ברצוננו להודות לקרן דלקת קרום המוח ול-MRC על מתן המימון לעבודה זו.

1. יצירת אמפליקון מוטציה על ידי SOE-PCR23 והגברה של קלטת ספקטינומיצין
<ol><li>התחל בביצוע PCR להגברה של זרועות ההומולוגיה (ply 5' (488 bp) ו- ply3' (715 bp) בהתאמה) של אזורי האיגוף של גן הרובד מזן 519/43. השתמש פריימרים plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGCCGGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTGGATCC GCGTCCTTTTTTTTTTTTTTTTTTCTTTTTC) ו- plyRv2_NotI (TTTGCGGCCGCCATTTTACCTTATCCTCTACC).</li>
	<li>השתמש בתנאי ה-PCR הבאים עבור ply5': דנטורציה ב-94°C למשך 60 שניות, שלב 2: דנטורציה ב-94°C למשך 30 שניות, שלב 3: חישול ב-58°C למשך 30 שניות, שלב 4: הארכה ב-72°C למשך 30 שניות, שלב 5: חזור לשלב 2 וחזור על הפעולה במשך 35 מחזורים, שלב 6: הארכה סופית ב-72°C למשך 30 שניות.<ol><li>השתמש באותם תנאי PCR עבור ply3' למעט זמן ההארכה בשלב 4 ושלב 6 שבו הוא אמור להיות 60 שניות.</li>
	</ol></li>
	<li>לנתח את מוצרי PCR על ידי אלקטרופורזה ג'ל הבלו את אמפליקון מן הג'ל.</li>
	<li>לטהר את אמפליקוני ה-PCR בהתאם לפרוטוקול המתואר בהוראות היצרן (טבלת חומרים).</li>
	<li>השתמש בכמויות שוות ערך של שתי זרועות ההומולוגיה כתבניות ב- SOE-PCR. התיך את שני האמפליקונים באמצעות פריימרים plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ו- plyRv2_NotI (TTTGCGGCCGCCATTTTTTACCTTATCCTCTACC).</li>
	<li>השתמש בתנאי SOE-PCR הבאים (שלב 1: דנטורינג ב 94 ° C במשך 2 דקות, שלב 2: denaturing ב 94 ° C במשך 30 שניות, שלב 3: חישול 58 ° C עבור 30 שניות, שלב 4: הארכה ב 68 ° C עבור 60 שניות, שלב 5: לחזור לשלב 2 ולחזור במשך 25 מחזורים, שלב 6: הארכה סופית ב 68 ° C עבור 90 שניות).</li>
	<li>לנתח את המוצר SOE-PCR על ידי אלקטרופורזה ג'ל. הבלו אותו מן הג'ל באמצעות ערכת מיצוי ג'ל ופעל לפי ההוראות שסופקו.</li>
	<li>הגבירו את קלטת הספקטינומיצין מפלסמיד pR412 באמצעות תנאי ה-PCR הבאים: שלב 1: דנטורינג ב-94 מעלות צלזיוס למשך 60 שניות, שלב 2: דנטורינג ב-94 מעלות צלזיוס למשך 30 שניות, שלב 3: חישול ב-55 מעלות צלזיוס למשך 30 שניות, שלב 4: הארכה ב-68 מעלות צלזיוס למשך 60 שניות, שלב 5: חזור לשלב 2 וחזור על הפעולה במשך 25 מחזורים, שלב 6: הארכה סופית ב-68°C למשך 60 שניות.<ol><li>השתמש פריימרים BamHI_SP2F2 (GGATCC, CTA, GAA, CTA, GTG, GAT, CCC CC) ו- BamHI_SP2R2 (GGATCC, AAT, TCT, GCA, GAT, TTT, AC, ATG ATC). פלסמיד pR412 נרכשה מד"ר מארק פרודהום (CNRS-Universite Paul Sabatier, טולוז, צרפת).</li>
	</ol></li>
	<li>לנתח את אמפליקונים PCR על ידי אלקטרופורזה ג'ל. הבלו ולטהר את אמפליקון PCR המתקבל כמתואר לעיל.</li>
</ol>2. יצירת פלסמיד pSD1 וטרנספורמציה כימית של E. coli Dh5α
<ol><li>ביצוע קשירה בהתאם להוראות היצרן של מערכת pGEMT-easy I (טבלת חומרים). בצינור מיקרוצנטריפוגה, הוסף 5 μL של 2x חיץ קשירה, 1 μL של pGEMTeasy, 2 μL של המוצר ply_SOE, 1 μL של T4 DNA ligase ומים לנפח כולל של 20 μL. לדגור לילה ב 4 °C (75 °F). זה מייצר פלסמיד pSD1.</li>
	<li>הפוך E. coli Dh5α בעל יכולת כימית עם pSD1. התחל על ידי דגירה של 50 μL של E. coli Dh5α בעל כשירות כימית עם 3 μL של תגובת קשירה pSD1 למשך 15 דקות על קרח. לאחר מכן המשך על ידי חשיפת התאים להלם תרמי (42 ° C, 30 שניות). מניחים את התאים על קרח למשך 2 דקות.</li>
	<li>הסר את התאים מקרח והוסף 350 μL של מדיה S.O.C. לדגור את התרבות במשך 2 שעות ב 37 ° C, 120 סל"ד.</li>
	<li>צלחת את השינוי על לוריא ברטאני אגר (LBA) בתוספת 0.4 mM IPTG, 0.24 מ"ג / מ"ל X-Gal עבור בחירה כחול/לבן ו 100 מיקרוגרם / מ"ל אמפיצילין כדי להבטיח שכל המושבות הגדלות בצלחת יש את עמוד השדרה פלסמיד. מושבות לבנות מכילות pSD1.</li>
	<li>בחרו שלוש מושבות לבנות והקימו גידולי לילה ב-10 מ"ל ליברות, בתוספת אמפיצילין של 100 מיקרוגרם/מ"ל. לדגור על התרביות במשך הלילה ב 37 °C (77 °F) עם רעידות.</li>
	<li>למחרת צנטריפוגו את התרביות בגודל 3,082 x גרם והשתמשו בגלולה להפקת פלסמיד.</li>
</ol>3. מיצוי DNA פלסמיד, הגבלת עיכול הגן pSD1 וספקטינומיצין והרכבת pSD2
<ol><li>לחלץ את DNA פלסמיד בהתאם להוראות שסופקו עם הערכה המסחרית (טבלה של חומרים).</li>
	<li>הגדר עיכול הגבלת BamHI הן עבור פלסמיד pSD1 והן עבור קלטת ספקטינומיצין שהוגברה וטוהרה בעבר. השתמש בתנאים ובכמויות הבאים המתוארים בטבלה 1.</li>
	<li>לדגור את הגבלת העיכול תגובות ובקרות ב 37 ° C במשך 3 שעות.</li>
	<li>לנתח את העיכול הגבלה על ידי אלקטרופורזה, הבלו את הרצועה ולטהר בהתאם להוראות שסופקו עם הערכה המסחרית (טבלה של חומרים).</li>
	<li>לאחר מכן, הכינו תגובת קשירה בהתאם להוראות היצרן (טבלת חומרים) באמצעות pSD1 וספקטינומיצין מעוכל BamHI (משלב 3.2). בצינור מיקרוצנטריפוגה, הוסף את רכיבי התגובה הבאים: 5 μL של 2x חיץ קשירה, 2 μL pSD1, 2 μL של קלטת ספקטינומיצין, 1 μL של T4 DNA ligase ודגור לילה ב 4 ° C. זה מייצר פלסמיד pSD2.</li>
	<li>הפוך פלסמיד pSD2 ל- E. coli Dh5α בעל יכולת כימית כמתואר בשלב 2.2.</li>
	<li>בחר את הטרנספורמנטים הנושאים פלסמיד pSD2 בהתבסס על יכולתם לגדול ב- LBA בתוספת 100 מיקרוגרם / מ"ל של ספקטינומיצין ואמפיצילין.</li>
	<li>ביצוע מיצוי DNA פלסמיד (pSD2) כמתואר לעיל ובהתאם להוראות היצרן (μL).</li>
</ol>4. טרנספורמציה של זן S. pneumoniae 519/43
<ol><li>הכינו תרבית לילה של S. pneumoniae 519/43 ב- BHI ואפשרו לו לגדול באופן סטטי ב 37 °C, 5% CO2.</li>
	<li>למחרת לדלל את התרביות 1:50 ו 1:100 ב 10 מ"ל של מרק BHI טרי. לדגור על התרביות באופן סטטי ב 37 ° C עד OD595nm הוא בין 0.05 ל 0.1 (רכישה אופטימלית של DNA קרוב יותר 0.1 OD).</li>
	<li>ברגע שמגיעים ל-OD של 0.1, לוקחים 860 μL ומעבירים לצינור מיקרוצנטריפוגה. באותו צינור מיקרוצנטריפוגה להוסיף: 100 μL של 100 mM NaOH, 10 μL של 20% (w/v) BSA, 10 μL של 100 mM CaCl 2,2 μL של 50 ng/mL CSP124 ו 500 ng של pSD2.</li>
	<li>לדגור את התגובה באופן סטטי ב 37 ° C במשך 3 שעות.</li>
	<li>צלחת 330 μL על 5% צלחות אגר דם (BA) בתוספת ספקטינומיצין 100 מיקרוגרם / מ"ל, כל שעה במשך 3 שעות הדגירה.</li>
	<li>לדגור על צלחות לילה ב 37 ° C, 5% CO2. מושבות עמידות בפני ספקטינומיצין טלאי על צלחת BA אחרת בתוספת ספקטינומיצין של 100 מיקרוגרם/מ"ל וכן על לוחות BA בתוספת 100 מיקרוגרם/מ"ל אמפיצילין. יש לדגור על שתי מערכות הצלחות למשך הלילה בתנאים שצוינו לעיל. לוחות ampicillin הם לבדוק את נוכחותו של עמוד השדרה פלסמיד.</li>
	<li>אשר את נוכחותה של קלטת spectinomycin על ידי PCR באמצעות פריימרים plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) ו- SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). אשר את המוטציה על ידי PCR באמצעות פריימרים plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) ו- plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) המתחברים מחוץ לאזור שעבר מוטציה.</li>
	<li>אשר את האינטגרציה במיקום הנכון של הגנום על ידי ריצוף באמצעות פריימרים plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), כמו גם פריימרים עם אתר הקישור שלהם בקלטת spectinomycin sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) ו- spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

למחברים אין מה לחשוף.

דלקת ריאות סטרפטוקוקוס, במיוחד סרוטיפ 1, ממשיכה להוות איום עולמי הגורם למחלת פנאומוקוק פולשנית ולדלקת קרום המוח. למרות הכנסת חיסונים שונים שאמורים להגן מפני סרוטיפ 1, באפריקה סרוטיפ זה עדיין מסוגל לגרום להתפרצויות שיובילו לתחלואה ותמותה גבוהה13. היכולת לבצע מניפולציה גנטית בסרוטיפ זה היא בעלת חשיבות קריטית בגלל הרלוונטיות הקלינית שלו. השיטה המתוארת במחקר זה מאפשרת מניפולציה גנטית של זן מייצג בתוך סרוטיפ זה. זן פולשני 519/43 (ST5316), מבודד קליני מחולה דלקת קרום המוח בדנמרק25.
המתודולוגיה שהוצגה כאן, הצליחה בעיקר בשל הזן הנבחר שכן הוא יכול לרכוש DNA אקסוגני, אך גם בשל שינויים שנעשו בפרוטוקולים המסורתיים המשמשים להתמרת S. pneumoniae , שיעור הצלחה טיפוסי לפרוטוקול הטרנספורמציה שלנו הוא כ -70%.
עם מתודולוגיה זו, חשוב ביותר להשתמש פלסמיד התאבדות במקום DNA ליניארי הרגיל. באופן קונבנציונלי, דנ"א ליניארי26,27,28 היה משמש; עם זאת, כל הניסיונות להשתמש בדנ"א האקסוגני בצורה זו לא צלחו. יתר על כן, ניסיונות לנצל את היכולת הטבעית של S. pneumoniae 519/43 בספיגה נמוכה יותר לא צלחו. פתרון בעיות הראה כי היכולת הטבעית לזן 519/43 הייתה גבוהה יותר כאשר OD595 היה 0.1, וזה שונה מהנתונים שנצפו עבור סרוטיפים אחרים של S. pneumoniae שבהם היכולת הטבעית הגבוהה ביותר נצפתה ב OD24 נמוך מאוד.
על מנת לאמת את השיטה, נבנה מוטנט פנאומוליזין מכיוון שהוא מציג פנוטיפ קל למעקב; עם זאת, כדי להוכיח כי השיטה יכולה להיות מיושמת על כל גן בתוך זן זה, גנים אחרים היו ממוקדים בהצלחה (כתבי יד בהכנה). שיטה כזו, תוך שימוש בווקטור התאבדות שאין לו מקור תואם גראם-חיובי, יכולה לשמש גם להשלמה כרומוזומלית, ביטוי יתר של גנים מעניינים, כמו גם החדרת מערכות כתב, כל זאת על ידי שימוש בגנים השכנים כאזורי הומולוגיה.
הרחבת הכלים הגנטיים ל- S. pneumoniae serotype 1, זן 519/43 חשובה מכיוון שכעת אנו יכולים לבצע מניפולציה גנטית ישירות בזנים מייצגים. זן 519/43 מעניין מכיוון שהוא גמיש גנטית, הוא פתוגני מכיוון שבודד מחולה דלקת קרום המוח, והמניפולציה שלו תספק רמזים להבנה טובה יותר של התפתחות והתבססות של דלקת קרום המוח. בעבר, הבנת דטרמיננטים מסוימים בתוך המין נעשתה על ידי החדרת הגן המדובר לאחד הזנים המאופיינים היטב של S. pneumoniae, כגון D39 (סרוטיפ 2). גישה כזו שימשה את Paton et al., בשל קשיים עם מוטגנזה על סרוטיפ 129. התוצאות שדווחו על ידם על D39 הנושא אלל פחות המוליטי של סרוטיפ 1 רובד בהשוואה ל- 519/43 ∆ply שונות מאלה שהוצגו על ידינו30 , ומדגישות את החשיבות של היכולת לבצע מוטציה בגן בתוך רקע הזן המקורי. מאוחר יותר, אותה קבוצה הצליחה לבצע מוטציה בזן סרוטיפ 1 שאינו שושלת22. באופן מעניין, הפרוטוקול שלהם שונה למדי משלנו, שכן זוהי גישה דו-שלבית הדורשת שהמוטציה תיעשה תחילה בזני סרוטיפ 2 ולאחר מכן זה משמש כתבנית לשינוי בזן סרוטיפ 1 שלהם.
נכון לעכשיו, יש מגבלה אחת בשיטה המוצגת. לעת עתה, שיטה זו עובדת רק עבור הזן המייצג 519/43. אותו פרוטוקול בדיוק נוסה בזנים אחרים, כלומר מבודדים קליניים מ-ST3081 ו-ST303 ולא הצליח. יתר על כן, אלקטרופורציה כשיטה להעברת DNA אקסוגני לתא נוסתה גם על כל שלושת סוגי הרצפים, עם תוצאות חיוביות שנצפו רק עבור 519/43. הרחבה וסטנדרטיזציה של המתודולוגיה לכל זני סרוטיפ 1 היא בעלת חשיבות עליונה מכיוון שיש שונות עצומה בכל הקבוצה. בימים אלה נערכים מחקרים להרחבת תחולת השיטה על כל הזנים בסרוטיפ 1.

סטרפטוקוקוס דלקת ריאות (S. pneumoniae, הפנאומוקוקוס) הוא אחד הגורמים העיקריים לתחלואה ולתמותה ברחבי העולם. עד לאחרונה התגלו קרוב ל-100 סרוטיפים של S. pneumoniae 1,2,3,4,5,6,7. מדי שנה, מחלת פנאומוקוק פולשנית (IPD) טוענת לכ -700,000 מקרי מוות, של ילדים מתחת לגיל5 שנים 8. S. pneumoniae הוא הגורם העיקרי לדלקת ריאות חיידקית, דלקת אוזניים, דלקת קרום המוח ואלח דם ברחבי העולם9.
בחגורת דלקת קרום המוח האפריקאית, סרוטיפ 1 אחראי להתפרצויות דלקת קרום המוח, כאשר סוג הרצף (ST) ST217, סוג רצף אלים ביותר, דומיננטי 10,11,12,13,14,15. חשיבותו בפתולוגיה של דלקת קרום המוח הושוותה לזו של Neisseria meningitidis בחגורת דלקת קרום המוח האפריקאית16. סרוטיפ 1 הוא לעתים קרובות הגורם העיקרי ל- IPD; עם זאת, הוא נמצא לעתים רחוקות מאוד בכרכרה. למעשה, בגמביה, סרוטיפ זה אחראי ל -20% מכלל המחלות הפולשניות, אך הוא נמצא רק ב -0.5% מהנשאים הבריאים 14,17,18,19. החלפה גנטית ורקומבינציה בפנאומוקוקים מוסמכים מתרחשת בדרך כלל בהובלה ולא במחלה פולשנית20. יתר על כן, סרוטיפ 1 הוכח כאחד משיעורי ההובלה הקצרים ביותר המתוארים בקרב פנאומוקוקים (9 ימים בלבד). לכן, הוצע כי סרוטיפ זה עשוי להיות בעל שיעור רקומבינציה נמוך בהרבה מאחרים21.
יש צורך במחקרי עומק כדי להבין את הסיבה לשיעור ההובלה הנמוך של זני סרוטיפ 1 ואת חשיבותו במחלות פולשניות באפריקה שמדרום לסהרה.
כאן אנו מדווחים על פרוטוקול המאפשר מוטגנזה כלל-גנומית של זן סרוטיפ 1 מסוים, 519/43. זן זה יכול בקלות לרכוש ולשלב מחדש דנ"א חדש בגנום שלו. שיטה זו עדיין אינה בין-זנית, אך היא יעילה מאוד כאשר היא נעשית ברקע 519/43 (מטרות אחרות עברו מוטציה, כתבי יד בהכנה). פשוט על ידי שימוש בזן 519/43, וניצול היכולת הטבעית שלו, כמו גם החלפת האופן שבו הדנ"א האקסוגני מסופק, הצלחנו לשנות את הגן pneumolysin (ply) בזן סרוטיפ 1 זה. שיטה זו מייצגת שיפור מזה שהוצג על ידי Harvey et al.22 כפי שהוא נעשה בשלב אחד ללא צורך להעביר את הדנ"א דרך סרוטיפ אחר. עם זאת, ובשל השונות בין הזנים, אף שיטה לא תוקנה לכל הזנים. היכולת לבצע מוטציה בגנים ספציפיים ולצפות בהשפעותיהם תאפשר הבנה מעמיקה של זני סרוטיפ 1 S. pneumoniae ותספק תשובות לתפקידם של זנים אלה בדלקת קרום המוח באפריקה שמדרום לסהרה.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 נותר בעיה עצומה במדינות בעלות הכנסה נמוכה ובינונית, במיוחד באפריקה שמדרום לסהרה. למרות חשיבותו, מחקרים בסרוטיפ זה עוכבו על ידי היעדר כלים גנטיים כדי לשנות אותו. במחקר זה אנו מתארים שיטה לשינוי גנטי של איזולט קליני של סרוטיפ 1 (זן 519/43). באופן מעניין, זה הושג על ידי ניצול יכולתו של הפנאומוקוק לרכוש דנ"א באופן טבעי. עם זאת, בניגוד לרוב הפנאומוקוקים, השימוש בדנ"א ליניארי לא היה מוצלח; כדי לשנות את הזן החשוב הזה, היה צורך להשתמש בפלסמיד מתאבד. מתודולוגיה זו סיפקה את האמצעים להבנה עמוקה יותר של סרוטיפ חמקמק זה, הן מבחינת הביולוגיה והן מבחינת הפתוגנים שלו. כדי לאמת את השיטה, הרעלן העיקרי הידוע של פנאומוקוק, פנאומוליזין, עבר מוטציה מכיוון שיש לו פנוטיפ ידוע וקל למעקב. הראינו שהמוטציה, כצפוי, איבדה את יכולתה ללדת תאי דם אדומים. על ידי היכולת לבצע מוטציה בגן חשוב בסרוטיפ המעניין, הצלחנו לצפות בפנוטיפים שונים לאובדן מוטציות תפקודיות בזיהומים תוך צפקיים ותוך אפיים מאלה שנצפו עבור סרוטיפים אחרים. לסיכום, מחקר זה מוכיח כי זן 519/43 (סרוטיפ 1) יכול להיות מהונדס גנטית.

הפרוטוקול המתואר כאן מתחיל בשימוש ב- PCR כדי להגביר את זרועות ההומולוגיה השמאלית והימנית, תוך מחיקת 191 bp מהאזור האמצעי של גן הרובד . בעת ביצוע ה-PCR מציגים אתר BamHI ב-3' של זרוע ההומולוגיה השמאלית ובקצה ה-5' של זרוע ההומולוגיה הימנית (איור 1A). אחריו מגיע PCR-SOE, שבו זרועות הומולוגיה שמאליות וימניות מאוחות לאמפליקון אחד (איור 1B). אמפליקון SOE-PCR זה משובט לאחר מכן לתוך pGEMTeasy באמצעות שיבוט TA כדי ליצור פלסמיד pSD1 (איור 1C). טרנספורמציה מוצלחת תניב מושבות לבנות עמידות לאמפיצילין. כל מושבה כחולה תהיה טרנספורמציה המכילה פלסמיד pGEMTeasy ריק. לאחר מכן, pSD1 יעוכל באתר BamHI שהוצג בזמן ה-SOE-PCR (איור 1D) ויוצמד לקסטת ספקטינומיצין (גם BamHI מתעכלת למטרות תואמות). הפלסמיד החדש נקרא pSD2 (איור 1E). הרכבה נכונה של pSD2 מאושרת על-ידי הגבלת העיכול (איור 2A). pSD2, הפועל כפלסמיד התאבדות מכיוון שאינו מכיל מקור תואם גראם-חיובי של שכפול, שימש לשינוי 519/43WT (מוכן בעבר להיות מוכשר). טרנספורמנטים חיוביים הם מושבות הגדלות על ספקטינומיצין של 100 מיקרוגרם/מ"ל לאחר דגירה של לילה. כל המושבות מודבקות על לוחות בסיס אגר דם טריים חדשים בתוספת ספקטינומיצין של 100 מיקרוגרם/מ"ל וכן בסיס אגר דם בתוספת 100 מיקרוגרם/מ"ל אמפיצילין. כל מושבה שגדלה על צלחות הלילה השנייה בתוספת ספקטינומיצין הן חיוביות אפשריות. כל מושבה שגדלה על לוחות אמפיצילין תציין אינטגרציה של פלסמיד מלא או רקומבינציה של קלטת אמפיצילין במקום אחר בגנום. עד כה ובאמצעות זן 519/43 לא גדלו מושבות על הצלחות בתוספת אמפיצילין. כל המושבות החיוביות ב-PCR חייבות להיות מאושרות על-ידי ריצוף (איור 2C) כדי להעריך ולאשר את מיקום ההחדרה. לשם כך, פריימרים חייבים להיות בעלי אתר קישור מחוץ לאזור ההומולוגיה (איור 2C). למטרה שנבחרה יש פנוטיפ מאוד מסומן (המוליזה של תאי דם אדומים (RBC)), ולכן ניתן לאשר את המוטציה גם פנוטיפית (איור 2B). המוטאנט איבד את יכולתו לשקר RBC's.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>רכיבים</td>
			<td>תגובה (μL)</td>
			<td>בקרה (μL)</td>
			<td>תגובה (μL)</td>
			<td>בקרה (μL)</td>
		</tr><tr><td>מאגר</td>
			<td>2</td>
			<td>2</td>
			<td>2</td>
			<td>2</td>
		</tr><tr><td>pSD1</td>
			<td>4</td>
			<td>4</td>
			<td></td>
			<td>-</td>
		</tr><tr><td>קלטת ספקטינומיצין</td>
			<td>-</td>
			<td>-</td>
			<td>6</td>
			<td>6</td>
		</tr><tr><td>BamHI-HF</td>
			<td>1</td>
			<td>-</td>
			<td>1</td>
			<td>-</td>
		</tr><tr><td>מים</td>
			<td>13</td>
			<td>14</td>
			<td>11</td>
			<td>12</td>
		</tr><tr><td>נפח כולל</td>
			<td>20</td>
			<td>20</td>
			<td>20</td>
			<td>20</td>
		</tr></tbody></table>טבלה 1: רכיבי תגובת עיכול הגבלה עבור קלטת pSD1 וספקטינומיצין.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61594/61594fig01.jpg"> איור 1: סקירה כללית של אסטרטגיית המוטגנזה. A) הגברה של זרועות הומולוגיה (Ply3' ו-Ply5' (נתיבים 2 עד 5); וחבור על ידי PCR הארכה חופפת (נתיבים 6 ו-7). L- היפרסולם I (ביוליין), נתיב 1- שליטה שלילית לתגובה, נתיב 2 ו- 3- ply5' (488 bp) ו- ply3' (715 bp) זרועות הומולוגיה מוגברות מ- D39 gDNA, נתיבים 4 ו- 5- ply5' (488 bp) ו- ply3' (715 bp) זרועות הומולוגיה מוגברות מ- 519/43 gDNA. נתיב ימני 6- D39 SOE PCR product, נתיב 7- 519/43 SOE PCR מוצר (1235 bp). ב) סכמטי המתאר את מבנה SOE-PCR הסופי שהתקבל (ply_SOE); מסומנים על ידי חצים הם פריימרים המשמשים להשגת אזור ההומולוגיה בין שתי זרועות ההומולוגיה, כמו גם את עיכול ההגבלה שנבחר. ג) פלסמיד pSD1, המתאר שיבוט של ply_SOE; ד) הגבלת העיכול של קלטת pSD1 וספקטינומיצין. E) מבנה סופי pSD2 המשמש לאחר מכן כפלסמיד התאבדות כדי להפוך את S. pneumoniae. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61594/61594fig01large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61594/61594fig02.jpg"> איור 2: A) אישור על נוכחות קלטת ספקטינומיצין ב- pSD2. L- היפרסולם 1kb (ביוליין); 1- pSD1 מעוכל עם BamHI; 2-pSD2 מעוכל עם BamHI; L hyperladder 1 kb (ביוליין); 3- קלטת ספקטינומיצין מוגברת מ-pR412, 4- קלטת ספקטינומיצין מעוכלת עם BamHI; B) אישור פנוטיפי למוטציה בפנאומוליזין על ידי קביעת פעילות המוליטית עבור D39, 519/43WT ומוטציה 519/43Δply. זה הושווה להמוליזה של תאי דם אדומים על ידי 0.5% saponin. המוליזה שמקורה בספונין נחשבת ל-100% והתעריפים עבור 519/43Wt ו-519/43Δply חושבו מולה. כל נקודת נתונים היא הממוצע של 5 עותקים טכניים ו-3 משוכפלים ביולוגיים. C) נתוני ריצוף שמופו לאזור הגנום המוטנטי שבו הופסקה דלקת ריאות. פריימרים מסומנים כחצים ובשם. PLYSCN1 ו-PLYSCN2 נקשרים מחוץ לזרועות ההומולוגיה. ריצוף שהתקבל מפריימרים PLYSCN1 ו-2 הראה שהיה רצף רצוף מהאזורים השכנים מחוץ לאזור ההומולוגיה עד לקלטת הספקטינומיצין, מה שמדגים את החדרת הגנום. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61594/61594fig02large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

כאן אנו מתארים זן סרוטיפ 1 של S. pneumoniae serotype 1 519/43 שניתן להנדס גנטית באמצעות יכולתו לרכוש באופן טבעי DNA ופלסמיד מתאבד. כהוכחה עקרונית נוצרה מוטציה איזוגנית בגן הפנאומוליזין (ply).

בניית מוטנטים בסרוטיפ 1 סטרפטוקוקוס דלקת ריאות זן 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K Views.  London School of Hygiene and Tropical Medicine. כאן אנו מתארים זן סרוטיפ 1 של S. pneumoniae serotype 1 519/43 שניתן להנדס גנטית באמצעות יכולתו לרכוש באופן טבעי DNA ופלסמיד מתאבד. כהוכחה עקרונית נוצרה מוטציה איזוגנית בגן הפנאומוליזין (ply).

Video: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of infection with influenza virus alone. Instead, most individuals are thought to have succumbed to a secondary bacterial infection, predominately caused by the bacterium Streptococcus pneumoniae (the pneumococcus). The synergistic relationship between infections caused by influenza virus and the pneumococcus has subsequently been observed during the 1957 Asian influenza virus pandemic, as well as during seasonal outbreaks of the virus (reviewed in 1, 2). Here, we describe a protocol used to investigate the mechanism(s) that may be involved in increased morbidity as a result of concurrent influenza A virus and S. pneumoniae infection. We have developed an infant murine model to reliably and reproducibly demonstrate the effects of influenza virus infection of mice colonised with S. pneumoniae. Using this protocol, we have provided the first insight into the kinetics of pneumococcal transmission between co-housed, neonatal mice using in vivo imaging 3.

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

A concurrent infection with influenza A virus is one of the factors implicated in the induction of invasive pneumococcal disease during asymptomatic Streptococcus pneumoniae carriage. Here we describe a mixed infection method using infant mice to investigate the synergism between these two respiratory pathogens.

באמצעות הדמיה Bioluminescent לחקור סינרגיזם בין Streptococcus pneumoniae ו שפעת וירוס עכברים תינוקות

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

הסקה Genotypic של כמיהות HIV-1 שימוש אוכלוסייה מבוססת רצף של V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not representative of the behavior, status or phenotype of single cells. Due to this new insight the number of single cell studies rises continuously (for recent reviews see 1,2,3). However, many of the single cell techniques applied do not allow monitoring the development and behavior of one specific single cell in time (e.g. flow cytometry or standard microscopy).
Here, we provide a detailed description of a microscopy method used in several recent studies 4, 5, 6, 7, which allows following and recording (fluorescence of) individual bacterial cells of Bacillus subtilis and Streptococcus pneumoniae through growth and division for many generations. The resulting movies can be used to construct phylogenetic lineage trees by tracing back the history of a single cell within a population that originated from one common ancestor. This time-lapse fluorescence microscopy method cannot only be used to investigate growth, division and differentiation of individual cells, but also to analyze the effect of cell history and ancestry on specific cellular behavior. Furthermore, time-lapse microscopy is ideally suited to examine gene expression dynamics and protein localization during the bacterial cell cycle. The method explains how to prepare the bacterial cells and construct the microscope slide to enable the outgrowth of single cells into a microcolony. In short, single cells are spotted on a semi-solid surface consisting of growth medium supplemented with agarose on which they grow and divide under a fluorescence microscope within a temperature controlled environmental chamber. Images are captured at specific intervals and are later analyzed using the open source software ImageJ.

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

This protocol provides a step-by-step procedure to monitor single cell behavior of different bacteria in time using automated fluorescence time-lapse microscopy. Furthermore, we provide guidelines how to analyze the microscopy images.

תא הדמיה חיה של Bacillus subtilis ו Streptococcus pneumoniae באמצעות מיקרוסקופית אוטומטי זמן לשגות

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

אפיון של תגובות דלקתיות במהלך קולוניזציה תוך-אפית עם דלקת ריאות סטרפטוקוקוס

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca2+, K+, and H+, respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial species. Though our protocols have been optimized for S. pneumoniae, we believe these approaches should form an excellent starting-point for similar studies in other bacterial species.

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Unlike that seen for eukaryotes, there is a paucity of studies that detail membrane depolarization and ion concentration changes in bacteria, primarily as their small size makes conventional methods of measurement difficult. Here, we detail protocols for monitoring such events in the significant Gram-positive pathogen Streptococcus pneumoniae utilizing fluorescence techniques.

ניטור שינויים בממברנה קוטביות, ממברנה יושרה, וריכוזי יון תאיים ב<em&gt; Streptococcus pneumoniae</em&gt; שימוש צבעי ניאון

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; שימוש תגובת Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; על ידי לאטקס התלכדות

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

מודל Murine של הקבוצה B<em&gt; סטרפטוקוקוס</em&gt; נרתיקי Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

מודל דלקת ריאות חזק במכרסמי immunocompetent להערכת יעילות אנטיבקטריאלי נגד<i&gt; S. pneumoniae</i&gt;,<i&gt; H. אינפלואנזה</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; או<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

שכפול של הוזמן, ספריית Nonredundant של Pseudomonas aeruginosa זן PA14 Transposon ההכנסה מוטציות

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...