We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

우리의 프로토콜은하고 아프리카 발톱 개구리의 배아에서 게놈 전체 염색질 프로파일을 분석하는 방법에 대해 설명합니다. 그것은 실리에 풍부한 게놈 사이트를 나타내는 읽기의 수백만을 처리하는 생체 내에서 내인성 유전자 좌에 가교 단백질에서 모든 단계를 다루고 있습니다. 게놈 초안의 증가 번호를 사용할 수 있기 때문에,이 프로토콜은 다른 모델과 비 모델 생물에 적용해야합니다. 이전의 연구 8,31,33,34에서 떨어져이 프로토콜을 설정하는 가장 중요한 실험 부분은, 가교 핵을 추출 후 고정 절차입니다. 그것은 효율적인 염색질 용해 화 및 전단 쉽게 업 스케일링을 용이하게한다. 함께 도서관 준비의 개선 된 효율성이 프로토콜은 반에서 관심있는 염색질 관련 항원을 발현하는 이백만 세포에 높은 복잡성 칩-SEQ 도서관의 건축을 할 수 있습니다. 칩 qPCR의 실험의 경우, 이들 세포의 몇 만 정상적으로 충분아마도 여섯 별개의 게놈 유전자 좌에서 DNA 농축을 확인합니다. 이러한 숫자는 보수적이지만, 단백질 발현 수준, 항체의 품질에 따라 효율, 에피토프의 접근성을 가교 달라질 수있다. 가이드로, 단일 Xenopus의 배아 중반 포배 단계 (Nieuwkoop 및 페이버 (29) 후 8.5)에서 약 4,000 세포를 포함, 후반 낭배 단계 (12)에서 40,000 세포와 초기 tailbud 단계 (20)에서 10 만 셀. 효율적인 면역에 대한 정확한 고정 시간은 칩 qPCR에 (10 항)에 의해 경험적으로 결정해야합니다. 실험이 X를 포함하는 경우 일반적으로 더 이상 고정 시간이 필요합니다 배아, 초기 발달 단계, 약한 (또는 간접) DNA 결합 특성을 laevis의. 그러나, 염색질 전단 효율성이 떨어질대로, 40 분보다 긴 아프리카 발톱 개구리 배아를 고정, 또는 표시 (섹션 3)보다 더 많은 배아를 처리하지 않는 것이 좋습니다. 그것은 중요하지매우 어려운 노른자 풍부한 배아에서 핵 추출을 할 수 포름 알데히드를 담금질이 일반적인 단계로 고정 후 어떤 글리신를 사용합니다. 현재, 그 이유는 알려져 있지 않다. 또한 포름 알데히드 부가 물 상기 글리신 아미노 기 또는 아르기닌 잔기 35 N 말단과 반응하여 생각할 수있다. 항체는 칩 실험의 핵심입니다 충분한 컨트롤 (Landt 등. (36) 가이드 라인을 참조) 관심의 항원에 대한 특이성을 보여주기 위해 수행 될 필요가있다. 더 칩 등급 항체가없는 경우이 단백질이 차지하는 결합 부위 내인성 수 37, 에피토프 태그 융합 단백질 대응 소개 합법적 대안이 될 수있다. 이 경우, uninjected 배아는 음성 대조군보다는 비특이적 혈 칩으로 사용하는 것이 최선이다. 관심의 단백질이 enri의 가난한 복구의 결과로 낮은 수준에서 표현되는 경우,이 전략은 적용 할 수있다CHED DNA. 왜냐하면 사용중인 DNA의 소량 칩-SEQ 라이브러리 제조용으로서,이 세정 공정 수를 줄이고 최소한 DNA의 손실을 유지하는 반응을 조합하는 방법을 선택하는 것을 권장한다. 어댑터와 프라이머 (특정 재료 / 장비의 표 참조) 멀티 플렉스 시퀀싱 및 NGS 플랫폼과 호환 될 수 있도록해야합니다. (긴 단일 가닥 무기를 포함) Y-어댑터를 사용하는 경우, 그것은 크기 선택 DNA 삽입하기 전에 PCR의 3-5 라운드 사전 증폭 라이브러리에 중요하다 (예., 100 내지 300 bp) 겔 전기 영동에 의해. 단일 가닥 말단 DNA 단편이 균질하게 이동. 시험은 PCR 사이클의 총 수를 결정하도록 권장 입력 DNA (예를 들면, 0.1, 0.5, 1, 2, 5, 10, 20 NG)의 다양한 양으로 실행 (이하 또는 18 사이클 같음) 크기를 만드는 데 필요한 100-200 NG의 - 선정 된 라이브러리입니다. PCR 사이클의 수를 줄이면 redu의 시퀀싱을 렌더링ndant은 덜 읽습니다. 고상 가역적 고정화 비즈 효율적으로 관심있는 DNA를 복구하고 안정적​​으로 결찰 및 PCR 반응이없는 임의의 어댑터 및 이량 체를 제거하는 시약을 정리 좋다. 수, 유형 및 길이의 측면에서 약 20-30000000 단일 엔드 36 bp의 충분한 깊이와 전체 Xenopus의 게놈을 커버하는 대부분의 칩 서열 번호 실험에 충분하다의 읽기, 읽기의. 가장 널리 NGS 기계는 이러한 기준을 충족 일상적으로 할 수있다. 그러나, 판독의 광범위한 분포가 예상되는 경우의 판독 샤프한 피크보다 오히려, 히스톤 변형 관찰로, 수를 늘리는 것이 유리할 수있다. 다수의 칩 - 서열 번호 실험을 위해, 4-5 다르게 인덱싱 라이브러리 풀링 할 수 있고, 고성능 NGS 기계를 사용하여 하나 이상의 유동 세포 차선 서열화. 때때로 mappability w을 증가 판독 길이 및 서열 DNA 템플릿의 양단 (페어링 엔드)를 연장하는 것이 바람직하다반복적 인 게놈 영역 내에서 염색질 암탉 분석입니다. 이 프로토콜은 전사 인자 시그널링 매개체 번역 후 변형으로 히스톤 염색질 다양한 기능에 성공적으로 적용되었다. 그들이 개발하고 염색질 프로파일을 해석하기 어렵게 될 그러나, 배아 세포 이질성의 증가 학위를 취득. 유망 단계는 세포 유형 특정 핵 (38, 39)를 추출하여 조직 특별히 프로필 염색질 풍경에 애기 장대와 초파리되었습니다. 우리의 프로토콜은 다른 배아 조직 특이 칩 서열 번호에 대한 방법을 포장 할 수있는 핵 추출 단계를 포함한다.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table><tbody><tr><td>1/16 inch tapered microtip</td><td>Qsonica</td><td>4417</td><td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td></tr><tr><td>8 ml glass sample vial with cap</td><td>Wheaton</td><td>224884</td><td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td></tr><tr><td>Adaptor</td><td>e.g., IDT or Sigma</td><td>NA</td><td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG&lt;br /&gt;
ATCTACACTCTTTCCCTACAC&lt;br /&gt;
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC&lt;br /&gt;
TGAACTCCAGTCAC &amp;#8208;NNNNNN&amp;#8208;&lt;br /&gt;
ATCTCGTATGCCGTCT&lt;br /&gt;TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&amp;#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &amp;#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &amp;#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &amp;#176;C.</td></tr><tr><td>b2g4pipe (software)</td><td>Blast2GO</td><td>non-commercial</td><td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td></tr><tr><td>BLAST+ (software)</td><td>Camacho et al.</td><td>non-commercial</td><td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&amp;amp; &lt;br /&gt;DOC_TYPE=Download</td></tr><tr><td>Bowtie (software)</td><td>Langmead et al.</td><td>non-commercial</td><td>http://bowtie-bio.sourceforge.net/index.shtml</td></tr><tr><td>cisFinder (software)</td><td>Sharov et al.</td><td>non-commercial</td><td>http://lgsun.grc.nia.nih.gov/CisFinder/</td></tr><tr><td>Chip for capillary electrophoresis</td><td>Agilent Technologies</td><td>5067-1504</td><td>Load this chip with 1 &amp;micro;l DNA for library quality control. Store at 4 &amp;deg;C.</td></tr><tr><td>Chip-based capillary electrophoresis system</td><td>Agilent Technologies</td><td>G2940CA</td><td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &amp;deg;C.</td></tr><tr><td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td><td>Kapa Biosystems</td><td>KK8504</td><td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &amp;deg;C.</td></tr><tr><td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td><td>Rubicon Genomics</td><td>R40048</td><td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &amp;deg;C.</td></tr><tr><td>Cluster3 (software)</td><td>de Hoon et al.</td><td>non-commercial</td><td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td></tr><tr><td>FastQC (software)</td><td>Simon Andrews</td><td>non-commercial</td><td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td></tr><tr><td>Fluorometer</td><td>life technologies</td><td>Q32866</td><td>Qubit 2.0 Fluorometer</td></tr><tr><td>Fluorometer reagents</td><td>life technologies</td><td>Q32851</td><td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &amp;deg;C, buffer and dye at room temperature.</td></tr><tr><td>Formaldehyde</td><td>Sigma</td><td>F8775-4X25ML</td><td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td></tr><tr><td>Gel (E-Gel EX agarose , 2%)</td><td>life technologies</td><td>G4010</td><td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td></tr><tr><td>Gel electrophoresis system</td><td>life technologies</td><td>G6465</td><td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td></tr><tr><td>Gel extraction kit</td><td>Qiagen</td><td>28706</td><td>Store all reagents at room temperature. Use 500 &amp;micro;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td></tr><tr><td>HOMER (software)</td><td>Chris Benner</td><td>non-commercial</td><td>http://homer.salk.edu/homer/index.html</td></tr><tr><td>Hybridization oven</td><td>Techne</td><td>FHB1D</td><td>Hybridizer HB-1D</td></tr><tr><td>IGV (software)</td><td>Robinson et al.</td><td>non-commercial</td><td>http://www.broadinstitute.org/igv/home</td></tr><tr><td>Illumina CASAVA-1.8 quality filter (software)</td><td>Assaf Gordon</td><td>non-commercial</td><td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td></tr><tr><td>Java TreeView (software)</td><td>Alok Saldanha</td><td>non-commercial</td><td>http://jtreeview.sourceforge.net</td></tr><tr><td>Laboratory jack</td><td>Edu-Lab</td><td>CH0642</td><td>This jack is used to elevate sample in sound enclosure for sonication.</td></tr><tr><td>Ladder, 100 bp</td><td>New England BioLabs</td><td>N3231</td><td>Keep 1x solution at room temperature. Store stock at -20 &amp;deg;C.</td></tr><tr><td>Ladder, 1 kb</td><td>New England BioLabs</td><td>N3232</td><td>Keep 1x solution at room temperature. Store stock at -20 &amp;deg;C.</td></tr><tr><td>Low-retention 1.5-ml microcentrifuge tubes</td><td>life technologies</td><td>AM12450</td><td>nonstick, RNase-free microfuge tubes, 1.5 ml</td></tr><tr><td>MACS2 (software)</td><td>Tao Liu</td><td>non-commercial</td><td>https://github.com/taoliu/MACS</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>11201D</td><td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>11203D</td><td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>10001D</td><td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>10003D</td><td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic rack</td><td>life technologies</td><td>12321D</td><td>DynaMag-2 magnet</td></tr><tr><td>MEME</td><td>Bailey et al.</td><td>non-commercial</td><td>http://meme.nbcr.net/meme/</td></tr><tr><td>Na3VO4</td><td>New England BioLabs</td><td>P0758</td><td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &amp;deg;C.</td></tr><tr><td>NaF</td><td>New England BioLabs</td><td>P0759</td><td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &amp;deg;C.</td></tr><tr><td>NGS machine</td><td>Illumina</td><td>SY-301-1301</td><td>Genome Analyzer IIx</td></tr><tr><td>NGS machine (high performance)</td><td>Illumina</td><td>SY-401-2501</td><td>HiSeq</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2028</td><td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2025</td><td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2027</td><td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Nucleic acid staining solution</td><td>iNtRON</td><td>21141</td><td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td></tr><tr><td>Orange G</td><td>Sigma</td><td>O3756-25G</td><td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &amp;deg;C.</td></tr><tr><td>PCR primers</td><td>e.g., IDT or Sigma</td><td></td><td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &amp;micro;M each. Use 5 &amp;micro;l in a 50 &amp;micro;l PCR reaction. Store at -20 &amp;deg;C.</td></tr><tr><td>MinElute PCR purification kit&amp;nbsp;</td><td>Qiagen</td><td>28006</td><td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &amp;deg;C, all other buffers and collection tubes at room temperature.</td></tr><tr><td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td><td>life technologies</td><td>AM9730</td><td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &amp;deg;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td></tr><tr><td>Primer3 (software)</td><td>Steve Rozen &amp;amp; Helen Skaletsky</td><td>non-commercial</td><td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td></tr><tr><td>Protease inhibitor tablets</td><td>Roche</td><td>11836170001</td><td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &amp;deg;C.</td></tr><tr><td>Protease inhibitor tablets</td><td>Roche</td><td>11873580001</td><td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &amp;deg;C.</td></tr><tr><td>Proteinase K</td><td>life technologies</td><td>AM2548</td><td>proteinase K solution (20 &amp;micro;g/&amp;micro;l). Store at -20 &amp;deg;C.</td></tr><tr><td>RNase A</td><td>life technologies</td><td>12091-039</td><td>RNase A (20 &amp;micro;g/&amp;micro;l). Store at room temperature.</td></tr><tr><td>Rotator</td><td>Stuart</td><td>SB3</td><td>Rotator SB3</td></tr><tr><td>SAMtools (software)</td><td>Li et al.</td><td>non-commercial</td><td>http://samtools.sourceforge.neta</td></tr><tr><td>Solid phase reversible immobilisation beads</td><td>Beckman Coulter</td><td>A63882</td><td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &amp;deg;C.</td></tr><tr><td>Sonicator 3000</td><td>Misonix/Qsonica</td><td></td><td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td></tr><tr><td>Sound enclosure</td><td>Misonix/Qsonica</td><td></td><td>optional: follow the manufacturer&#039;s recommendation to obtain the correct sound enclosure.</td></tr><tr><td>Thermomixer</td><td>eppendorf</td><td>22670000</td><td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &amp;deg;C above room temperature to 99 &amp;deg;C.</td></tr></tbody></table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

프로토콜은 잘 실행되는 경우 여기 제시된 동등한 결과가 예상되는 사용 및 항체 칩 품질 등급 (설명 참조)이다. 이 프로토콜은 포름 알데히드 고정 아프리카 발톱 개구리의 배아에서 핵의 추출 및 초음파에 의한 염색질의 효율적인 전단 (그림 1A-C)를 할 수 있습니다. 전단 염색질은 주로 100 내지 1000 염기쌍의 범위 및 BP (도 1C) 300 내지 500 피킹 DNA 단편의 비대칭 분포를 나타낸다. 면역 DNA의 최소 50 페이지가 성공적으로 비슷한 크기의 DNA를 삽입 (그림 2A)와 인덱스 쌍 엔드 칩-SEQ 라이브러리를 만들기 위해 필요합니다. 도서관은 약 12​​0 bp의 electropherogram에서 볼 수 있습니다 어댑터 이량 체의 크게 결여해야한다. 시퀀싱 합성에 의한시 읽기 사전 처리는 게놈 (그림 2B, C)에 매핑됩니다. 성공적인 실험과에서 <em&gt; X. tropicalis 배아는 하나의 엔드의 일반적 50-70%는 최대한 두 불일치와 7.1의 게놈 어셈블리에 고유하게 매핑 할 수 있습니다 (40) 혈압 읽습니다. 입력 게놈에 걸쳐 매우 균일하게 정렬 읽는 동안, 칩의 정렬은 관심 염색질 기능의 측면 가닥 별 부화에 결과를 읽습니다. 조각을 모두 5 &#39;말단 (그림 2C) 25 서열 때문입니다. 평균 단편 크기에 방향을 읽는 정렬을 확장하는 것은 같은 전사 인자 바인딩 이벤트와 같은 하나의 크로 마틴 기능에 대한 정확한 프로파일을 생성합니다. IGV 또는 기타 호환 게놈 브라우저 시각화 할 때 이러한 DNA의 점유는 피크로 나타납니다. MACS 등 피크 발신자는 이들 피크 (도 3a)의 위치를 결정하기 위해 사용된다. 수십 결합 부위의 수천이 방법은 X에서 결정되었습니다 tropicalis 게놈 같은 VegT (26) T-상자 전사 인자에 대한. 칩 qPCR에의 체험관사항 칩-SEQ (그림 3B)에 의해 발견 된 지역 농축을 확인해야합니다. 칩 서열 번호 실험 염색질 기능의 게놈 전체의 특성을 탐구 할 수 있습니다. 예를 들어, 전사 개시 및 종결 부위로 게놈 요소를 판독 분포를 산출하는 임의의 유전자 주위 공간 결합 선호도 (도 3c)를 강조 할 수있다. 마찬가지로, 피크 위치에서 읽기 분포의 히트 맵은 게놈 전체 규모 (그림 3D)에서 다른 염색질 기능을 비교하는 데 사용됩니다. 특정 전사 인자는 잠재적 인 공동 요인 (그림 3E)의 공동 풍부한 주제를 포함하여 이러한 종류의 정보를 검색 할 수 있습니다 게놈 DNA 기본 피크의 DNA 서열 특히. 드 노보 모티브 분석을 결합한다. 표적 유전자의 대다수는 DNA의 하부에 점유보다는 더 높은 레벨 (도 3f)를 도시한다. 이 규모없는 기능은 그럴 사이에서 매우 일반적인 것 같다anscription 인자와 표적 유전자의 작은 부분을 직접 생물학적 관련성 27,28으로 조절되는 것을 제시한다. 이러한 추가 Xenopus의 배아 (그림 3G)에서 염색질 기능의 생물학적 기능에 대한 통찰력을 공개 할 수있다 표적 유전자의 발현 차이 등 풍부한 GO의 조건이나 다른 속성의 분석. <img alt="그림 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> 아프리카 발톱 개구리의 배아 1. 염색질 면역 침전 과정을 그림. (A) 배아 포름 알데히드 고정 공유 바인드 (가교)에 관심 게놈 DNA와 관련된 단백질의 발달 단계에있다. 핵 추출 (B)시, 가교 염색질 바인딩 게놈 DNA 또는 측면에서는 DN을 최소화하여 염색질 변형 사이트를 좁힐 조각난시퀀스 (C). 그 후, 염색질 조각은이자 (D)의 에피토프를 포함하는 사람들을 풍요롭게 칩 수준의 항체와 면역 있습니다. 공동 면역 DNA가 단백질을 제거하고 NGS (그림 2)의 칩 조각 라이브러리를 작성하기 전에 (E)를 정제한다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> 그림 2. 칩 서열 번호 라이브러리 준비, 시퀀싱 합성에 의한, 매핑 및 피크를 호출합니다. (A) electropherogram는 250 bp의 450의 DNA 템플릿과 좋은 칩 서열 번호 라이브러리를 표시합니다. 이러한 템플릿은 보편적 (58 BP)에 의해 형벌 관심의 DNA 삽입 및 인덱스 (63 BP) 어댑터를 수반한다. (B) </동일한 템플릿을 포함하는 각 클러스터와 클러스터의 강한&gt; 수백만, 가역, 독특한 형광과 동일한 종료 속성을 가진 네 개의 뉴클레오티드의 존재에 기초하여 시퀀스 기본이다. 형광 이미지 읽기에 궁극적으로 조립 해당 기지를, 전화를 실시간으로 처리됩니다. (C)는 만 유일하게 아프리카 발톱 개구리의 게놈지도가 유지되는 것을 읽습니다. 모든 단편은 5 &#39;말단으로부터 순서가되기 때문에, 칩의 매핑은 관심 염색질 기능의 측면 가닥 특정 피크의 결과를 판독한다. 이에 따라, 피크 호출자가 정확하게 크로 마틴 기능을 현지화 평균 조각 길이로 읽어 면역에서 유래하고 확장 농축을 감지합니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img aLT = &quot;그림 3&quot;SRC = &quot;/ 파일 / ftp_upload / 52535 / 52535fig3highres.jpg&quot;/&gt; 그림 3. 접합체의 T-상자 전사 인자 VegT (zVegT). 모두 여기에 표시된 수가 10 만명 정규화 읽어 고유 매핑과 비 중복이 읽습니다. (A) 발췌에 의한 후 염기 서열 분석 및 데이터 시각화의 예 zVegT의 게놈 전체 프로필 X에서 바인딩 (Nieuwkoop 및 페이버 (29) 후 12.5로 무대 11) tropicalis 낭배 배아. 각 피크, 확장 된 읽기의 더미 업, 하나의 결합 부위를 나타냅니다. 이들 피크는 1 % 미만의 오류 발견 레이트 (FDR)와 MACS2 의해 호출된다. 각 mesp 유전자 바인딩 매우 인접 상류 zVegT를 보여줍니다,하지만 mespa 및 mespb는 그 단계 (RNA-SEQ 데이터 30)에 의해 표현된다. (B) zVegT의 DNA 점유율 수준 여러 유전자 ​​좌에서 칩 qPCR에 의해 결정 (비 포함 KB 상류 β 액틴의 -bound 지역 0.5) 확인 합니칩 서열 번호에 의해 발견 된 특정 농축을 RM은. (A)에서 (빨간색 막대)라고 피크 mespa에 대한 결과를 비교한다. DNA 점유 레벨은 모두 입력의 비율, VegT 항체 (IgG의 이소 타입의 토끼 폴리 클로 날) 및 항체 제어 (정상 토끼의 IgG)와 칩 (Chip) 칩으로 보여집니다. 오차 막대는 두 개의 생물학적 반복 실험의 표준 편차를 반영한다. (C) Metagene 분석 주위에 다른 게놈 영역 및 유전자 기관 내 프로모터 상대에 바인딩 우선 zVegT을 (태그 25 bp의 이상 비닝)를 보여줍니다. (D)는 히트 맵은 K-평균을 보여줍니다 클러스터 (K = 5) DNA 점유율 수준 낭배 단계에서 모든 zVegT 바인딩 지역에 zVegT과 된 Smad2 /의 Smad3 (칩 서열 번호 데이터 31) 상대의 (태그는 25 bp의 이상 비닝). 히트 맵은 드 노보 모티브 분석 zVegT-의 38 %에 결합 모티프 정식 T-상자 전사 인자를 발견 2 기반 BP 당 5 태그를 중심으로. (E) 로그입니다기본 모티브 스코어 배경 서열에서 5 %의 비율로 발견 정규화 경우 결합 영역. 정식 된 Smad2 / Smad3이 결합 모티프가 거의 농축되지 않은 반면, 밀도지도, zVegT 결합 부위의 중앙에 T-상자 모티브 가장 높은 농축을 보여줍니다. (F) 히스토그램은 각 표적 유전자에 대해 계산된다 zVegT의 DNA 점유율 수준을 보여줍니다 [-] 모든 피크 (+/- 200 BP) 5킬로바이트 상류 사이에서. 전사 시작 사이트를 대응하고 1킬로바이트 하류 [+] (G) 가장 높은 DNA 점유율 내 -5 킬로바이트 수준과 1킬로바이트 아르와 최고 300 유전자 초기 배아 발달의 생물학적 과정에 대한 풍부. 이 용어가 zVegT의 추정 함수와 함께 줄에 이동합니다. FDR은 양측 피셔의 정확한 테스트를 기반으로 여러 테스트를 위해 수정됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

방법 염색질 규제 및 염색질 상태의 문제는 생체 내에서 유전자가 세포 운명 결정이 배아에서 어떻게 만들어 지는지 초기에 대한 우리의 이해의 열쇠입니다 영향을 미칩니다. 칩 서열 번호 - 글로벌 수준입니다 Xenopus의 배아 여기 설명에서 크로 마틴의 기능을 조사하기 가장 인기있는 방법.

염색질 레귤레이터 및 미국에서의 게놈 전체의 스냅 샷<em&gt; 아프리카 발톱 개구리</em칩 서열 번호&gt; 태아

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

genome-wide-snapshot-chromatin-regulators-states-xenopus-embryos-chip

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

12.3K 조회수.  MRC National Institute for Medical Research.  방법 염색질 규제 및 염색질 상태의 문제는 생체 내에서 유전자가 세포 운명 결정이 배아에서 어떻게 만들어 지는지 초기에 대한 우리의 이해의 열쇠입니다 영향을 미칩니다. 칩 서열 번호 - 글로벌 수준입니다 Xenopus의 배아 여기 설명에서 크로 마틴의 기능을 조사하기 가장 인기있는 방법. 

비디오: Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

낮은 풍부 배아 샘플 chromatin Immunoprecipitation (칩) 프로토콜

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

연구

유전학

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

종양 조직에 높은 처리량 칩 시퀀스를 사용 하 여 Chromatin의 게놈 넓은 매핑 위한 통합된 플랫폼

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

암 연구학

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a protocol for performing the chromatin conformation capture technique in situ Hi-C on staged Drosophila melanogaster embryo populations. The result is a sequencing library that allows the mapping of all chromatin interactions that occur in the nucleus in a single experiment. Embryo sorting is done manually using a fluorescent stereo microscope and a transgenic fly line containing a nuclear marker. Using this technique, embryo populations from each nuclear division cycle, and with defined cell cycle status, can be obtained with very high purity. The protocol may also be adapted to sort older embryos beyond gastrulation. Sorted embryos are used as inputs for in situ Hi-C. All experiments, including sequencing library preparation, can be completed in five days. The protocol has low input requirements and works reliably using 20 blastoderm stage embryos as input material. The end result is a sequencing library for next generation sequencing. After sequencing, the data can be processed into genome-wide chromatin interaction maps that can be analyzed using a wide range of available tools to gain information about topologically associating domain (TAD) structure, chromatin loops, and chromatin compartments during Drosophila development.

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

This work describes a protocol for the generation of high resolution in situ Hi-C libraries from tightly staged pre-gastrulation Drosophila melanogaster embryos.

단단히 준비 초기 초파리 배아에서 게놈 넓은 Chromatin 구조 캡처 라이브러리의 생성

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a ...

Epigenetic Regulation of Cardiac Differentiation of Embryonic Stem Cells and Tissues

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated by transcription factors which bind genomic regulatory regions including enhancers and promoters of cardiac constitutive genes. DNA is wrapped around histones that are subjected to chemical modifications. Modifications of histones further lead to repressed, activated or poised gene transcription, thus bringing another level of fine tuning regulation of gene transcription. Embryonic Stem cells (ES cells) recapitulate within embryoid bodies (i.e., cell aggregates) or in 2D culture the early steps of cardiac development. They provide in principle enough material for chromatin immunoprecipitation (ChIP), a technology broadly used to identify gene regulatory regions. Furthermore, human ES cells represent a human cell model of cardiogenesis. At later stages of development, mouse embryonic tissues allow for investigating specific epigenetic landscapes required for determination of cell identity. Herein, we describe protocols of ChIP, sequential ChIP followed by PCR or ChIP-sequencing using ES cells, embryoid bodies and cardiac specific embryonic regions. These protocols allow to investigating the epigenetic regulation of cardiac gene transcription.

A fine tuning regulation of gene transcription underlies embryonic cell fate decision. Herein, we describe chromatin immunoprecipitation assays used to investigate epigenetic regulation of both cardiac differentiation of stem cells and cardiac development of mouse embryos.

배아 줄기 세포와 조직의 심장 차별화의 성적인 규정

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated ...

발생학

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

인간 배아 줄기 세포에서 염색질의 Immunoprecipitation

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

생물학

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease (ChIP-Exo)

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) is widely used to identify genome-wide binding locations of DNA-binding proteins. However, the ChIP-seq method is limited by its heterogeneity in length of sonicated DNA fragments and non-specific background DNA, resulting in low mapping resolution and uncertainty in DNA-binding sites. To overcome these limitations, the combination of ChIP with exonuclease digestion (ChIP-exo) utilizes 5&#8217; to 3&#8217; exonuclease digestion to trim the heterogeneously sized immunoprecipitated DNA to the protein-DNA crosslinking site. Exonuclease treatment also eliminates non-specific background DNA. The library-prepared and exonuclease-digested DNA can be sent for high-throughput sequencing. The ChIP-exo method allows for near base-pair mapping resolution with greater detection sensitivity and reduced background signal. An optimized ChIP-exo protocol for mammalian cells and next-generation sequencing is described below.

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease ChIP-Exo

Precise determination of protein-binding locations across the genome is important for understanding gene regulation. Here we describe a&#160;genomic mapping method that treats chromatin-immunoprecipitated DNA with exonuclease digestion (ChIP-exo) followed by high-throughput sequencing. This method detects protein-DNA interactions with near base-pair mapping resolution and high signal-to-noise ratio in mammalian neurons.

크롬 마틴 면역 침전 -엑소뉴클레아제 (ChIP-Exo)를 사용하여 마우스 줄기 세포 유래 뉴런에서 단백질 DNA 상호 작용의 고해상도 매핑

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, epigenetic regulators, and post-translation modifications of histones that combinatorially influence the gene expression state of nearby genes. RNA has also been shown to interact with various proteins to regulate chromatin dynamics&#160;and gene expression. Chromatin-associated RNA immunoprecipitation (CARIP) followed by next-generation sequencing (CARIP-Seq) is a novel method to survey RNAs associated with chromatin proteins, while chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq) is a powerful genomics technique to map the location of post-translational modification of histones, transcription factors, and epigenetic modifiers on a global-scale in ES cells. Here, we describe methods to perform CARIP-Seq and ChIP-Seq, including library construction for next-generation sequencing, to generate global chromatin-associated RNA and epigenomic maps in ES cells.

Here, we describe methods to perform ChIP-Seq and CARIP-Seq, including library preparation for next-generation sequencing, to generate global epigenomic and chromatin-associated RNA maps in ES cells.

CARIP-Seq와 칩 Seq: Chromatin 관련 된 RNAs 및 배아 줄기 세포에 단백질 DNA 상호 작용을 식별 하는 방법

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Chromatin Immunoprecipitation (ChIP) using Drosophila tissue

Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at different developmental stages. Epigenetic regulation contributes to a broad spectrum of biological processes, including cellular differentiation during embryonic development and homeostasis in adulthood. A critical strategy in epigenetic studies is to examine how various histone modifications and chromatin factors regulate gene expression. To address this, Chromatin Immunoprecipitation (ChIP) is used widely to obtain a snapshot of the association of particular factors with DNA in the cells of interest.
ChIP technique commonly uses cultured cells as starting material, which can be obtained in abundance and homogeneity to generate reproducible data. However, there are several caveats: First, the environment to grow cells in Petri dish is different from that in vivo, thus may not reflect the endogenous chromatin state of cells in a living organism. Second, not all types of cells can be cultured ex vivo. There are only a limited number of cell lines, from which people can obtain enough material for ChIP assay.
Here we describe a method to do ChIP experiment using Drosophila tissues. The starting material is dissected tissue from a living animal, thus can accurately reflect the endogenous chromatin state. The adaptability of this method with many different types of tissue will allow researchers to address a lot more biologically relevant questions regarding epigenetic regulation in vivo1, 2. Combining this method with high-throughput sequencing (ChIP-seq) will further allow researchers to obtain an epigenomic landscape.

Chromatin Immunoprecipitation ChIP using Drosophila tissue

Recently high-throughput sequencing technology has greatly increased sensitivity of Chromatin Immunoprecipitation (ChIP) experiment and prompted its application using purified cells or dissected tissue. Here we delineate a method to use ChIP technique with Drosophila tissue, which can address the endogenous chromatin state in a well-characterized biological system.

사용 염색질 Immunoprecipitation (CHIP) Drosophila 조직

Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Single-Cell Factor Localization on Chromatin using Ultra-Low Input Cleavage Under Targets and Release using Nuclease

Determining the binding locations of a protein on chromatin is essential for understanding its function and potential regulatory targets. Chromatin Immunoprecipitation (ChIP) has been the gold standard for determining protein localization for over 30 years and is defined by the use of an antibody to pull out the protein of interest from sonicated or enzymatically digested chromatin. More recently, antibody tethering techniques have become popular for assessing protein localization on chromatin due to their increased sensitivity. Cleavage Under Targets &amp; Release Under Nuclease (CUT&amp;RUN) is the genome-wide derivative of Chromatin Immunocleavage (ChIC) and utilizes recombinant Protein A tethered to micrococcal nuclease (pA-MNase) to identify the IgG constant region of the antibody targeting a protein of interest, therefore enabling site-specific cleavage of the DNA flanking the protein of interest. CUT&amp;RUN can be used to profile histone modifications, transcription factors, and other chromatin-binding proteins such as nucleosome remodeling factors. Importantly, CUT&amp;RUN can be used to assess the localization of either euchromatic- or heterochromatic-associated proteins and histone modifications. For these reasons, CUT&amp;RUN is a powerful method for determining the binding profiles of a wide range of proteins. Recently, CUT&amp;RUN has been optimized for transcription factor profiling in low populations of cells and single cells and the optimized protocol has been termed ultra-low input CUT&amp;RUN (uliCUT&amp;RUN). Here, a detailed protocol is presented for single-cell factor profiling using uliCUT&amp;RUN in a manual 96-well format.

CUT&#38;RUN and its variants can be used to determine protein occupancy on chromatin. This protocol describes how to determine protein localization on chromatin using single-cell uliCUT&#38;RUN.

표적 하에서 초저 입력 절단을 이용한 크로마틴에 대한 단일 세포 인자 국소화 및 뉴클레아제를 이용한 방출

Determining the binding locations of a protein on chromatin is essential for understanding its function and potential regulatory targets. Chromatin ...

염색질 레귤레이터 및 미국에서의 게놈 전체의 스냅 샷

요약

더 많은 비디오 탐색

이 비디오의 챕터