우리는 MIA 모델, 자폐증, 정신 분열증 연구의 발전에 공헌을 위해 후반 박사 폴 H. 패터슨을 존중하고 싶습니다. 우리는이 프로토콜에 대한 그의 위대한 지원 Sarkis K. Mazmanian을 인정; 행정 지원 루벤 M. 바이욘, 이벳 가르시아 - 플로레스, 카렌 C. Lencioni, 그​​리고 레슬리 A. 노이만; 촬영에 도움을 알리 Khoshnan 및 월 C. 코; MIA 유도에 자신의 조언을 일레인 Y. 샤오와 나탈리아 Malkova; 자신의 전문 축산에 대한 제프리 S. 코크, 호아킨 구티에레즈, 콴 F. 리, 제이미로드 리 게스, 로레나 C. 산도발, 나탈리 A. Verduzco. 이 작품은 (폴 H. 패터슨에 NIH 5P50MH086383-04,)를 NIH 콘테 센터 수상에 의해 지원되었다; 자폐증은 (폴 H. 패터슨에 # 7670) 언어; (Sarkis K. Mazmanian에 # 322839) 시몬스 재단; NIH 교육 그랜트 (K.-HC에 NIH / NRSA T32GM07616); (ZY에) 캘리포니아 공과 대학 여름 학부 연구 활동 (SURF); 암젠 학자 캘리포니아 공과 대학에서 (ZY에) 프로그램; 및 박사후 친목 FR톰 국립 과학위원회, 대만 (NSC 101-2917-I-564-039, W.-LW)이다.

모든 프로토콜 기술 기관 동물 관리 및 사용위원회의 캘리포니아 공과 대학 (IACUC)의 승인하에 수행 하였다. 시간 제한 - 결합 쌍 1. 준비 <ol><li> 유전자 발현 분석을위한 최소 6 행동 실험 댐 및 3을 사용합니다. 참고 : 마우스의 약 50 %가 시간 제한-짝짓기에서 연결되는 바와 같이, 추정 암컷 마우스의 두 배 번호를 사용합니다. </li><li> 더 이전의 임신 연령의 8~16주에서 암컷 마우스를 사용합니다. 참고 : 여성 생쥐 수컷 마우스에 앞서 성적 노출을 가지고 있지만 임신되지 않았습니다 허용됩니다. </li><li> 하우스는 여성 마우스는 함께 서로 옆에 자신의 발정주기를 동기화하기 위해 새장을 배치합니다. 5 성인 마우스의 주택 수 있도록 5.5 인치 이상의 높이와 75 평방 인치 내부 바닥과 표준 마우스 케이지를 사용합니다. 귀 펀치를 사용하여 각 여성 마우스 레이블. </li></ol> 2. 시간 제한 매트 설정ING 쌍 <ol><li> 어두운 사이클이 시작되기 전에 시간 제한-짝짓기 0-2 시간을 설정합니다. 각 장에 두 여성 마우스를 놓습니다. 쥐를 가지고 개별적으로 무게. 암컷 마우스의 체중을 기록한다. </li><li> 두 암컷 마우스 각 케이지에 한 남성 마우스를 놓습니다. 부계 교란 효과를 최소화하기 위해 트리오 짝짓기를 사용합니다. </li></ol> 3. 질 플러그 검사 (E0.5) <ol><li> 어두운 사이클 종료 후 암컷 쥐 0-4 시간을 확인합니다. 조심스럽게 꼬리의 기지에서 여성의 마우스를 올리고 마우스가 와이어 그리드, 케이지 상단, 또는 케이지 가장자리를 잡아 할 수 있습니다. </li><li> 질 플러그의 흔적을 검색 질 플러그는 질 입구에서 볼 수 희끄무레 한 덩어리입니다. 플러그가 분명하지 않은 경우, 부드럽게 질구에 200 μL 피펫 팁을 삽입합니다. 응고에서 저항 질 플러그 형성을 확인합니다. 하루에 한 번 질 플러그를 확인합니다. 참고 : 질 플러그 g 때문에하지 않습니다 교미가 발생했음을 만 표시하고,uarantee 임신. 질 플러그는 생쥐의 특정 균주에 식별하기 어려울 수 있습니다. 플러그 식별의 정확성을 높이기 위해 경험이 풍부한 마우스 교사로부터 도움을 얻을 수 있습니다. </li><li> 새 케이지에 연결된 마우스를 이동하고 그룹을 수용. 배아 0.5 일 (E0.5)와 같은 질 플러그 모양의 날을 정의합니다. </li></ol> E10.5-11.5 4. 임신 확인 <ol><li> 조심스럽게 꼬리의 기반을 들어 올려 마우스가 와이어 그리드, 케이지 상단, 또는 케이지 가장자리를 잡아 할 수 있습니다. 임신, 예를 들어, 복부의 팽창 (그림 1)의 징후를 확인하기 위해 복부 영역을 관찰한다. 주 : 임신의 부호는 항상 E10.5보다 E11.5에서 더 분명하다. </li><li> 임신을 확인하기 위해 마우스의 무게를. 임신 한 마우스는 일반적으로 E10.5에서 약 20 % 무겁고 비 임신 한 마우스 (그림 2)에 비해 E12.5에서 30 % 무거운 무게. 단일 집 청소 새장에서 임신 한 쥐. </li></ol> 5. 20 밀리그램 /kg 폴리 (I : C) 준비 <ol><li> 유전자 발현 분석을 위해 그룹 당 적어도 6 행동 실험 군당 댐 (3)를 사용한다. 솔루션 : 폴리 (C I)의 해당 금액을 준비합니다. </li><li> 40 mg / ml의 최종 농도를 확인하기 위해 50 ㎖ 원뿔형 튜브 (C I) 분말 폴리 무게. 최소화 및 주입 부피에 의한 응력을 표준화, 폴리 5 μL를 주입하기 위해 (I : C)의 마우스 체중 (5 μL / g, 5 ㎖ / kg)의 각 그램에 대한 솔루션을 제공한다. kg 당 : (C I) MIA를 유도하기 위해, 우리는 폴리 20 mg을 주입. 주 : 폴리 농도 (I : C) 필요 용액 (20 ㎎ / ㎏) / (5 ㎖ / kg) = 4 ㎎ / ㎖이다. 폴리 때문에 (I는 : C) 분말을 10 % 폴리 포함 된 용액 (I : C)에, 우리는 (4 ㎎ / ㎖) /0.1= 40 밀리그램 / 폴리 ㎖ (C I)의 최종 농도를 확인해야한다. 주의 : 폴리 (I : C) 분말은 매우 가볍다. 원뿔 튜브에 주걱에서 전송하는 동안 어떤 분말을 잃지 않도록주의하십시오. </li><li> 원추형 욕조로 0.9 % 염화나트륨 (식염수)의 해당 볼륨을 추가전자와 뚜껑을 닫습니다. 이 솔루션은 분명하다 때까지 (C I) 분말 부드럽게 폴리 통해 식염수 방울을 압연하여 분말을 용해. 1 분 (그림 3C) 800 XG에 원뿔 튜브를 원심 분리기. (: C I) 0.22 μm의 필터로 해결 폴리를 필터링합니다. 1.5 2 ml의 microcentrifuge 관에 (C I) 솔루션 폴리을 전송합니다. 옵션 : 솔루션 : 폴리 (C I)의 280 분의 260의 비율을 측정하는 분광 광도계를 사용합니다. 비율이 제조자에 의해 설명 된 바와 같이 1.54-1.82 (그림 3) 사이에 있는지 확인하십시오. 참고 : (: C I) 분말 및 멸균 및 제약 학년해야 제어 분사의 역할 폴리을 용해하는 데 사용되는 식염수. </li></ol> 6. 식염수 또는 폴리 (I : C) E12.5에 주입 <ol><li> 규모에 마우스를 달아 케이지에 다시 넣어. (C : I) 마우스 : 체중 (g) (5)에 의해 승산 = 원하는 주입량 (μL) 염 및 폴리 모두 분사 체적을 계산하기 위해 다음 식을 사용한다. 0.3 ML의 INSUL를 사용하여(: C I) 솔루션, 예를 들면, 30g 마우스 150 μL 주사기에 생리 식염수를 계산 볼륨 또는 20 ㎎ / ㎏ 폴리을 그립니다. </li><li> 조심스럽게 꼬리의 기본으로 마우스를 선택하고 케이지의 상단에 배치합니다. 스트레스에 의해 유도 교란 효과를 방지하기 위해 부드럽게 마우스를 처리합니다. 두 개의 상부 젖꼭지 (그림 4)의 중심에 마우스에 약 20 ° 상대, 최대 베벨, 바늘을 삽입하고 식염수 또는 폴리 (I : C) 주입 솔루션을. 주 : 바늘은 주사 후 각 마우스 교체해야합니다. </li><li> 다시 홈 케이지에 마우스를 놓습니다. 다른 교란 효과를 피하기 위해 조용하고 낮은 트래픽 방에 케이지를 놓습니다. </li></ol> 7. 폴리 다음날 (I : C) 사출 (E13.5) <ol><li> 다음 아침에 주입 된 쥐를 확인합니다. 체중을 측정하는 척도를 사용합니다. 참고 : 폴리 : 식염수가 INJ 다음날에 쥐를 주입보다 (I C)는 임신 한 마우스는 일반적으로 적은 체중 증가 주입ection. </li><li> 자식이 태어난 때까지 마우스를 방해하지 마십시오. </li></ol> MIA의 자손의 8 게이지 <ol><li> MIA 유도의 혼란 함을 주죠 영향을 최소화하기 위해, MIA 자손의 사용을 측정하기 위해 아래의 지침을 따르십시오. <ol><li> 쓰레기 크기가 5보다 작은 조기 또는 지연 출생에서, 또는 경우 새끼를 제외합니다. </li><li> 쓰레기 크기가 10보다 큰 경우 CO 2에 의한 과도한 새끼를 안락사. </li></ol></li></ol> 9. 옵션 : MIA 후 급성 염증 반응을 검사 <ol><li> 기관의 동물 관리위원회 승인 프로토콜에 설명 된 방법을 사용하여 주입 : 식염수 또는 폴리 (C I) 후 임신 한 쥐 3 시간을 희생. 주 : 경추 탈구가 종종 댐 배아에 CO 2 / 안락사 약물의 효과를 최소화로 바람직하다. </li><li> 태반과 태아의 브래지어를 성인 임신 한 마우스에서 비장를 수집 및 분리실체 현미경 아래에있다. <ol><li> 비장 컬렉션의 경우, 해부 접시에 마우스를 놓고 임신 한 쥐의 복부에 70 % 에탄올을 스프레이. 피부를 통해 흉곽 아래 복부 영역의 중앙에 수직 컷을 만들기 위해 멸균 가위를 사용합니다. </li><li> 비장은 왼쪽 우수한 복부 사분면에 앉아있다. 비장을 분리 집게를 사용합니다. 기관 주위 지방 조직을 제거하는 섬세한 작업 와이퍼에 비장 롤. 비장 조직의 약 50 mg의 수집 및 핵산 분해를 방지하기 위해 버퍼 또는 트리 졸 안정을 500 μL의 RNA와 에펜 도르프 튜브에 개별적으로 배치합니다. 사용할 때까지 -80 ° C의 냉동고에서 샘플을 저장합니다. </li><li> 태반 수집을 위해, 부드럽게 몸에서 자궁 뿔을 잡아 당깁니다. 멸균 된 인산 완충 식염수 (PBS)로 가득 배양 접시에 자궁 뿔을 놓고 얼음 접시를 둡니다. 자궁 벽을 열고 눈물과 양막 낭을 노출하는 두 개의 집게를 사용합니다. <ol><li>조심스럽게 태반과 태아를 손상시키지 않고 양수 주머니를 열려면 집게를 사용합니다. 태아의 태반을 분리하고 가능한 한 태반에 가까운 탯줄을 잘라. 태반에서 양막 낭 파편을 제거합니다. 개별적으로 버퍼 또는 트리 졸 안정을 500 ㎕의 RNA와 에펜 도르프 튜브에 태반을 놓습니다. 사용할 때까지 -80 ° C의 냉동고에서 샘플을 저장합니다. </li></ol></li><li> 태아의 뇌 수집을 위해, 해부 할 때까지 단계 9.2.2에서 버퍼를 안정 RNA에 태아를 저장합니다. 실체 현미경 아래에서 섬세 # 5 집게를 사용하여 뇌의 뇌실에서 pial 멤브레인을 애타게. 조심스럽게 태아의 뇌에서 모든 막을 제거합니다. 개별적으로 버퍼 또는 트리 졸 안정을 500 ㎕의 RNA와 에펜 도르프 튜브에 태아의 두뇌를 놓습니다. 사용할 때까지 -80 ° C의 냉동고에서 샘플을 저장합니다. </li></ol></li><li> 조직에서 RNA를 추출하여 cDNA를에 RNA를 변환합니다. 리얼 t하여 cDNA를 IL6의 유전자 발현 분석IME PCR. </li><li> 트리 졸의 제조 프로토콜에 따라 조직에서 RNA를 추출합니다. 조직은 RNA 안정화 버퍼에 저장되어있는 경우. 샘플을 해동하고 버​​퍼를 스핀 다운. 500 ㎕의 트리 졸과 다른 에펜 도르프에 팁으로 조직을 전송하고 RNA 추출을 계속합니다. </li><li> 농도 260/280 및 RNA의 230분의 260의 비율을 측정하는 분광 광도계를 사용한다. 비율이 2.0 이상일 확인합니다. </li><li> 10 ㎕의 최종 부피로 처리 된 DNase를 I. 믹스 1 μg의 RNA와 RNA의 1 ㎕의 10X 반응 완충액 1 ㎕의 RNA 분해 효소가없는 DNase를하고 클레아없는 물에 의한 DNA의 오염을 제거한다. 30 분 동안 37 ° C에서의 마스터 믹스를 부화. 반응을 종료 1 μL DNase의 중지 솔루션을 추가합니다. 10 분 동안 65 ° C의 혼합물을 품어. </li><li> 의 cDNA에 RNA를 전사 역. 20 ㎕의 반응을 사용하여 최대 반응 당 총 RNA의 μg의 1. 전사 (RT) 반응 혼합물 버퍼를 역 5 배 4 μl를 혼합, 1 μL 레브ERSE의 효소가의 DNase I, 4 ㎕를 클레아없는 H 2 O로 처리 한 후 11 μl의 RNA 템플릿은 최종 20 ㎕의 솔루션을 확인합니다. RT에 대한 열 자전거 타는 조건을 프로그래밍합니다. 일반적인 조건은 다음과 같습니다 : 1 단계 : 5 분 25 ° C를; 2 단계 : 30 분 동안 42 ° C; 3 단계 : 5 분 85 ° C; 4 단계 : 4 ° C에서 개최합니다. cDNA를 5 배 희석. 단기 저장을 위해, 4 ° C에서 cDNA를 저장합니다. 장기간 저장을 위해, -20 ° C에서 cDNA를 동결. </li><li> 실시간 PCR하여 cDNA를 IL6의 유전자 발현 분석 및 베타 - 액틴 유전자 발현을 IL6 유전자 발현을 정규화. <ol><li> IL6 및 β - 굴지 검출을위한 마스터 믹스를 확인합니다. 25 ㎕의 반응을 사용하여 각 유전자에 대한 마스터 믹스 12.5 μL SYBR 그린 믹스 10 μM 정방향 프라이머, 0.5 ㎕의 10 μM 역방향 프라이머 및 6.5 ㎕의 뉴 클레아없는 H 2 O 0.5 μL 포함 </li><li> 5 ㎕를 5 배 희석 cDNA를 a를 배치광 반응을 96- 웰 플레이트의 웰의 바닥에서 t. 피펫은 각 웰에 마스터 믹스 20 μl의 최종 25 ㎕의 PCR 믹스를 확인합니다. 각 샘플에 대한 각 유전자 중으로. 광학 필름 접착제를 사용하여 플레이트를 밀봉. 4 ° C를 사용하여 실시간 PCR의 표준 프로그램에서 3 분 동안 800 XG에 접시를 스핀 다운 : 1 단계 : 50 ° C 2 분; 2 단계 : 10 분 동안 95 ° C; 3 단계 : 15 초 온도 1 분 60 ° C 95 ° C의 40주기. 해리 곡선 추가 단계를 추가합니다. </li></ol></li></ol> 10. MIA 성인 자손의 행동 이상 (선택 사항) 검사 : <ol><li> 8-12주의 나이에 동작 테스트를 수행합니다. 최소 3 일 시험 전에 케이지 침구를 변경합니다. 적어도 30 분 시험 전에 행동 테스트 룸에 쥐를 적응. </li><li> 프리 펄스 저해 (PPI)의 경우, 하부 압전 센서 플렉시 실린더 내의 마우스 억제. PPI에 마우스를 적응5 분 동안 챔버. 120dB 백색 잡음 (놀라게)의 6 시험에 쥐를 노출. </li><li> 그리고 15dB (15dB 이상 소음의 14 시련 놀라게 14 시험, 프리 펄스 5dB (5dB 배경 잡음보다 높은) + 놀라게 (PPI5)의 14 시련과 프리 펄스의 14 임상 시험의 무작위 혼합물로 쥐를 노출 배경 잡음 + 놀라게 (PPI15)보다. </li><li> 120dB 시험의 첫 번째 (6) 시험에 대한 놀라게 응답의 평균. 다른 각각의 자극에 대한 놀라게 응답의 평균. (- PPI5 또는 PPI15 놀라게) / 놀라게하여 프리 펄스 억제에 값을 은밀한. </li><li> 오픈 필드 테스트의 경우, 열린 광장 무대 (50 × 50 X 50cm 3)의 모서리에 마우스를 놓습니다. 천장에 장착 된 카메라를 통해 10 분 동안 마우스의 궤적을 기록합니다. 중앙 영역 (17 X 17cm 2)로 무대의 중심을 정의합니다. 수동 또는 이미지 기반의 자동 분석 소프트웨어 중심 영역에 소요되는 이동 거리, 중앙 영역 항목 및 시간을 정량화. </리&gt; <li> 대리석 매립 시험의 경우, 10 분 동안 압축 5cm 깊이, 청소, 아스펜 소나무 침구 테스트 케이지에 마우스를 적응. 그 homecage에 마우스를 돌려줍니다. 부드럽게 4 × 5 배열의 방식으로 20 남색 1.5 cm 직경의 유리 구슬을 배치합니다. 10 분 동안 구슬 테스트 케이지에 다시 마우스를 놓습니다. 10 분의 시험 시간에 매장 된 구슬을 계산합니다. </li></ol> (11) MIA 성인 자손의 소뇌 신경 병리학 (선택 사항) 검사 : <ol><li> 마취에 의한 생리 식염수와 MIA 성인 자손을 안락사. 심혈 내지 50㎖의 PBS로 마우스 및이어서 50ml의 4 % 파라 포름 알데히드를 관류. </li><li> 조심스럽게 뇌를 제거하고 4에서 하룻밤 4 % 파라 포름 알데히드의 뇌를 접미사에 기음. PBS로 3 회 뇌를 씻어 사용할 때까지 4 ° C 냉장고에 0.02 % 나트륨 아 지드와 PBS의 뇌를 저장합니다. 주 :라는 접미어 뇌는 0.02 %의 잔디와 PBS에 저장 될 수있다한 달에 최대의 냉장고에 이움 아 지드. </li><li> 제 50 μm의 얇은 조각으로 뇌 sagittally vibratome를 사용하여. 부드러운 브러시 펜을 사용하여 뇌의 부분을 수집합니다. 실온에서 30 분 동안 0.6 %의 과산화수소 수의 섹션을 배양하여 내인성 퍼 옥시 다제 활성을 종료한다. </li><li> 밤새 실온에서 차단 완충액 (PBS 중 0.1 % 트리톤 X-100, 0.02 % 아 지드 화 나트륨과 10 %의 염소 혈청)에 희석 방지 calbindin 항체의 섹션을 인큐베이션. 실온에서 2 시간 동안 블로킹 완충액에 희석 한 비오틴 이차 항체에 대응하는 섹션을 배양한다. </li><li> 아비딘 DH의 섹션을 인큐베이션 - 비 오티 닐화 퍼 옥시 다제 착체 H 버퍼를 실온에서 1 시간 동안 바이오틴을 검출. 항원을 가시화하는 퍼 옥시 다제 기질을 이용하여 부분을 개발한다. 단계 사이에 PBS로 3 회 섹션을 씻으십시오. 현미경 슬라이드에 섹션을 탑재합니다. 이미지 현미경 섹션. </li></올&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

서로 다른 시간 창에서 MIA 유도는 설치류에서 다른 두뇌 발달 이벤트를 교란, 결과적으로 자손에 다른 행동 이상과 neuropathologies에 연결됩니다. E12.5에 주입 : 여기, 우리는 폴리 (C I)와 마우스에서 MIA를 유도 할 수있는 프로토콜을 설명했다. MIA 유도의이 방법은 행동, 신경 학적, 면역 학적, 그리고 자손 8,10,11,16에서 자폐증과 정신 분열증과 관련된 위장관 이상에 연결됩니다. MIA는 환경 적 위험 인자이기 때문에이 점에 유의하는 것이 중요하고, 자손의 표현형이 신경 발달 장애의 유전 적 모델 쥐에서보다 높은 변동을 가질 것으로 기대된다. 따라서, 정확하고 일관 MIA 통해 자폐증, 정신 분열증과 관련된 표현형을 생성하기 위해, 상기 결과 혼란 추가적인 변수를 최소화하는 것이 특히 중요하다. 프로토콜에 설명 된 타임 라인 가까이 따라야한다LY. 올바른 분사 시간 창 MIA 원하는 단계에서 자손의 두뇌 발달을 교란 있는지 확인합니다. 마우스에서 E12.5에서 MIA의 유도는 인간의 임신 (21)의 첫 번째 임신의 끝 부분 섭동에 해당 - 상당한 두뇌 발달이 대뇌 피질의 층에 조롱박 세포와 미상의 피질의 개발 및 신경을 포함하여, 발생하는 기간입니다. 추가 조사는 MIA 소뇌 조롱박 세포의 손실 및 뇌 발달의 초기 섭동의 연관성을 증명하기 위해 필요한 것이다. 일관된 치료, 검사 및 댐도 축산는 자손의 표현형에 산모의 스트레스의 영향을 최소화 할 수 있지만, 우리의 프로토콜은 여전히​​ 연구자가 알아야 할주의 사항이 포함되어 있습니다. (C : I) 및 임신의 나머지 부분, 예를 들어, 폴리 주입 전날 집에게 댐 싱글. 우리의 전략은 undisturbe에서 임신 한 쥐를 떠날 것입니다D 환경을 제공합니다. 그러나이 조치는 산모의 환경에서 스트레스 반응을 유도 할 수있다. 우리는이 분리 유발 스트레스 반응은 자식의 개발을 방해 여부를 모르고 있지만, MIA 효과는 우리의 방법에 따라 관찰 될 수있다. 또한, 마우스의 유전 적 변형 및 배경을 선택하고 MIA 유도주의 깊게 검사되어야한다. 지금까지 MIA의 효과는 주로 야생 형 C57BL / 6N 생쥐 8,10,13,16에 복제됩니다. 기타는 BTBR 마우스 스트레인 (19)의 MIA 효과를 관찰했다. 자손에 추가 교란 효과를 초래할 수있다 유전자 조작 생쥐 13,22-24 다른 면역 반응을 유도 할 수있다 : (C I)는 그 폴리 보였다. 생물학적 복제 횟수의 관점에서는, 유전자 발현, 단백질 또는 면역 대한 그룹당 행동 또는 생리 학적 분석법에 대한 그룹당 적어도 6 리터, 3 리터를 사용조직 화학 접근. 우리 실험 대신에 바이어스를 피하기 위해 쓰레기 내에 하나 또는 두 개의 자식을 사용하는 깔짚 내의 모든 자손을 테스트한다. 또한 쓰레기 내의 모든 자손의 데이터를 평균 한 데이터 포인트 (예컨대 N = 리터의 수 있음) 피하기 부적절한 통계 (13)이 평균을 사용한다. 명백한 성별 차가 MIA 모델 (13)에서 관찰되지 않았기 때문에 각 성별의 데이터는 또한 풀링된다. 쓰레기 크기 MIA의 자손을 계측 뒤에 근거는 산모 간호 및 간병으로 인한 변화를 최소화하는 것이다. 쓰레기 크기는 마우스 6분의 25 C57BL에에 박힌 행동과 상관 관계를 보였다. 우리는이 어머니의 간호 및 간병 동안 자원의 할당에 의한 될 수 있다고 추측. 이 혼란 효과를 방지하기 위해, 우리의 표준 원하는 쓰레기 크기는 C57BL / 6 마​​우스에 대한 6-10이다. 밀접 프로토콜 다음의 경우에도, 실험자 EN 수도주입 : 폴리 (C I) 후 임신 한 쥐에 지나치게 약하거나 지나치게 강력한 면역 반응에 대응. 이를 방지하기 위해서는 폴리 다른 배치 (: C I)의 발열 및 cytokinogenic 활성을 확인하는 것이 필수적이다. 다른 배치 및 폴리의 많은 : 쥐에서 염증 반응의 서로 다른 수준으로 이어질 수 같은 회사에서 (I C); 기 막히게, 폴리 동일 용량 주입 : 다른 배치에서 (I C 것은) 플라즈마에서 최대 10 배 차이 IL-6 수준 (26)이 발생할 수 있습니다. 투여 량 및 폴리의 배치 결정 : 비 임신 여성 IL-6 측정의 판독에 의해 더 MIA의 실험 (I C 것은) MIA 유도에서 효과의 변화를 줄일 수있다. 이 폴리 특정 배치에 대한 투여 수정할 필요가있는 경우 주 사용 용액을 주입 부피는 그램 당 약 5 μL 남도록 (I : C)을 그 (C I) 폴리 농도를 변경하는 것도 중요 마우스 무게. 예를 들어, 증명할에 따른acturer의 절차는, 폴리은 (I : C)는 아마 생리적 인산 완충 용액의 폴리 뉴클레오티드를 수득 물 10 ㎎ / ㎖ ~로 재구성된다. 우리의 40 ㎎ / ㎖ 용액에 비해 낮은 농도 4 겹으로 주입 부피를 증가시킬 것이다. 임신 마우스를 들어, 버퍼 주입 대량 잠재적 자손 효과를 교란, 배아의 압력을 증가시키고 바람직하지 않은 도입 할 수있다. 주입 부피를 줄이기 위해 높은 최종 농도 0.09 %의 염화나트륨 (C I) 분말 따라서 폴리 용해 선택한다. 종래의 연구는 뇌 발달 및 행동 MIA의 효과를 매개하는 데 중요한 요인으로 IL-6 신호를 식별 때문에 IL-6는 급성 염증 반응의 마커로 선택된다. 폴리하기 (I : C) 처리는 IL-6는 모체 혈액 태반 10,12 가장 상향 조절 사이토 카인이다. 가장 중요한 것은, 스미스 등. 몇 가지의 입증매우 상향 조절 사이토 카인 만 IL-6는 MIA 관련 뇌와 행동 이상 유도 모두 필요 충분 조건을 나타내었다. 중화 다른 사이토 카인 (10)은하지 않았다 동안 즉, 효과적으로 MIA의 자손에서 비정상적인 행동과 transcriptomic 이상을 방지 할 수 항 IL-6의 모성 주입입니다. 또한, 재조합 IL-6 형 (폴리없이 (I : C))의 어머니의 주입은 MIA 태아의 뇌와 자손 12,15에서 볼 MIA 관련 전사 및 행동 이상을 재생한다. MIA을 유도하는 다른 방법과 비교하여 (예를 들면, 리포 폴리 사카 라이드 (LPS) 또는 인플루엔자, 폴리 I : C)은 비교적 안전하고, 면역 반응의 강도를 조절하는 간단한 방법을 제공한다. 산모 폴리 (I : C)에 의해 유발 염증 반응하지만 정부는 급성 및 일시적이며, 자손의 행동과 두뇌 발달에 미치는 영향은 깊은입니다. 전반적으로, MIA t을 유도하는 기술 한 번hrough 폴리 (I는 : C) E12.5에서 주입되는 마스터 하나는 자식이 환경에 위험 요인의 영향을 조사하기 위해 서로 다른 행동 및 생물학적 분석을 수행하도록 진행할 수있다. 동시에, 하나는 이전, 도중 유전자 변형 또는 다른 치료와 방법을 조합하거나 임신 후 원인 및 자폐증, 정신 분열증 치료에 대한 가능한 접근법을 조사하기 위해.

산모의 면역 활성화의 개념 (MIA)는 자폐증과 정신 분열증 1 모성 감염의 연관성에 대한 역학 연구에서 유래. 인해 태반 또는 바이러스 감염 모체 2,3- 후 태아 뇌에서 검출 가능한 복제 바이러스 병원체의 부재에, 자손에 감염의 효과가 오히려 병원체 자체보다 모체 면역 시스템의 활성화에 의한 것으로 가정한다 . polycytidylic 산 : MIA와 정신 장애, 화학적으로 합성, 바이러스 성 모방 이중 가닥 RNA의 polyinosinic의 주입 사이의 인과 관계를 규명하기 : 임신 설치류에 (폴리 (I C)) 널리 MIA의 동물 모델로 사용되어왔다 4,5. 폴리는 (I : C) 수신자 같은 수용체 3 (TLR3) 및 폴리의 전신 투여 인식 (난 : C)은 바이러스와 같은 급성 염증 반응 유도한다. 메커니즘 중 하나되는 폴리으로 (I : C) 홍보자손에 oduces 행동 이상과 neuropathologies는 산모 - 태반 - 태아 축 6 프로와 항 염증성 사이토 카인의 불균형을 초래하는 것입니다. 몇몇 그룹은 정신 장애 (7)의 원인을 이해하는 MIA 모델을 채용 한 의한 연구 그룹 중에서 다양한 관심사 면역 활성화의 다양한 시점은 뇌 발달과 행동 7 상이한 섭동을 달성하기 위해 사용되었다. 배아 12.5 일에서 임신 한 쥐에 성공적으로 MIA는 행동, 신경을 유도 할 수 있음을 보여 주었다 (E12.5)을, (C I) 캘리포니아 기술 연구소의 폴 H. 패터슨 연구소는 폴리를 주입하는 전략을 채택 자폐증과 정신 분열증 8-11과 관련된 자손의 면역 학적 변화. 우리의 이전 작품 MIA의 자손이 행동 이상 (예를 들어, 사회 impairmen을 표시 보여t, 통신 결핍, 반복 행동, 불안 같은 행동 및 잠재 억제 적자 8,10,12), 면역 조절 곤란 및 사이토 카인 불균형 8,13,14, 태아의 뇌 유전자 발현 (15)의 변경, 소엽 VII에 조롱박 세포의 손실 소뇌 (11), 해마 9 시냅스 특성의 변화, 유전자 X 환경의 상호 작용 (13), 장 투과성의 변화 및 장내 미생물 조성 16. 또한, 치료 및 예방 전략이 모델 시스템 13,16,17에서 개발된다. E12.5에서 MIA을 유도함으로써, 다른 MIA는 뇌 synaptosomal 분자 (17)의 태아 미세 아교 활성화 및 기저 전뇌 (18)의 콜린성 발달 변경, 변형 특정 상호 작용 (19), 뇌 뇌 synaptosomal 미세 구조의 이상, 뇌 미토콘드리아 호흡 연쇄 항진의 abnormalties, 하향 조절을 생산하는 것으로 나타났습니다 ,우울증 같은 행동,인지와 해마 장기 강화 (LTP)의 손상, 성인 해마 신경 (20)의 적자. (C : I)뿐만 아니라, 자폐증, 정신 분열증의 병인을 연구 모델을 적용하는 방법에 대한 패러다임 여기서는 폴리 의해 E12.5에서 MIA을 유도하는 방법의 상세한 방법을 제공한다. 이 장애는 4 MIA 다양한 위험 인자 인 것이 중요하고, 그 결과 시간 및 유도 방법뿐만 아니라, 임신 댐 축산에 매우 민감하다. 따라서, 실험실간에 사소한 불일치는 종종 낮은 재현성 및 / 또는 자손 다른 표현형을 초래한다. 우리의 방법은 특별히 자폐증, 정신 분열증에 대한 환경 적 위험 인자로 MIA 연구에 관심을 위해 설계되고, 상세한 설명은 연구자들이 데이터의 재현성을 향상시킬 것이다 제공.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> / kg 폴리 20 mg을 주입 : E12.5에서 (I C)는 산모 - 태반 - 태아 축에서 급성 염증 반응을 불러 일으킬과 두뇌 발달 및 행동 표현형 12, 13에 만성적 인 영향을 침전 수 있습니다. 전 염증성 사이토 카인의 상승 수준은 인터루킨 (IL) -6, MIA 후 급성 염증 반응의 신뢰할 수있는 지표입니다. 주사 12, 13 : IL6 유전자 태반의 표현과 태아의 뇌에 대한 피크 시간은 3 시간 후 폴리 (C I)에 있습니다. 우리는 그 폴리을 보여 주었다 (난 : C)는 산모의 비장-태반 태아의 뇌에서 높은 IL6 유전자 발현 (그림 5) 유도 (우에서 적응 데이터 등, 2015). 13. 연구자 등 예를 들어 MIA 후 급성 염증 반응, 임산부 다이어트, 유전 적 돌연변이 생쥐, 항 염증 약물을 바꿀 수있는 요인을 연구하기 위해 다른 치료와 함께이 패러다임을 결합 할 수 있습니다. <html> &quot;FO : 유지-together.within 페이지 =&quot;엔트 한편 1 &quot;&gt;, 행동 변화는 MIA 모델의 특징은 몇 가지 행동 테스트는 다른 자폐증과 정신 분열증과 같은를 보여주기 위해 MIA 성인 자손에 수행 될 수있다. 식염수 자손에 비해 행동. 일반적으로, MIA의 자손 오픈 필드 테스트에 소요 된 적은 중심 영역 항목과 짧은 중심 영역의 지속 시간을 표시합니다. 그들은 또한 (데이터 적응 시험과 낮은 PPI (그림 6) 매장 대리석에 더 자주 매립 동작을 표시 우에서 등., 소뇌의 소엽 VII에 조롱박 세포의 2,015) 13. 손실 (MIA 자손의 또 다른 특징이다시 등., 2009). calbindin 항체로 염색 할 때, 소뇌의 적은 calbindin 양성 조롱박 세포가있다 식염수 제어 자손 (그림 7)에 비해 MIA 자손의 소엽 VII. 3643 / 53643fig1.jpg &quot;/&gt; 그림 1. 임신 한 쥐의 부호. 중간 임신 마우스의 복부 영역 (화살표)의 팽창에 의해 식별 될 수있다. 근친 C57BL / 6 마우스 변형은 예를 들어 여기에 사용됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53643/53643fig2.jpg" /> (E) 배아 0.5-12.5 일에서 임신 한 C57BL / 6N 생쥐 그림 2. 체중 변화. E0.5에 존재하는 질 플러그 임신 및 비 임신 한 쥐를 비교하면, 체중의 (A)의 체중 및 (B) 비율 임신 마우스 E10.5 극적인 증가를 겪는다. 임신 N = 10, 비 임신 N = 5. 데이터는 평균 ± SE로 표시됩니다. *** p &lt;0.001, ****P &lt;0.0001. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53643/53643fig3.jpg" /> 그림 3. 폴리의 흡광도 측정 (I : C).. 용액 280 분의 260 비율이 1.54-1.82 사이에 있는지 확인 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/53643/53643fig4.jpg" /> 그림 4. 폴리 (I : C) 배아 (E)에 주입 12.5 일 목덜미 임신 한 마우스 부드럽게를.. 주사 부위는 상부 유두의 중앙에 위치한다. 바늘을 주입 마우스에 약 20 ° 각도로 위로 경사지게. 근친 C57BL / 6 마우스 변형은 예를 들어 여기에 사용됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53643/53643fig5.jpg" /> 그림 5. 폴리 (I : C). 주입 데이터는 평균 ± SEM으로 표시하고 있습니다 댐의 비장-태반 태아의 뇌 축에서 IL6 유전자 발현을 증가시킨다. * P &lt;0.05, ** p &lt;0.01 (데이터로부터 우 외. 2015 년과 기사 (13)에 대한 수정 원래이다). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/53643/53643fig6.jpg" /> 그림 6. &amp; #(160);. MIA 성인 자손이 자폐증과 정신 분열증의 endophenotypes과 관련된 행동 이상을 전시 오픈 필드 테스트에서, MIA의 자손 (A)의 중심 영역에 소요되는 시간을 줄이고 중앙 자주 영역과 (B)를 입력합니다. 대리석 매립 시험에서 (C)는, MIA의 자손은 식염수 제어 자손보다 더 많은 구슬을 묻어. MIA의 자손 (D) 프리 펄스 5dB에서 프리 펄스 억제 (PPI) 적자 (E) 프리 펄스 15dB을 나타낸다. ± SEM을 의미한다. * P &lt;0.05, ** p는 &lt;0.01 (데이터는 원래부터 우 외. 2015 년과 기사 (13)에 대한 수정입니다). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 7" src="/files/ftp_upload/53643/53643fig7.jpg" /> 그림 7. MIA 성인 자손은 VII는 MIA 성인 자손에 표시되어 소엽에서 조롱박 세포의 자폐증. 손실의 endophenotypes과 관련된 신경 병리학 적 이상을 나타낸다. 화살표 : Calbindin + 조롱박 세포. ML : 분자 층, GCL : 과립 세포층, PCL :. 조롱박 세포 층 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

(: C I) 바이러스 성 모방 폴리와 중간 임신 단계에서 마우스의 모성 면역 활성화 유도

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.2K 조회수.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

비디오: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

의 마우스 모델 Utero에 이식

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

연구

의학

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

마우스 자궁에서 임신 기간 동안 산모의 혈관 재 평가

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

발생학

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

사용<em&gt; 생체 내</em&gt; 이미징 신생아의 실험 쥐 거대 세포 바이러스 감염의 진행 상황을 모니터링 할 수

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

면역학 및 감염병학

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

사이토 카인 생산의 바이러스 성 회피에 타고난 면역 신호를 해부

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

Mouse In Vivo Placental 표적 CRISPR 조작

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

유전학

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

산모 - 태아 인터페이스에서 쥐의 조직에서 백혈구의 분리

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

신생아 뇌에 바이러스 성 입자와 형광 마이크로 비즈의 뇌실과 혈관 내 주입

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

신경과학

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus GBS

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

신생아 장 발달에 급성 chorioamnionitis의 효력을 연구하기 위하여 모성 염증에 태아 노출의 Murine 모형

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring

Maternal immune activation (MIA) during pregnancy is consistently linked to increased risk of neurodevelopmental and neuropsychiatric disorders in offspring. Animal models of MIA are used to test causality, investigate mechanisms, and develop diagnostics and treatments for these disorders. Despite their widespread use, many MIA models suffer from a lack of reproducibility and almost all ignore two important aspects of this risk factor: (i) many offspring are resilient to MIA, and (ii) susceptible offspring can exhibit distinct combinations of phenotypes. To increase reproducibility and model both susceptibility and resilience to MIA, the baseline immunoreactivity (BIR) of female mice before pregnancy is used to predict which pregnancies will result in either resilient offspring or offspring with defined behavioral and molecular abnormalities after exposure to MIA. Here, a detailed method of inducing MIA via intraperitoneal (i.p.) injection of the double stranded RNA (dsRNA) viral mimic poly(I:C) at 12.5 days of gestation is provided. This method induces an acute inflammatory response in the dam, which results in perturbations in brain development in mice that map onto similarly impacted domains in human psychiatric and neurodevelopmental disorders (NDDs).

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using PolyI:C to Study Susceptibility and Resilience in Offspring

Maternal infection is a risk factor for neurodevelopmental disorders. Mouse models of maternal immune activation (MIA) may elucidate infection's impact on brain development and function. Here, general guidelines and a procedure are provided to produce reliably resilient and susceptible offspring exposed to MIA.