에 관여하는 효소의 효소 활성을 보여주는 FCA 분석이 논문에 설명한다. 

비디오: Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Bimolecular Fluorescence Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as immunoprecipitation do not provide information on the spatial localization of complexes. In contrast, BiFC monitors the interaction and subcellular compartmentalization of protein complexes. In this method, a fluororescent protein is split into amino- and carboxy-terminal non-fluorescent fragments which are then fused to two proteins of interest. Interaction of the proteins results in reconstitution of the fluorophore (Figure 1)1,2. A limitation of BiFC is that once the fragmented fluorophore is reconstituted the complex is irreversible3. This limitation is advantageous in detecting transient or weak interactions, but precludes a kinetic analysis of complex dynamics. An additional caveat is that the reconstituted flourophore requires 30min to mature and fluoresce, again precluding the observation of real time interactions4. BiFC is a specific example of the protein fragment complementation assay (PCA) which employs reporter proteins such as green fluorescent protein variants (BiFC), dihydrofolate reductase, b-lactamase, and luciferase to measure protein:protein interactions5,6. Alternative methods to study protein:protein interactions in cells include fluorescence co-localization and F&ouml;rster resonance energy transfer (FRET)7. For co-localization, two proteins are individually tagged either directly with a fluorophore or by indirect immunofluorescence. However, this approach leads to high background of non-interacting proteins making it difficult to interpret co-localization data. In addition, due to the limits of resolution of confocal microscopy, two proteins may appear co-localized without necessarily interacting. With BiFC, fluorescence is only observed when the two proteins of interest interact. FRET is another excellent method for studying protein:protein interactions, but can be technically challenging. FRET experiments require the donor and acceptor to be of similar brightness and stoichiometry in the cell. In addition, one must account for bleed through of the donor into the acceptor channel and vice versa. Unlike FRET, BiFC has little background fluorescence, little post processing of image data, does not require high overexpression, and can detect weak or transient interactions. Bioluminescence resonance energy transfer (BRET) is a method similar to FRET except the donor is an enzyme (e.g. luciferase) that catalyzes a substrate to become bioluminescent thereby exciting an acceptor. BRET lacks the technical problems of bleed through and high background fluorescence but lacks the ability to provide spatial information due to the lack of substrate localization to specific compartments8. Overall, BiFC is an excellent method for visualizing subcellular localization of protein complexes to gain insight into compartmentalized signaling.

The subcellular localization of proteins is important in determining the spatio-temporal regulation of cell signaling. Here, we describe bimolecular fluorescence complementation (BiFC) as a straightforward method for monitoring the spatial interactions of proteins in the cell.

Bimolecular 형광 Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as ...

연구

생물학

<meta charset="utf8"></head><body>분자 생물학 교육 및 기술 향상을 위한 Gibson Assembly 구현

Improving Student Outcomes with an Adaptable Molecular Cloning Course-Based Undergraduate Research Experience

The continuous advancement of molecular biology techniques requires that molecular biology curricula are&#160;regularly refined to effectively prepare students to enter the workforce with modern competencies. In particular, the emergence of Gibson Assembly, a highly customizable and adaptive molecular cloning technique, has advanced the landscape of molecular cloning in numerous research environments. Thus, we created a Gibson Assembly cloning module for deployment in a molecular biology laboratory course at California Polytechnic State University, San Luis Obispo and evaluated student learning outcomes from the module. Over three iterations of the course, students participated in an experiment-based independent project that involved cloning three unique plasmid libraries to support research projects in natural products biosynthesis. Students were given pre- and post-questionnaires to evaluate their understanding of molecular cloning and their confidence in molecular biology terms and techniques. Students&#8217; responses showed a significant increase in both learning molecular cloning concepts and in self-reported confidence with molecular cloning terms and techniques. This module framework can be generalized to teach Gibson Assembly for various applications, providing instructors with a toolkit for teaching an adaptable and emergent cloning technology while advancing their research projects.

<meta charset="utf8"></head><body>Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

An adaptable Gibson Assembly molecular cloning module was employed in a course-based undergraduate research experience (CURE) format for molecular biology laboratory course students. Assessment of student learning outcomes showed improved understanding and confidence in molecular cloning after completion of the CURE, and novel plasmids were cloned for natural product biosynthesis research.&#160;&#160;

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

The continuous advancement of molecular biology techniques requires that molecular biology curricula are&#160;regularly refined to effectively prepare ...

생화학

Annotation of Plant Gene Function via Combined Genomics, Metabolomics and Informatics

Given the ever expanding number of model plant species for which complete genome sequences are available and the abundance of bio-resources such as knockout mutants, wild accessions and advanced breeding populations, there is a rising burden for gene functional annotation. In this protocol, annotation of plant gene function using combined co-expression gene analysis, metabolomics and informatics is provided (Figure 1). This approach is based on the theory of using target genes of known function to allow the identification of non-annotated genes likely to be involved in a certain metabolic process, with the identification of target compounds via metabolomics. Strategies are put forward for applying this information on populations generated by both forward and reverse genetics approaches in spite of none of these are effortless. By corollary this approach can also be used as an approach to characterise unknown peaks representing new or specific secondary metabolites in the limited tissues, plant species or stress treatment, which is currently the important trial to understanding plant metabolism.

Combination of genomics, co-expression gene analysis and the identification of target compounds via metabolism give gene functional annotation.

결합 지노 믹스, Metabolomics와 정보학 통해 식물 유전자 기능의 주석

Given the ever expanding number of model plant species for which complete genome sequences are available and the abundance of bio-resources such as ...

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine cell central metabolism and discover new enzymes is 13C-assisted metabolism analysis 1. This technique is based on isotopic labeling, whereby microbes are fed with a 13C labeled substrates. By tracing the atom transition paths between metabolites in the biochemical network, we can determine functional pathways and discover new enzymes. 
As a complementary method to transcriptomics and proteomics, approaches for isotopomer-assisted analysis of metabolic pathways contain three major steps 2. First, we grow cells with 13C labeled substrates. In this step, the composition of the medium and the selection of labeled substrates are two key factors. To avoid measurement noises from non-labeled carbon in nutrient supplements, a minimal medium with a sole carbon source is required. Further, the choice of a labeled substrate is based on how effectively it will elucidate the pathway being analyzed. Because novel enzymes often involve different reaction stereochemistry or intermediate products, in general, singly labeled carbon substrates are more informative for detection of novel pathways than uniformly labeled ones for detection of novel pathways3, 4. Second, we analyze amino acid labeling patterns using GC-MS. Amino acids are abundant in protein and thus can be obtained from biomass hydrolysis. Amino acids can be derivatized by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (TBDMS) before GC separation. TBDMS derivatized amino acids can be fragmented by MS and result in different arrays of fragments. Based on the mass to charge (m/z) ratio of fragmented and unfragmented amino acids, we can deduce the possible labeled patterns of the central metabolites that are precursors of the amino acids. Third, we trace 13C carbon transitions in the proposed pathways and, based on the isotopomer data, confirm whether these pathways are active 2. Measurement of amino acids provides isotopic labeling information about eight crucial precursor metabolites in the central metabolism. These metabolic key nodes can reflect the functions of associated central pathways.
13C-assisted metabolism analysis via proteinogenic amino acids can be widely used for functional characterization of poorly-characterized microbial metabolism1. In this protocol, we will use Cyanothece 51142 as the model strain to demonstrate the use of labeled carbon substrates for discovering new enzymatic functions.

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

13C-isotope labeling is a useful technique for determining the cell central metabolism for various types of microorganisms. After cells have been cultured with a specific labeled substrate, GC-MS measurement can reveal functional metabolic pathways based on unique labeling patterns in proteinogenic amino acids.

을 통해 대사 경로 확인 및 검색 13</supProteinogenic 아미노산> C - 라벨링

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine ...

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

에 박테리아 기능 네트워크 및 경로를 매핑<em&gt; 대장균</em&gt; 합성 유전자 배열을 사용하여

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

A Web Tool for Generating High Quality Machine-readable Biological Pathways

PathWhiz is a web server built to facilitate the creation of colorful, interactive, visually pleasing pathway diagrams that are rich in biological information. The pathways generated by this online application are machine-readable and fully compatible with essentially all web-browsers and computer operating systems. It uses a specially developed, web-enabled pathway drawing interface that permits the selection and placement of different combinations of pre-drawn biological or biochemical entities to depict reactions, interactions, transport processes and binding events. This palette of entities consists of chemical compounds, proteins, nucleic acids, cellular membranes, subcellular structures, tissues, and organs. All of the visual elements in it can be interactively adjusted and customized. Furthermore, because this tool is a web server, all pathways and pathway elements are publicly accessible. This kind of pathway &#34;crowd sourcing&#34; means that PathWhiz already contains a large and rapidly growing collection of previously drawn pathways and pathway elements. Here we describe a protocol for the quick and easy creation of new pathways and the alteration of existing pathways. To further facilitate pathway editing and creation, the tool contains replication and propagation functions. The replication function allows existing pathways to be used as templates to create or edit new pathways. The propagation function allows one to take an existing pathway and automatically propagate it across different species. Pathways created with this tool can be &#34;re-styled&#34; into different formats (KEGG-like or text-book like), colored with different backgrounds, exported to BioPAX, SBGN-ML, SBML, or PWML data exchange formats, and downloaded as PNG or SVG images. The pathways can easily be incorporated into online databases, integrated into presentations, posters or publications, or used exclusively for online visualization and exploration. This protocol has been successfully applied to generate over 2,000 pathway diagrams, which are now found in many online databases including HMDB, DrugBank, SMPDB, and ECMDB.

PathWhiz is a comprehensive, online pathway drawing tool for generating biochemical and biological pathways. It uses publicly accessible databases and easily expandable palettes consisting of pre-drawn pathway components. This protocol describes how to easily build new pathways, replicate and edit existing pathways, and propagate previously drawn pathways to different organisms.

생성 고품질 기계 판독 가능한 생물 진학을위한 웹 도구

PathWhiz is a web server built to facilitate the creation of colorful, interactive, visually pleasing pathway diagrams that are rich in biological ...

High-Throughput Metabolic Profiling for Model Refinements of Microalgae

Metabolic models are reconstructed based on an organism&#39;s available genome annotation and provide predictive tools to study metabolic processes at a systems-level. Genome-scale metabolic models may include gaps as well as reactions that are unverified experimentally. Reconstructed models of newly isolated microalgal species will result in weaknesses due to these gaps, as there is usually sparse biochemical evidence available for the metabolism of such isolates. The phenotype microarray (PM) technology is an effective, high-throughput method that functionally determines cellular metabolic activities&#160;in response to a wide array of entry metabolites. Combining the high throughput phenotypic assays with metabolic modeling can allow existing metabolic network models to be rapidly reconstructed or optimized by providing biochemical evidence to support and expand genomic evidence. This work will show the use of PM assays for the study of microalgae by using the green microalgal model species Chlamydomonas reinhardtii as an example. Experimental evidence for over 254 reactions obtained by PM was used in this study to expand and refine a genome-scale C. reinhardtii metabolic network model, iRC1080, by approximately 25 percent. The protocol created here can be used as a basis for functionally profiling the metabolism of other microalgae, including known microalgae mutants and new isolates.

This protocol demonstrates the use of a phenotype microarray (PM) technology platform to define metabolic requirements of Chlamydomonas reinhardtii, a green microalga, and refine an existing metabolic network model.

미세 조류의 모델 개선을 위한 높은 처리량 신진 대사 프로파일링

Metabolic models are reconstructed based on an organism&#39;s available genome annotation and provide predictive tools to study metabolic processes at a ...

딥러닝을 이용한 알츠하이머병의 신호전달 모듈 분석Analyzing Signaling Modules in Alzheimer's Disease with Deep Learning

DeepOmicsAE: Representing Signaling Modules in Alzheimer's Disease with Deep Learning Analysis of Proteomics, Metabolomics, and Clinical Data

Large omics datasets are becoming increasingly available for research into human health. This paper presents DeepOmicsAE, a workflow optimized for the analysis of multi-omics datasets, including&#160;proteomics, metabolomics, and clinical data. This workflow employs a type of neural network called autoencoder, to extract a concise set of features from the high-dimensional multi-omics input data. Furthermore, the workflow provides a method to optimize the key parameters needed to implement the autoencoder. To showcase this workflow, clinical data were analyzed from a cohort of 142 individuals who were either healthy or diagnosed with Alzheimer&#39;s disease, along with the proteome and metabolome of their postmortem brain samples. The features extracted from the latent layer of the autoencoder retain the biological information that separates healthy and diseased patients. In addition, the individual extracted features represent distinct molecular signaling modules, each of which interacts uniquely with the individuals&#39; clinical features,&#160;providing for a mean to integrate&#160;the proteomics, metabolomics, and clinical data.

저자 스포트라이트: 알츠하이머 연구의 발전 – 조기 발견 및 멀티오믹스 접근법 탐구

DeepOmicsAE is a workflow centered on the application of a deep learning method (i.e., an autoencoder) to reduce the dimensionality of multi-omics data, providing a foundation for predictive models and signaling modules representing multiple layers of omics data.

DeepOmicsAE: 단백질체학, 대사체학 및 임상 데이터의 딥러닝 분석을 통한 알츠하이머병의 신호 모듈 표현

Large omics datasets are becoming increasingly available for research into human health. This paper presents DeepOmicsAE, a workflow optimized for the ...

기능 보완 분석 (FCA) : 설계 및 생화학 적 경로의 교육을 보완하기 위해 구현 된 실험실 운동

요약

더 많은 비디오 탐색

이 비디오의 챕터

Bimolecular 형광 Complementation

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

결합 지노 믹스, Metabolomics와 정보학 통해 식물 유전자 기능의 주석

을 통해 대사 경로 확인 및 검색^{13 C - 라벨링}

에 박테리아 기능 네트워크 및 경로를 매핑

생성 고품질 기계 판독 가능한 생물 진학을위한 웹 도구

미세 조류의 모델 개선을 위한 높은 처리량 신진 대사 프로파일링

DeepOmicsAE: 단백질체학, 대사체학 및 임상 데이터의 딥러닝 분석을 통한 알츠하이머병의 신호 모듈 표현

기능 보완 분석 (FCA) : 설계 및 생화학 적 경로의 교육을 보완하기 위해 구현 된 실험실 운동

요약

더 많은 비디오 탐색

이 비디오의 챕터

Bimolecular 형광 Complementation

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

Adaptable Molecular Cloning 과정 기반 학부 연구 경험을 통한 학생 결과 개선

결합 지노 믹스, Metabolomics와 정보학 통해 식물 유전자 기능의 주석

을 통해 대사 경로 확인 및 검색 13 C - 라벨링

에 박테리아 기능 네트워크 및 경로를 매핑

생성 고품질 기계 판독 가능한 생물 진학을위한 웹 도구

미세 조류의 모델 개선을 위한 높은 처리량 신진 대사 프로파일링

DeepOmicsAE: 단백질체학, 대사체학 및 임상 데이터의 딥러닝 분석을 통한 알츠하이머병의 신호 모듈 표현

을 통해 대사 경로 확인 및 검색^{13 C - 라벨링}