Authors would like to thank Catherine Solioz for her skillful assistance.

1. BCM 준비 <ol><li> 가능한 한 신선한 지역 정육점에서 돼지 턱을 얻습니다. 회사 표면에 턱을 놓고 전체 두께 플랩이있는 부드러운 조직을 떠나거나 뼈에 부착 된 골막하지 않도록 특별한주의를 기울이고 놓습니다. 흐름 후드에서 작동 할 필요없이 깨끗한 환경에서 작업. </li><li> 전체 두께 플랩이 해제되면, 협측에서 뼈 칩을 수확 뼈 스크레이퍼를 사용합니다. 뼈 스크레이퍼 날카로운되어 있어야합니다. 단단히 뼈 스크레이퍼를 처리하고 긴 운동은 뼈를 수집로. 작은 그 1mm를 뼈 칩을 폐기하십시오. <ol><li> 기본 뼈 칩을 유지하기 위해, 1 %의 항생제와 그들을 밖으로 건조를 허용하지 않습니다 항진균제 보충 둘 베코의 수정 이글의 중간 (DMEM)와 10cm 직경의 플라스틱 접시에 직접 뼈 칩을 놓습니다. </li><li> 열처리의 영향을 평가하기 위해, 대상 뼈 칩은 80 ° C에서 30 분 동안 저온 살균 또는121 ℃에서 20 분 동안 오토 클레이브. </li><li> , 탈회의 영향을 평가 4 ℃에서 4-6 시간 동안 1 M HCL에 뼈 칩을 흔들 pH가 중성이 될 때까지 배양 배지로 반복 세척합니다. </li></ol></li><li> 새로운 플라스틱 접시에 1 % 항생제와 항진균제로 보충 된 10 ml의 신선한 DMEM 당 뼈 칩 5 g의 총을 놓습니다. </li><li> 24 시간 동안 37 ℃에서 가습 분위기에서 플라스틱 접시를 놓습니다. 그런 다음, 수확 BCM. 원심 분리기, 파편을 제거 멸균 (0.2 nm의) 필터, -80 ℃에서 냉동 분취 량을 유지하기 위해 10 분 동안 200 XG에 BCM. </li><li> 바로 사용하기 전에 BCM 주식을 해동과 동결 융해의 반복주기를 피하십시오. </li><li> 나타낸 실험에서, RT에서 1 시간 동안 BCM 또는 무 혈청 배지로 콜라겐 막을 담가. PBS로 적극적으로 막을 세척하고 96 웰 플레이트에 배치합니다. 젖은 막은 세포와 씨앗을 품고있다. </li><li> BCM의 제조 공정은도 1에 요약 하였다. </리&gt; </ol> 간엽 세포 기준 2. 생물학적 정량 <ol><li> / cm 2 30,000 세포의 농도로 12 웰 플레이트 (예를 들어, 골 세포, 치은 및 치주 인대 섬유 아세포) 종자 인간 간엽 세포. 세포를 DMEM으로 이루어지는 성장 배지, 10 % 소 태아 혈청과 항생제를 사용 시드. 세포는 플레이트의 O / N에 부착하자. </li><li> 문화 매체를 취소하고 37 ° C에서 미리 예열 PBS로 세포를 씻어. 와 20 % BCM없이 예열 무 혈청 배지를 첨가하여 세포를 자극한다. 24 시간 동안 37 ° C에서 가습 된 분위기에서 셀을 놓는다. </li><li> , 문화 매체를 폐기 미리 예열 PBS로 세포를 씻어하고 원하는 프로토콜에 따라 RNA를 추출. </li><li> 각 샘플에서 RNA의 동일한 금액을하기 위해 RNA의 농도를 조정합니다. cDNA를 준비하고, 표 1에 나타낸 프라이머를 사용하여 선택된 유전자를 분석 QRT-PCR을 수행한다. 참고 :이 모든 구성 요소의 희석 수 있습니다 : 배 SYBR 녹색, 20 배 프라이머 앞으로, 20 배 프라이머 역, 5 배 무균 DD 물, 5 배의 cDNA. QRT-PCR은 95 ° C 15 초, 40 사이클 및 60 ° C에서 1 분간 수행된다. </li><li> CT GAPDH와 Δ (ΔCT) ΔCT 자극 - - ΔCT 제어 ΔCT는 CT의 대상이되는 Δ (ΔCT) 방법을 사용하여 하우스 키핑 유전자 GAPDH에 정상화가 상대적 발현 수준을 계산합니다. </li><li> 이 품질 관리 후에, 중간 엽 세포, 조혈 세포 또는 내피 세포를 포함하여 모든 유형의 세포를 자극하는 배양액을 추가로 BCM. </li></ol>

<ol>
	<li>Buser, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+Stability+of+Early+Implant+Placement+with+Contour+Augmentation.">Long-term Stability of Early Implant Placement with Contour Augmentation.</a> Journal of dental research. , (2013).</li><li>Chiapasco, M., Casentini, P., Bone Zaniboni, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=augmentation+procedures+in+implant+dentistry.">augmentation procedures in implant dentistry.</a> The International journal of oral &amp; maxillofacial implants. 24 Suppl. , 237-259 (2009).</li><li>Giannoudis, P. V., Dinopoulos, H., Bone Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=substitutes:+an+update.+Injury.">substitutes: an update. Injury.</a> 36, Suppl 3. S20-S27. , (2005).</li><li>Jensen, S. S., Broggini, N., Hjorting-Hansen, E., Schenk, R., Bone Buser, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=healing+and+graft+resorption+of+autograft,+anorganic+bovine+bone+and+beta-tricalcium+phosphate.+A+histologic+and+histomorphometric+study+in+the+mandibles+of+minipigs.">healing and graft resorption of autograft, anorganic bovine bone and beta-tricalcium phosphate. A histologic and histomorphometric study in the mandibles of minipigs.</a> Clinical oral implants research. 17, 237-243 (2006).</li><li>Jensen, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+novel+biphasic+calcium+phosphate+in+standardized+bone+defects:+a+histologic+and+histomorphometric+study+in+the+mandibles+of+minipigs.">Evaluation of a novel biphasic calcium phosphate in standardized bone defects: a histologic and histomorphometric study in the mandibles of minipigs.</a> Clinical oral implants research. 18, 752-760 (2007).</li><li>Grabowski, G., Bone Cornett, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=graft+and+bone+graft+substitutes+in+spine+surgery:+current+concepts+and+controversies.">graft and bone graft substitutes in spine surgery: current concepts and controversies.</a> The Journal of the American Academy of Orthopaedic Surgeons. 21, 51-60 (2013).</li><li>Khan, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+bone+grafting.">The biology of bone grafting.</a> The Journal of the American Academy of Orthopaedic Surgeons. 13, 77-86 (2005).</li><li>Bohr, H., Ravn, H. O., Werner, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+osteogenic+effect+of+bone+transplants+in+rabbits.+The+Journal+of+bone+and+joint+surgery.">The osteogenic effect of bone transplants in rabbits. The Journal of bone and joint surgery.</a> British. 50, 866-873 (1968).</li><li>Bone Urist, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=formation+by+autoinduction.">formation by autoinduction.</a> Science. 150, 893-899 (1965).</li><li>Caball&#233;-Serrano, J. D., Buser, D., Gruber, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+analysis+of+porcine+bone+conditioned+medium.">Proteomic analysis of porcine bone conditioned medium.</a> The International journal of oral &amp; maxillofacial implants. , (2014).</li><li>Peng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone-Conditioned+Medium+Inhibits+Osteogenic+and+Adipogenic+Differentiation+of+Mesenchymal+Cells+In+Vitro.">Bone-Conditioned Medium Inhibits Osteogenic and Adipogenic Differentiation of Mesenchymal Cells In Vitro.</a> Clinical implant dentistry and related research. , (2014).</li><li>Brolese, E., Buser, D., Kuchler, U., Schaller, B., Gruber, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+bone+chips+release+of+sclerostin+and+FGF-23+into+the+culture+medium:+an+in+vitro+pilot+study.">Human bone chips release of sclerostin and FGF-23 into the culture medium: an in vitro pilot study.</a> Clinical oral implants research. , (2014).</li><li>Caball&#233;-Serrano, J., Bosshardt, D. D., Gargallo-Albiol, J., Buser, D., Bone Gruber, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=conditioned+medium+enhances+osteoclastogenesis+in+murine+bone+marrow+cultures.+Clin+Oral+Impl+Res;+in.">conditioned medium enhances osteoclastogenesis in murine bone marrow cultures. Clin Oral Impl Res; in.</a> Int J Oral Maxillofac Surg. , (2015).</li><li>Zimmermann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone-conditioned+medium+changes+gene+expression+in+bone-derived+fibroblasts).">Bone-conditioned medium changes gene expression in bone-derived fibroblasts).</a> IJOMI accepted. , (2014).</li><li>Fulzele, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myelopoiesis+is+regulated+by+osteocytes+through+Gsalpha-dependent+signaling.">Myelopoiesis is regulated by osteocytes through Gsalpha-dependent signaling.</a> Blood. 121, 930-939 (2013).</li><li>Becerra, J., Andrades, J. A., Ertl, D. C., Sorgente, N., Nimni, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Demineralized+bone+matrix+mediates+differentiation+of+bone+marrow+stromal+cells+in+vitro:+effect+of+age+of+cell+donor.">Demineralized bone matrix mediates differentiation of bone marrow stromal cells in vitro: effect of age of cell donor.</a> Journal of. 11, 1703-1714 (1996).</li><li>Kupcova Skalnikova, ., H, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+techniques+for+characterisation+of+mesenchymal+stem+cell+secretome.">Proteomic techniques for characterisation of mesenchymal stem cell secretome.</a> Biochimie. , (2013).</li><li>Romanello, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osteoblastic+cell+secretome:+A+novel+role+for+progranulin+during+risedronate+treatment.">Osteoblastic cell secretome: A novel role for progranulin during risedronate treatment.</a> , (2013).</li><li>Schuldt Filho, ., G, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conditioned+medium+of+demineralized+bone+matrix+activates+TGF-&#946;+signaling+pathways+in+mesenchymal+cells+in+vitro.">Conditioned medium of demineralized bone matrix activates TGF-&#946; signaling pathways in mesenchymal cells in vitro.</a> J Cranio Maxill Surg. , (2015).</li><li>Buser, D., Chen, S. T., Weber, H. P., Belser, U. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+implant+placement+following+single-tooth+extraction+in+the+esthetic+zone:+biologic+rationale+and+surgical+procedures).">Early implant placement following single-tooth extraction in the esthetic zone: biologic rationale and surgical procedures).</a> The International journal of periodontics &amp; restorative dentistry. 28, 441-451 (2008).</li><li>Stoecklin-Wasmer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absorbable+collagen+membranes+for+periodontal+regeneration:+a+systematic+review.">Absorbable collagen membranes for periodontal regeneration: a systematic review.</a> Journal of dental research. 92, 773-781 (2013).</li></ol>

저자가 공개하는 게 없다. 조르디 Caballé - 세라노는 치과 연구 및 교육, 바젤, 스위스의 재단에서 장학금을 받았다.

뼈 에어컨 매체는 골 재생의 초기 단계 동안 뼈 이식의 공개 활동을 반영한다. 여기에 설명 된 프로토콜이 골 재생에 관여하는 세포의 다른 유형의 반응을 연구하기 위해 적응 될 수있다. 또한, 프로토콜 처리 된 뼈 또는 뼈 충전제로부터의 조건화 배지를 제조 할 수있다. 다양한 네이티브 및 처리 뼈에서 방출 요인 : 방법을 수행하고 간단한 개념에 의존하기 쉽다. 방법 BCM을 이해하는 것은 중간 엽 세포가 이식 통합 및 골자가 이식의 속성에 대한 자세한 내용을 보려면하는 데 도움이 될 수 있습니다에 영향을줍니다. 우리는 또한 세 가지 주요 계통으로 증식, 이동 및 분화에, 중간 엽 세포의 유전자 발현에 네이티브 11, 15 및 14, 20에서 처리 된 뼈 수득 BCM의 영향에 대한 지식을 축적이 개념에 근거; 조골 세포, 지방 세포와 연골 세포 (11). BCM 또한 TA에 용량을 조사 하였다파골 세포 (13)의 변조에 대해, 예를 들어 조혈 세포를 rget. 많은 잠재적 표적 세포는 체외에서 BCM에 응답을 기다리고 있습니다, 여기에 제시된 프로토콜은이 연구를위한 입문서 역할을 할 수 있습니다. 제시된 프로토콜은 또한 더 BCM은 중간 엽 세포에서 특히 TGF-β 조절 유전자를 활성화하는 분자 메커니즘을 나타 내기 위해 애니메이션을한다. 예를 들어, 내가 SB431542을 길항제 TGF-β 수용체 유전자 패널 ADM의 발현에 BCM의 효과를 차단, IL-11, NOX4, PRG4 및 PTX3 11, 15. 흥미롭게도, 알칼리 포스 파타 아제 및 IL33 다른 아직 알 수없는 경로는 BCM에 의해 규제되는 제안 SB431542 11, 15로 역전되지 않았다. 또 다른 의문은 BCM의 분자가 세포 반응에 대한 책임있는 무엇입니까? BCM은 TGF-β가 포함되어 있지만, 복잡한 세포 반응 (10, 11)을 설명하지 않습니다이다. 에 게다가셀룰러 측면을 시험관, 전체 문제는 남아있다 : 어느로 골 재생의 생체 과정에 영향을 미칠, BCM에 의해 반영 뼈 이식의 공개 활동을 수행 확장? 생물 검정에서 프로토콜과 데이터는이 방향에서 연구를 소개한다. 이 프로토콜은 한계가있다. BCM은 완전히 때문에 기증자 및 수확 기술 사이의 변화의 표준화 할 수 없습니다. 또한, 생체에 존재하는 효소 조성물 또는 BCM의 활동에 영향을 미칠 수있는 방법을 알 수없는 남아있다. 앞으로의 연구는 예를 들면, 수확 기술의 BCM &quot;생물학적 활성&quot;에 미치는 영향에 집중한다. BCM의 조성에 골 세포의 역할은 또한 구체적으로 연구되어야한다. BCM은 sclerostin, 골 세포 (12)에 의해 거의 독점적으로 발표 한 분자가 포함되어 있습니다. 제한하지만, 연구의 다음 단계에 대한 영감을 제공합니다. 심지어 BCM과 연구의 임상 적 관련성은 HY 유지하지만pothetical, 우리의 프로토콜은 뼈 이식은, 네이티브 또는 가공 후 하나가, &quot;생물학적 활성&quot;을 출시하는 오랜 개념을 지원합니다. 체외에서 세포에 영향을 미칠 BCM 방법을 이해하는 것은 아마도 골자가 이식은 생체 내에서 작동하는 방법을 이해하는 데 도움이 될 수 있습니다.

자가 뼈 널리 기형의 결과, resective 수술, 재건 외상 수술, 이전 임플란트 식립 1, 2에로 발생한 결함을 연결하는 데 사용됩니다. 뼈 이식은 이식 통합의 과정을 지원하는 방법의 생물학적 원리를 이해하는 것은자가 이식이 재건 수술의 황금 표준으로 간주하는 이유를 이해하기 만 키가 아닌, 그것은 또한 뼈 대체 (3)의 개선 된 디자인에 생체 공학입니다. 그러나 이식 통합은 빠른자가 뼈와 뼈가 4,5 대체 비교된다. 따라서, 골 재생을 지원하기 때문에 효과적인 자가골을 분자 세포 메커니즘을 나타 내기 위해 필수적이다. 통합 프로세스의 6,7을 지원하는 것으로 간주되는자가 이식의 세 교과서의 특성이 있습니다. 첫째,자가 뼈가 성장하는 새로 형성된 뼈에 대한 지침을 제공, osteoconductive입니다결함에. 둘째,자가 뼈는 조골 세포 (8)로 분화 할 수 중간 엽 세포를 포함 즉, 골 형성이다. 매트릭스 내에 안치 뼈 형태 형성 단백질 유사 성장 인자 연골 또는 골 형성 intramembranous (9)의 처리를 개시 할 수있다 셋째, 자가골은 골 유도된다. 또 다른 측면이있다 : 갓 준비 뼈 칩은 &quot;뼈 에어컨 매체&quot;10 ~ 15과 체외 관찰을 기반으로 분비 기능을 유지. 또한 myelopoiesis의 영향은 16를 언급한다. &quot;탈회 골 기질 - 조정 배지&quot;A와 유사한 용어는 이미 탈회 (17)에 의해 처리 된 경우에도, 1996 년 낸 뼈의 분비 기능의 전체적인 개념을 지원 하였다. 우리의 목적을 위해, BCM은 10,11 하악골 신선한 돼지로부터 제조 될 수있다. BCM의 프로테옴 분석은 성장의 사실을 포함하여, 복잡한 구성을 밝혀ORS과 세포 외 기질 (10)의 성분은, 또한 전체의 뼈 18,19 테아의 기존 기술을 연장. 따라서, BCM은 시험관 내에서 뼈 이식의 다양한 변형의 공개 활동을 반영해야한다. 중간 엽 세포는, 예를 들어 뼈 칩 또는 구두 부드러운 조직에서 분리 된 사람들을 위해, BCM 수 있나요? 체외 노출되었을 때 어떻게됩니까, BCM은 골 형성과 지방 세포 분화를 감소시키고, IL11 식 (11)의 강한 증가를 불러 일으킨다. 게놈 넓은 마이크로 어레이는 차등 BCM에 대한 응답으로 중간 엽 세포에서 발현되는 많은 유전자를 한 것으로 밝혀졌습니다. 이들 유전자 중 adrenomedullin (ADM)이며, IL11, IL33, NADPH 산화 효소 4 (NOX4), 프로테오글리칸 4 (PRG4, 또는 lubricin) 및 3 (PTX3) 15 pentraxin. 멸균 뼈 칩으로부터 얻어진 BCM은 각각 14 유전자의 발현을 변경하지 못한 경우. 저온 살균을 시행하고 동결 뼈 칩에서 BCM은 할 수 있었다유전자 발현 (14)을 변경합니다. 탈회 골 기질 (DBM-CM)의 또한 에어컨 매체는 TGF-β 조절 유전자 (20)의 표현을 변경합니다. 흥미롭게도, 주위의 부드러운 조직 뼈 (21, 22)로부터 칩을 보호하는 데 콜라겐 배리어 막은, 유전자 발현의 변화 (23)에 대한 책임 BCM의 그 부분을 흡착. BCM 연구는 몇 가지 이름을, 같은 뼈 재 흡수 파골 세포와 내피 세포로 골 재생에 관여하는 다른 세포 유형으로 확장 할 수 있습니다. 전반적으로, 축적 체외 데이터는 임상 연구의 설계를위한 과학적 근거를 제공한다. 본 프로토콜은 두 가지입니다 : 첫째, BCM을 준비하는 방법을 보여줍니다. 둘째, 체외에서 중간 엽 세포를 기반으로 생물학적 활성을 테스트하는 방법을 보여줍니다.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Pig Mandibles</td>
			<td>Local bucher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bone Scraper</td>
			<td>Hu-Friedy</td>
			<td>PPBUSE2/36</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibiotics &#38; Antimicotics</td>
			<td>All life Technologies</td>
			<td>15240-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagen Membranes (Bio-Gide)</td>
			<td>Geistlich</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Calf Serum</td>
			<td>Invitrogen Corporation</td>
			<td align="right">16030074</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Invitrogen Corporation</td>
			<td>21885-025</td>
			<td></td>
		</tr>
		<tr>
			<td> 
			High Pure RNA Isolation Kit</td>
			<td>Roche</td>
			<td align="right">11828665001</td>
			<td></td>
		</tr>
		<tr>
			<td>Transcriptor First Strand cDNA Synthesis Kit</td>
			<td>Roche</td>
			<td align="right">4379012001</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td>Microsynth</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green (for Q-RT-PCR)</td>
			<td>Roche</td>
			<td align="right">4673484001</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Roche</td>
			<td align="right">11666789001</td>
			<td></td>
		</tr>
	</tbody>
</table>

bone conditioned medium: preparation and bioassay

자가 뼈 이식 널리 구강 악안면 외과, 정형 외과 및 외상에 사용됩니다. 자가 뼈 이식은 누락 된 뼈를 대체하지, 그들은 또한 골 재생의 복잡한 과정을 지원합니다. 자가 이식이 유리한 동작은 세 가지 특징에 기인한다 : osteoconductivity, osteogenicity 및 osteoinductivity을. 그러나, 다른 측면이있다 : 뼈 골 재생에 관련된 중간 엽 세포를 대상으로 할 수 성장 인자를 포함하여 분자의 무수 해제 접목. 골 이식의 분비 속성은 뼈 에어컨 매체 (BCM)를 사용하여 시험 관내에서 공부하실 수 있습니다. 여기에서 우리는 열 처리 또는 탈회를 시행 기본 돼지 피질 뼈에서 뼈 에어컨 매체를 준비하는 방법에 대한 프로토콜 및 뼈를 제시한다. 세포는 직접 BCM에 노출 또는 콜라겐 멤브레인, 이전 BCM 적신 같은 생체 재료,에 접종 할 수있다. 우리는 체외 bioassa에 대한 예를들TGF-β 조절 유전자의 발현에 중간 엽 세포와 YS. 제시된 프로토콜은 추가 골 재생시 뼈 이식의 분비 효과를 밝혀 및 재건 수술의 폭 넓은 분야의 중개 연구에 대한 경로를 엽니 다 장려해야한다.

뼈 조정 배지를 신선한 돼지 뼈 칩으로부터 제조된다. 공정의 일반 개요 BCM을 준비하고 BCM 생체 물질과 조합을 사용은도 1 및도 2에 각각 도시되어있다. BCM 준비 동안, 최종 BCM의 품질에 영향을 미칠 수있는 짧은 움직임 또는 매우 작은 뼈 칩만큼 움직임 큰 뼈 칩을 얻는 것이 중요하다. ADM, PTX3, IL11, IL33, NOX4 및 PRG4 (도 3) : BCM의 품질 BCM 타겟 유전자의 유전자 발현을 분석하여 제어 될 수있다. ADM과 PTX3 0.4 배 아래로 아래로 조절하고 200 배에 규제까지-IL11, IL33, NOX4 및 PRG4이 될 수 있습니다. 구강 섬유 아세포 표시된 수준에서 BCM의 표적 유전자를 발현하지 않는 경우, 세포의 상태를 확인하거나 새로운 턱에서 새로운 BCM을 준비합니다. 콜라겐 장벽 막에 시드 구강 섬유 아세포에서 BCM 대상 유전자의 발현에서 4 표시에게 전형적인 결과를 그림. 구강 섬유 아세포 살균 뼈 칩에서 조정 배지 및 탈회 골 칩에서 조정 배지의 20 %를 자극, BCM (표 2 및 표 3)로 자극 세포에 유사한 유전자 발현을 나타냈다. 그러나, 경구 아세포의 유전자 발현이 멸균 (121 ° C)에서 뼈 칩 조정 배지에 노출되지 않은 자극 제어에 필적 하였다. <img alt="그림 1" src="/files/ftp_upload/52707/52707fig1.jpg" /> 그림 1. 신선한 돼지 턱에서 뼈 에어컨 매체를 제조하는 데 사용되는 프로세스의 개요. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52707/52707fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52707/52707fig2.jpg" /> 그림 2. 요약BCM와 중간 엽 세포를 기반으로 생물 검정의. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52707/52707fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52707/52707fig3.jpg" /> 경구 섬유 아세포에서 뼈 조정 배지 표적 유전자의 3 유전자 발현을 도표. BCM. 유전자의 ADM과 PTX3의 품질을 제어하는 데 사용 여섯 유전자의 전형적인 결과를 하향 조절된다 (A)와 IL11는, IL33, NOX4, PRG4는 (B)를 상향 조절된다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52707/52707fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/52707/52707fig4.jpg" /> 그림 4. 뼈 conditione의 유전자 발현콜라겐 배리어 막 상에 시드 경구 아세포에서 D 중간 표적 유전자. BCM의 품질을 제어하는 데 사용 여섯 유전자의 전형적인 결과. 유전자의 ADM과 PTX3는 하향 조절된다 (A)와 IL11, NOX4, PRG4는 (B)를 상향 조절된다. 사용 된 생체 재료에 따라, 성장 인자의 흡수는 다를 수있다. 콜라겐 멤브레인 따라서 IL33 발현이 설정에 규정되지 않은 IL33 발현을 제어하는 요인을 흡수하는 데 실패했습니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52707/52707fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" cellpadding="0" cellspacing="0"><colgroup><col span="3" /></colgroup><tbody><tr><td> 약어 </td><td> 프라이머 앞으로 </td><td> 프라이머 역 </td></tr><tr><td> GAPDH </td><td> AGCCACATCGCTCAGACAC </td><td> GCCCAATACGACCAAATCC </td></tr><tr><td> ADM </td><td> GGACATGAAGGGTGCCTCTC </td><td> TGTTCATGCTCTGGCGGTAG </td></tr><tr><td> IL11 </td><td> TGCACCTGACACTTGACTGG </td><td> AGTCTTCAGCAGCAGCAGTC </td></tr><tr><td> IL33 </td><td> TCAGGTGACGGTGTTGATGG </td><td> GGAGCTCCACAGAGTGTTCC </td></tr><tr><td> NOX4 </td><td> TCTTGGCTTACCTCCGAGGA </td><td> CTCCTGGTTCTCCTGCTTGG </td></tr><tr><td> PRG4 </td><td> CGACGCCCAATGTAAGAAGT </td><td> GGTGATGTGGGATTATGCACT </td></tr><tr><td> PTX3 </td><td> TGTATGTGAATTTGGACAACGAA </td><td> CATTCCGAGTGCTCCTGAC </td></tr></tbody></table> 표 1 : 사용 (6) 유전자의 프라이머 순서. <table border="0" cellpadding="0" cellspacing="0"><colgroup><col span="3" /></colgroup><tbody><tr><td> 유전자 </td><td> 80 ° C 평균 ± 표준 편차 </td><td> 121 ° C 평균 ± 표준 편차 </td></tr><tr><td> ADM </td><td> 0.2 ± 0.1 </td><td> 1.1 ± 0.2 </td></tr><tr><td> PTX3 </td><td> 0.1 ± 0.1 </td><td> 0.9 ± 0.2 </td></tr><tr><td> IL11 </td><td> 20 ± 10 </td><td> 1.5 ± 1 </td></tr><tr><td> IL33 </td><td> 15 ± 5 </td><td> 1.2 ± 4 </td></tr><tr><td> NOX4 </td><td> 35 ± 15 </td><td> 2 ± 1 </td></tr><tr><td> PRG4 </td><td> 40 ± 10 </td><td> 1.8 ± 1 </td></tr></tbody></table> 표 2 : ADM, PTX3, IL11, IL33, 열처리 뼈 칩에서 조정 배지의 20 %를 자극 경구 섬유 아세포 및 NOX4 PRG4 일반적인 유전자 발현. <table border="1" cellpadding="0" cellspacing="0"><tbody><tr><td> 유전자 </td><td> ± 표준 편차 평균 </td></tr><tr><td> ADM </td><td> 0.1 ± 0.1 </td></tr><tr><td> PTX3 </td><tD&gt; 0.1 ± 0.1 </td></tr><tr><td> IL11 </td><td> 15 ± 5 </td></tr><tr><td> IL33 </td><td> 20 ± 10 </td></tr><tr><td> NOX4 </td><td> 60 ± 15 </td></tr><tr><td> PRG4 </td><td> 50 ± 20 </td></tr></tbody></table> 표 3 : ADM, PTX3, IL11, IL33, 탈회 골 칩에서 조정 배지의 20 %로 자극 구강 섬유 아세포에서 NOX4과 PRG4의 전형적인 유전자 발현.

Watch this Scientific Journal Video about Bone Conditioned Medium: Preparation and Bioassay at JoVE.com

Bone Conditioned Medium: Preparation and Bioassay

우리는 뼈 에어컨 매체 (BCM)을 준비하고 시험 관내에서 활동을 테스트하는 방법을 여기에 대해 설명합니다.

뼈 조정 배지 : 준비 및 생물 검정

Autologous bone grafts are widely used in oral and maxillofacial surgery, orthopedics, and traumatology. Autologous bone grafts not only replace missing ...

bone-conditioned-medium-preparation-and-bioassay

Universidad San Sebastian

Research

JoVE Journal

Biology

11.0K 조회수.  School of Dental Medicine, University of Bern.  우리는 뼈 에어컨 매체 (BCM)을 준비하고 시험 관내에서 활동을 테스트하는 방법을 여기에 대해 설명합니다. 

비디오: Bone Conditioned Medium: Preparation and Bioassay

Maintaining Wolbachia in Cell-free Medium

In this video protocol, procedures are demonstrated to (1) purify Wolbachia symbionts out of cultured mosquito cells, (2) use a fluorescent assay to ascertain the viability of the purified Wolbachia and (3) maintain the now extracellular Wolbachia in cell-free medium.  Purified Wolbachia remain alive in the extracellular phase but do not replicate until re-inoculated into eukaryotic cells.  Extracellular Wolbachia purified in this manner will remain viable for at least a week at room temperature, and possibly longer.  Purified Wolbachia are suitable for micro-injection, DNA extraction and other applications. 


This video describes a method for purifying Wolbachia pipientis from an Anopheles gambiae cell line and then culturing the endosymbiont in cell-free medium. An assay for viability of the bacterium is demonstrated.

셀없는 매체 Wolbachia을 유지

In this video protocol, procedures are demonstrated to (1) purify Wolbachia symbionts out of cultured mosquito cells, (2) use a fluorescent assay to ...

연구

생물학

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Electroporation에 대한 Murine 골수에서 조혈 세포 차 문화의 준비

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Human In-Vivo Bioassay for the Tissue-Specific Measurement of Nociceptive and Inflammatory Mediators

This in-vivo human bioassay can be used to study human volunteers and patients. Samples are collected from pertinent tissue sites such as the skin via aseptically inserted microdialysis catheters (Dermal Dialysis, Erlangen, Germany). Illustrated in this example is the collection of interstitial fluid from experimentally inflamed skin in human volunteers. Sample collection can be combined with other experimental tests. For example, the simultaneous assessment of locally released biochemicals and subjective sensitivity to painful stimuli in experimentally inflamed skin provides the critical biochemical-behavioral link to identify biomarkers of pain and inflammation. Presented assay in the living human organism allows for mechanistic insight into tissue-specific processes underlying pain and/or inflammation. The method is also well suited to examine the effectiveness of existing or novel interventions - such as new drug candidates - targeting the treatment of painful and/or inflammatory conditions.
This article will provide a detailed description on the use of microdialysis techniques for collecting interstitial fluid from experimentally inflamed skin lesion of human study subjects. Interstitial fluid samples are typically processed with aid of multiplex bead array immunoassays allowing assaying up to 100 analytes in samples as small in volume as 50 microliters.


A technique is presented for the in-vivo collection of interstitial fluid samples from pertinent tissue sites (here, experimentally inflamed skin) for the measurement of biochemicals mediating pain and inflammation.

Nociceptive 및 염증성 중재자의 조직 특정 측정을위한 인간 - VIVO의 Bioassay

This in-vivo human bioassay can be used to study human volunteers and patients. Samples are collected from pertinent tissue sites such as the skin via ...

Undecalcified Bone Preparation for Histology, Histomorphometry and Fluorochrome Analysis

Undecalcified bone histology demonstrates the micro-architecture of bone. It shows both the mineralised and cellular components of bone, which provides vital information on bone turnover or bone formation and resorption. This has tremendous importance in a variety of clinical and research applications. It yields beautiful images1 and allows for techniques such as fluorochrome assessment and histomorphometry2. Fluorochrome analysis is a technique where fluorescent dyes that bind to calcium are injected at a particular time point, which allows for quantification of the amount of mineralisation at that given time. Histomorphometry is a process of bone quantification at the microscopic level. 
Performing undecalcified bone histology is technically challenging, particularly with large size specimens. It requires variations in technique from those used in standard paraffin embedded histology. This video illustrates the process of producing good quality sections and demonstrates the technical difficulties and methods with which to overcome them. Specimen preparation, fixation and processing are achieved with a manner similar to other soft tissues, however due to the density and lower permeability of bone considerably longer fixation and processing times are required, often taking several weeks. Embedding is achieved using a supporting medium with similar or equal hardness and density to the bone such as methacrylate- based resins, but unlike paraffin infiltration and embedding, this is an irreversible step. Sectioning can be achieved by grinding which produces a thicker section, which is optimal for studies such as fluorochrome analysis. This is best achieved using a diamond blade on a macrotome. Alternatively, thinner sections can be produced for light microscopy and this is achieved using a sledge microtome with a very sharp blade. The sledge microtome provides the additional strength and stability required for large, hard blocks. Resin embedded sections can be stained with a variety of stains, which are demonstrated.

Undecalcified bone histology provides important information for a variety of clinical and research applications. It is technically challenging, particularly with large size specimens. This video illustrates the process of producing good quality sections and demonstrates the technical difficulties and methods with which to overcome them.

조직학, 조직 형태 측정 및 분석을위한 Fluorochrome Undecalcified 본 준비

Undecalcified bone histology demonstrates the micro-architecture of bone. It shows both the mineralised and cellular components of bone, which provides ...

Cryopreserving and Recovering of Human iPS Cells using Complete KnockOut Serum Replacement Feeder-Free Medium

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem cells has created a valuable new source of pluripotent cells for drug discovery, cell therapy, and basic research.
GIBCO media and reagents have been at the forefront of pluripotent stem cell research for years. Knockout DMEM supplemented with Knockout Serum Replacement is the media of choice for embryonic stem cell growth and now iPS cell culture 3-9. This gold standard media system can now be used for feeder-free culture with the addition of Knockout SR Growth Factor Cocktail.
Traditional human ES and iPS cell culture methods require the use of mouse or human fibroblast feeder layers, or feeder-conditioned medium. These culture methods are labor-intensive, hard to scale and it is difficult to maintain hiPS cells undifferentiated due to the undefined conditions. Invitrogen has developed Knockout SR Growth Factor Cocktail to allow you to easily transition your hiPS and hES cell cultures to feeder-free while still maintaining your use of Knockout SR.

This protocol describes the detailed procedure for cryopreserving human iPS cells in KnockOut SR cryopreservation medium and recovering these cells in complete KnockOut SR Feeder Free (KSR-FF) medium or feeder-based KnockOut SR medium.

Cryopreserving와 인간 IPS 세포 복구 완료 마네에게 세럼 교체 피더 - 무료 매체를 사용하여

The discovery in 2006 that human and mouse fibroblasts could be reprogrammed to generate iPS cells 1-3 with qualities remarkably similar to embryonic stem ...

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of plant leaves or vertebrate lungs further difficulties arise from multiple transitions in refractive index between cellular components, between cells and airspaces and between the biological tissue and the rest of the optical system. Moreover, refractive index mismatches lead to attenuation of fluorophore excitation and signal emission in fluorescence microscopy. We describe here the application of the perfluorocarbon, perfluorodecalin (PFD), as an infiltrative imaging medium which optically improves laser scanning confocal microscopy (LSCM) sample imaging at depth, without resorting to damaging increases in laser power and has minimal physiological impact2. We describe the protocol for use of PFD with Arabidopsis thaliana leaf tissue, which is optically complex as a result of its structure (Figure 1). PFD has a number of attributes that make it suitable for this use3. The refractive index of PFD (1.313) is comparable with that of water (1.333) and is closer to that of cytosol (approx. 1.4) than air (1.000). In addition, PFD is readily available, non-fluorescent and is non-toxic. The low surface tension of PFD (19 dynes cm-1) is lower than that of water (72 dynes cm-1) and also below the limit (25 - 30 dyne cm-1) for stomatal penetration4, which allows it to flood the spongy mesophyll airspaces without the application of a potentially destructive vacuum or surfactant. Finally and crucially, PFD has a great capacity for dissolving CO2 and O2, which allows gas exchange to be maintained in the flooded tissue, thus minimizing the physiological impact on the sample. These properties have been used in various applications which include partial liquid breathing and lung inflation5,6, surgery7, artificial blood8, oxygenation of growth media9, and studies of ice crystal formation in plants10. Currently, it is common to mount tissue in water or aqueous buffer for live confocal imaging. We consider that the use of PFD as a mounting medium represents an improvement on existing practice and allows the simple preparation of live whole leaf samples for imaging.

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

We describe the use of perfluorodecalin as an infiltrative mounting medium. This is a simple method for improving depth of imaging in Arabidopsis thaliana leaf tissue with minimal physiological impact.

이미징을위한 간단한 방법 Arabidopsis는 Infiltrative 영상 매체로 Perfluorodecalin를 사용하여 잎

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of ...

Osteoclast Derivation from Mouse Bone Marrow

Osteoclasts are highly specialized cells that are derived from the monocyte/macrophage lineage of the bone marrow. Their unique ability to resorb both the organic and inorganic matrices of bone means that they play a key role in regulating skeletal remodeling. Together, osteoblasts and osteoclasts are responsible for the dynamic coupling process that involves both bone resorption and bone formation acting together to maintain the normal skeleton during health and disease.
As the principal bone-resorbing cell in the body, changes in osteoclast differentiation or function can result in profound effects in the body. Diseases associated with altered osteoclast function can range in severity from lethal neonatal disease due to failure to form a marrow space for hematopoiesis, to more commonly observed pathologies such as osteoporosis, in which excessive osteoclastic bone resorption predisposes to fracture formation.
An ability to isolate osteoclasts in high numbers in vitro has allowed for significant advances in the understanding of the bone remodeling cycle and has paved the way for the discovery of novel therapeutic strategies that combat these diseases. 
Here, we describe a protocol to isolate and cultivate osteoclasts from mouse bone marrow that will yield large numbers of osteoclasts.

Osteoclasts are the principal bone-resorbing cell in the body. An ability to isolate osteoclasts in large numbers has resulted in significant advances in the understanding of osteoclast biology. In this protocol, we describe a method for isolation, cultivating and quantifying osteoclast activity in vitro.

마우스 골수에서 파골 세포의 유도

Osteoclasts are highly specialized cells that are derived from the monocyte/macrophage lineage of the bone marrow. Their unique ability to resorb both the ...

Flow Cytometric Analysis of Extracellular Vesicles from Cell-conditioned Media

Flow cytometry (FC) is the method of choice for semi-quantitative measurement of cell-surface antigen markers. Recently, this technique has been used for phenotypic analyses of extracellular vesicles (EV) including exosomes (Exo) in the peripheral blood and other body fluids. The small size of EV mandates the use of dedicated instruments having a detection threshold around 50-100 nm. Alternatively, EV can be bound to latex microbeads that can be detected by FC. Microbeads, conjugated with antibodies that recognize EV-associated markers/Cluster of Differentiation CD63, CD9, and CD81 can be used for EV capture. Exo isolated from CM can be analyzed with or without pre-enrichment by ultracentrifugation. This approach is suitable for EV analyses using conventional FC instruments. Our results demonstrate a linear correlation between Mean Fluorescence Intensity (MFI) values and EV concentration. Disrupting EV through sonication dramatically decreased MFI, indicating that the method does not detect membrane debris. We report an accurate and reliable method for the analysis of EV surface antigens, which can be easily implemented in any laboratory.

The protocol describes a reproducible method designed for use with cell culture supernatants to detect surface epitopes on small extracellular vesicles (EV). It utilizes specific EV immunoprecipitation using beads coupled with antibodies that recognize surface antigen CD9, CD63, and CD81. The method is optimized for downstream flow cytometry analysis.

Extracellular 소포 세포 조절 미디어에서의 Cytometric 분석 흐름

Flow cytometry (FC) is the method of choice for semi-quantitative measurement of cell-surface antigen markers. Recently, this technique has been used for ...

Tissue Collection and RNA Extraction from the Human Osteoarthritic Knee Joint

Osteoarthritis (OA) is a chronic and degenerative joint disease most often affecting the knee. As there is currently no cure, total knee arthroplasty (TKA) is a common surgical intervention. Experiments using primary human OA tissues obtained from TKA provide the capability to investigate disease mechanisms ex vivo. While OA was previously thought to impact mainly the cartilage, it is now known to impact multiple tissues in the joint. This protocol describes patient selection, sample processing, tissue homogenization, RNA extraction, and quality control (based on RNA purity, integrity, and yield) from each of seven unique tissues to support disease mechanism investigation in the knee joint. With informed consent, samples were obtained from patients undergoing TKA for OA. Tissues were dissected, washed, and stored within 4 h of surgery by flash freezing for RNA or formalin fixation for histology. Collected tissues included articular cartilage, subchondral bone, meniscus, infrapatellar fat pad, anterior cruciate ligament, synovium, and vastus medialis oblique muscle. RNA extraction protocols were tested for each tissue type. The most significant modification involved the method of disintegration used for low-cell, high-matrix, hard tissues (considered as cartilage, bone, and meniscus) versus relatively high-cell, low-matrix, soft tissues (considered as fat pad, ligament, synovium, and muscle). It was found that pulverization was appropriate for hard tissues, and homogenization was appropriate for soft tissues. A proclivity for some subjects to yield higher RNA integrity number (RIN) values than other subjects consistently across multiple tissues was observed, suggesting that underlying factors such as disease severity may impact RNA quality. The ability to isolate high-quality RNA from primary human OA tissues provides a physiologically relevant model for sophisticated gene expression experiments, including sequencing, that can lead to clinical insights that are more readily translated to patients.

Primary tissues obtained from patients following total knee arthroplasty provide an experimental model for osteoarthritis research with maximal clinical translatability. This protocol describes how to identify, process, and isolate RNA from seven unique knee tissues to support mechanistic investigation in human osteoarthritis.

인간 골관절염 무릎 관절에서 조직 수집 및 RNA 추출

Osteoarthritis (OA) is a chronic and degenerative joint disease most often affecting the knee. As there is currently no cure, total knee arthroplasty ...

Using Real-Time Cell Metabolic Flux Analyzer to Monitor Osteoblast Bioenergetics

Bone formation by osteoblasts is an essential process for proper bone acquisition and bone turnover to maintain skeletal homeostasis, and ultimately, prevent fracture. In the interest to both optimize peak bone mass and combat various musculoskeletal diseases (i.e., post-menopausal osteoporosis, anorexia nervosa, type 1 and 2 diabetes mellitus), incredible efforts have been made in the field of bone biology to fully characterize osteoblasts throughout their differentiation process. Given the primary role of mature osteoblasts to secrete matrix proteins and mineralization vesicles, it has been noted that these processes take an incredible amount of cellular energy, or adenosine triphosphate (ATP). The overall cellular energy status is often referred to as cellular bioenergetics, and it includes a series of metabolic reactions that sense substrate availability to derive ATP to meet cellular needs. Therefore, the current method details the process of isolating primary, murine bone marrow stromal cells (BMSCs) and monitoring their bioenergetic status using the Real-time cell metabolic flux analyzer at various stages in osteoblast differentiation. Importantly, these data have demonstrated that the metabolic profile changes dramatically throughout osteoblast differentiation. Thus, using this physiologically relevant cell type is required to fully appreciate how a cell's bioenergetic status can regulate the overall function.

Real-time cell metabolic flux assay measures the oxygen consumption rate and extracellular acidification rate, which corresponds to mitochondrial and glycolytic adenosine triphosphate production, using pH and oxygen sensors. The manuscript explains a method to understand the energy status of osteoblasts and the characterization and interpretation of the cellular bioenergetic status.

Bone formation by osteoblasts is an essential process for proper bone acquisition and bone turnover to maintain skeletal homeostasis, and ultimately, ...