עבודה זו נתמך בחלקה על ידי התוכנית-CORE (מעניקה מס 41/11), הקרן הלאומית למדע (גרנט מס 908/15), ואת אירופה קרוהן קוליטיס הארגון (ECCO).

אישור מוסרי לחקר הוענקה על ידי ועדת האתיקה שיבא מחקר מקומיים, כל השיטות בוצעו בהתאם ההנחיות הרלוונטיות והתקנות. הפרוטוקול קיבל החולה והסכמתו לחריגה מן הלוח המקומי ביקורת אתית, מאז החומר הצואתי ששימשו כבר הוגשו עד היסוד מיקרוביולוגיה כחלק של בדיקות קליניות, ללא מידע המאפשר זיהוי אישי, סבלני חוץ גיל, מגדר, ותוצאות מיקרוביאלי. נכתב, הסכמה מדעת היה המתקבלים מתנדבים בריאים, ועדת הבדיקה מוסדיים אישור המחקר. חלק את הדגימות כבר נכללו בניתוח הקודם1.
1. מדגם טיפול
<ol><li>אוספים כ 5 מ מ2 השמצות (בערך בגודל של מחק עיפרון) של דגימת צואה טרייה עם מקלון סטרילי במבחן צינור (ראה טבלה של חומרים). לאחסן כל דגימות המכיל דגימות צואה ב-80 מעלות צלזיוס בתוך 24 שעות. הושארו צואה יכולים להישאר שם עד עיבוד נוסף.</li>
</ol>2. הפקת דנ א
<ol><li>להפשיר את החילוץ ופתרונות דילול בטמפרטורת החדר (ראה טבלה של חומרים).</li>
	<li>העברת הדגימה צואה לתוך אוסף ריק mL 2 צינור (ראה טבלה של חומרים). להתאים את גודל ספוגית מקל על ידי חיתוך באמצעות מספריים נקי כדי לאפשר סגירת שפופרת עם מינימום זיהום צולב. להוסיף 250 μL של פתרון מיצוי כל שפופרת אוסף המכיל את ספוגית צואתי ואת מערבולת לערבב.</li>
	<li>מחממים את הדגימות 10 דקות באמבט מים רותחים (95-100° C). להוסיף 250 μL של דילול פתרון לכל דגימה של מערבולת לערבב.</li>
	<li>מאחסנים צינורות 2 מ"ל המכיל את ה-DNA שחולץ הדגימה ב 4 º C.</li>
</ol>3. PCR והכנת ספריית
עבור שלבים 3.1 ו- 3.2, עובד תחנת עבודה-PCR המספק נקי, תבנית סביבה אמפליקון חינם.
<ol><li>תווית של תחל (טבלה 1) לפי ברקוד שלהם. לדלל כל תחל במים מזוקקים כפול (DDW) ריכוז μM 50 ו החנות ב-20 ° C.</li>
	<li>להשתמש בלוח 96-ובכן לתגובות PCR. כל צלחת יכול להכיל 32 מדגמים שונים, אשר מתויגות כברירת 32 תחל אינדקס שונים. להפשיר את פריימר לפנים, את צבעי יסוד הפוך 32 בטמפרטורת החדר, לדלל אותם כדי 5 μM.</li>
	<li>היכונו PCR התגובה mixes 100 תגובות (נפח סופי בכל טוב יהיה 20 μl) על ידי ערבוב μL 100 μM 5 פריימר לפנים, מיקס מאסטר PCR X 1 מ"ל 2 ו 400 μL DDW. הכניסו μL 15 של מיקס PCR הזה מכל קידוח (סה כ 96 וולס). להוסיף 1 μL של כל פריימר באינדקס ההפוך 5 μM 3 בארות שונות (32 שונים תחל ב- triplicates נותן סך של בארות 96).</li>
	<li>בתוך אזור ייעודי טרום-PCR, כלומר ספסל נקי תבנית, אמפליקון חינם, להוסיף 4 μL של כל מדגם ה-DNA שחולץ התגובה תערובות (כל מדגם ה-DNA שחולץ מוגבר שהפקידים — 32 דגימות לכל צלחת 96-ובכן).</li>
	<li>הפעל את ה-PCR עם ההגדרות הבאות: דנטורציה הראשונית של 94 º C למשך 3 דקות; ואחריו 35 מחזורי דנטורציה ב 94 ° C עבור 1 דקות, חישול ב 55 ° C 1 דקות, סיומת ב-72 מעלות עבור 1 דקות; ועם סיומת הסופי ב-72 מעלות למשך 10 דקות.</li>
	<li>על ספסל שונים, אשר תוגדר כאזור ייעודי פוסט-PCR, לשלב את כל התגובה PCR triplicate לתוך צינור אחסון יחיד (60 μL עבור דגימה).</li>
	<li>כדי להעריך את האיכות של ה-PCR amplicons, להפעיל 4 μL של כל תגובה משולב-PCR על ג'ל שהוכתמו ברומיד agarose 1% אתידיום. מתחת UV באורך גל של 260 ננומטר, amplicons חיובי יופיעו גודל של הלהקה הצפוי של bp 375-425. רק amplicons אלה ייכלל והשלבים הבאים. הערה: כל מדגם מוגבר במובן triplicate, כי כל מדגם מוגבר ב- 3 תגובות PCR שונות. לא תעשה זום</li>
</ol>4. ספריית כימות וניקוי
<ol><li>על מנת לקבל בריכת equimolar ריכוז של כל הדגימות PCR, לכמת כל אמפליקון על ידי ה-DNA נטושים כפול (dsDNA לכמת ריאגנט) חומצת גרעין נמכרות כתם (ראה טבלה של חומרים), מתאים כימות סימולטני של גדול כמות דגימות. הערה: מאז הטווח בגודל אמפליקון מפוקפקת, הסכום בפועל ב ננוגרם משמש לטעינת של ריכוז equimolar.</li>
	<li>שילוב 500 ננוגרם של כל מדגם לתוך צינור יחיד, סטרילי. מערבולת לערבב.</li>
	<li>הרץ μL 200 של הספרייה במאגר ג'ל שהוכתמו אתידיום ברומיד agarose 1%. לחלץ את הלהקות bp 375-425 מ הג'ל באמצעות ערכת חילוץ ג'ל על פי הוראות היצרן (ראה טבלה של חומרים) ו elute בספריה 80 μL DDW במאגר. הערה: הספרייה במאגר צריך להיות בגודל שנבחר כדי לצמצם מוצרים שאינם ספציפיים הגברה מהמארח הדנ א.</li>
	<li>למדוד את הריכוז ספריית הסופי באמצעות dsDNA רגישה מאוד גילוי הערכה על פי הוראות היצרן (ראה טבלה של חומרים). למדוד את גודל הספרייה מדויק באמצעות ערכת ההפרדה וניתוח רגישות גבוהה עבור ספריות DNA על-פי הוראות היצרן (ראה טבלה של חומרים).</li>
</ol>5. רצף
<ol><li>לדלל במאגר הספריה עד 7 בערב עם תוספת של 20% בקרת ספרייה (ראה טבלה של חומרים), לפי הפרוטוקול המכונה רצף.</li>
	<li>עבור רצף, מותאמים אישית לשימוש שנועדו לקרוא תחל זה ללא תשלום תחל הגברה V4 (ראה טבלה 1).</li>
	<li>פריימר רצף מעוצב מותאם אישית לשימוש שלישי שקורא הברקוד ב נוספים מחזור (ראה טבלה 1) ומייצר קריאות סוף-זיווג הבסיסים 175 אורך לכל כיוון, בהתאם למפרט היצרן.</li>
	<li>להפעיל את המכונה רצף ולקבל FASTQ קבצים על פי הפרוטוקול של היצרן.</li>
</ol>6. עיבוד נתונים
<ol><li>. סטיץ ' יחד ולעבד את קבצי FASTQ סוף-לזווג חופפים צינור curation נתונים מיושם QIIME 2 גירסה 2017.7.017. Demultiplex את הקריאות לפי מדגם ספציפי ברקודים.</li>
	<li>השתמש DADA218 עבור זיהוי משתנה (SVs) בקרת איכות, רצף. לחתוך קריאות-13 בסיסים מקצה 3' ובסיסים 15 5' מהקצה, להשליך קורא עם יותר מ- 2 שגיאות הצפוי. לזהות ולהסיר את כימרות באמצעות שיטת הקונצנזוס — כימרות מזוהים בדגימות באופן אינדיבידואלי, רצפים נמצאו chimeric בשבריר מספיק דוגמאות של יוסרו.</li>
	<li>לבצע סיווג טקסונומי SVs באמצעות מסווג Bayes נאיבי מצויד, על אוגוסט 2013 99% זהות Greengenes מאגר6, 175 זמן של קריאות של פריימר לפנים/הפוכה להגדיר.</li>
	<li>כל הדגימות לעומק של רצפי 2,146 להעלימה.</li>
	<li>השתמש Unweighted UniFrac למדידה של β-גיוון (בין מדגם גיוון19,20) על הדגימות דליל, כדי להימנע אפקט גודל המדגם.</li>
	<li>השתמש המטריצה המתקבלת מרחק כדי לבצע ניתוח נקודות הציון העיקריות (PCoA). הערה: קבצי script ומיפוי עיבוד הנתונים מסופקים כחומר משלים (חומר משלים 1 ו- 2).</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

המחברים אין לחשוף.

מטוסי אף-16 rRNA-אמפליקון ורצף רובה metagenomics צברו פופולריות ב מיקרוביולוגיה קלינית יישומים21,22,23. טכניקות אלה הן יתרון ביכולת מוגברת שלהם לכידת taxa culturable ו- culturable, המספק נתונים אודות שפע יחסי של inoculum פתוגניים, ואת יכולתם לזהות ביתר דיוק זיהומיות polymicrobial טביעות אצבע של24. ההתקדמות בתחום של מחקר microbiome יצרו כמויות אדירות של נתונים שאינם השוואה בקלות עקב חוסר עקביות הגישות השונות. בשנים האחרונות, מספר מהמגזר ניסו להתמודד עם בעיות אלה. פרוטוקול זה עוקב אחר הכנת ספריה דומה כפרוייקט microbiome כדור הארץ (EMP). אולם, הוסיף הוא פרוטוקול מפורט שלב אחר שלב להפקת DNA של דגימות צואה דרך צינור ניתוחים.
בעבר, מטוסי אף-16 rRNA רצף שימש לאפיין את הדפוסים קומפוזיציה מיקרוביאלית של דגימות צואה לנסיינים בריאים שאינם מאושפזים, חולים מאושפזים עם חשד שלשול זיהומיות, התרבות המסורתית לתוצאות. התוצאות של ניתוח זה הראה כי חולים מאושפזים יש עליות עמוקה ב taxa מפרוטאובקטריה מערכה1. המתוארים כאן הוא פרוטוקול משולב של שיטות שימוש בהרחבה עבור מטוסי אף-16 rRNA ג'ין אמפליקון רצף באמצעות PCR ללא עמודות ישיר זה תוכנן במקור עבור מיצוי של הצמח דנ א16. גישה זו ניתן ביעילות, במהירות לחלץ באיכות טובה מוגבר-DNA ספריות פילוח האזור משתנה V4 של הגן rRNA מטוסי אף-16 מ מספר רב של דוגמאות מתאים תפוקה גבוהה מטוסי אף-16 rRNA רצף.
כמו זו היא שיטה המבוססת על ה-DNA רצף, מתקבלים נתונים על aerobes והן anaerobes מיקרוביאלי קהילות נוכח דוגמה צואה בודדים. הפרוטוקול אימצה את תחל שהיו במקור תוכנן15 נגד האזור V4 של הגן rRNA מטוסי אף-16. חשוב, ומהצמיגים הגברה הפוכה להכיל רצף 12 ברקוד בסיס תומך באגירת דוגמאות שונות עד 2,167 כל ליין15. פריימר לפנים הגברה כוללת תשעה עוד בסיסים באזור מתאם התומכים לזווג-קצה הרצף על רצף פלטפורמה25 (טבלה 1 ו- 3 חומר משלים). גישה זו זמינה טיפול ספריה מורכבת 250 דגימות צואה היו וסודרו ליין אחד עם עומק המצטבר של 10622.57 ± 1211.34 (זאת אומרת ± תקן שגיאה) קריאות עבור דגימה בעלות של ~ 30 דולר לכל דגימה.
כדי להבטיח בקרת איכות, אנו ממליצים להשתמש שלילי הפקדים הבאים; i) PCR בלי תבנית ה-DNA, ii) PCR על ה-DNA מופק ספוגית סטרילית נקי ו- iii) PCR על מעורבות החילוץ פתרון דילול. עבור פקדים חיובית, אנו ממליצים כולל דוגמאות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת עם תחל לבר-קוד הפוכה שונים ודוגמאות מן הקודם פועל כמו בקרת איכות פנימית. ראוי לציין, פקדים אחרים חיובי אופציונלי כדי לשמש הן את הסטנדרטים מדידה microbiome הללו, שסופקו על-ידי NIST. הממוצע קורא כיסוי עבור הפקדים שלילי נמוך במידה ניכרת לעומת דגימות צואה בפועל (טבלה 1) וכללה בעיקר מ taxa Mycoplasma. הראנו נוסף לשיפור העקביות של רצף התוצאות המתקבלות באמצעות דגימות אחד שמקורם באותו חומר צואתי, אך זה עבר הכנה בספרייה אחרת (איור 3). תוצאה זו גם מאשרת כי, כאשר משתמשים בשיטה המשולבת שלנו, יש אין זיהום צולב בין דגימות.
ב פרוטוקול זה נסקור פרוטוקול משולב במדים, ריאלי לנתח מספר רב של דוגמאות. פרוטוקול זה שמטרתו להדריך מדענים מעוניין ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, זול, מפורט מתוך אוסף צואה כדי ניתוח נתונים, באמצעות פקדי חשוב. באמצעות פרוטוקול מודרך מפורט מתוקננת זה, ייתכן למזער תופעות אצווה ומאפשרים תוצאות דומות יותר רצף בין מעבדות שונות.

מרוכזים מאמצים נעשו כדי להבין טוב יותר microbiome גיוון ושפע, כמו היבט נוסף של לכידת ההבדל ונקודות הדמיון בין אנשים בריאים ופתולוגיים בתנאים. גיל2,3, גאוגרפיה4,5,סגנון חיים6ו מחלה5 הוצגו להיות מזוהה עם ההרכב של microbiome הבטן, אבל התנאים אוכלוסיות רבות טרם אושרו במלואן מאופיין. לאחרונה דווח כי ניתן לשנות את microbiome עבור יישומים טיפוליים-7,-8,-9. לכן, נוספים תובנות לגבי מערכת היחסים בין מצבים פיזיולוגיים שונים ההרכב מיקרוביאלי הוא הצעד הראשון לקראת אופטימיזציה של שינויים עתידיים פוטנציאליים.
השיטות התרבות חיידקים המסורתית מוגבלים על ידי תשואות נמוכות10,11, נתפסים כמו מדינה בינארי חיידקים איפה גם להציג בבטן או לא. תפוקה גבוהה מבוסס DNA רצף יש מהפכה אקולוגיה מיקרוביאלית, הפעלת לכידתו של כל חברי הקהילה מיקרוביאלי. עם זאת, רצף לקרוא אורך ואיכות נותרו מכשולים משמעותיים טקסונומיה מדויק הקצאה12. יתר על כן, ניסויים לפי תפוקה גבוהה עלולים לסבול מתופעות אצווה, איפה מדידות מושפעים הלא-ביולוגיים או לא מדעי משתנים13. בשנים האחרונות הוקמו מספר תוכניות כדי ללמוד את microbiome האנושית, כולל הפרויקט בטן אמריקאי, פרוייקט Microbiome האנושי של ארצות הברית (ארה ב) של הפרויקט MetaHIT הממלכה המאוחדת (בריטניה). היוזמות הללו יצרו כמויות אדירות של נתונים שאינם השוואה בקלות עקב חוסר עקביות הגישות שלהם. מגוון רחב של פרויקטים בינלאומיים כגון האיחוד הבינלאומי Microbiome האנושי, הפרויקט לסטנדרטים Microbiome האנושית בינלאומיים, ואת המכון הלאומי לתקנים וטכנולוגיה (NIST) ניסה להתמודד עם בעיות אלה,14 , ופיתח תקנים עבור מדידות microbiome אשר צריך לאפשר את ההישג של תוצאות אמינות הרבייה. המתוארים כאן הוא פרוטוקול משולב של מספר15,בשימוש רחב16 עבור מטוסי אף-16 rRNA תפוקה גבוהה רצף (16-seq) מתחיל דגימת צואה מקולקציית לצורך הערכה ניתוח נתונים. הפרוטוקול מתאר גישה ללא עמודים PCR, תוכנן במקור עבור חילוץ ישיר של צמח ה-DNA16, כדי לאפשר טיפול בו זמנית מספר גדול של צואה דגימות תוך זמן קצר יחסית עם איכות גבוהה מוגבר DNA עבור ממוקד קביעת רצף של אזור V4 משתנה חיידקים על פלטפורמה משותפת רצף. פרוטוקול זה שמטרתו להדריך מדענים מעוניין ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, מפורט, באמצעות פקדי חשוב. יש פרוטוקול שלב מודרכים ומפורט אחר עשוי לצמצם את ההשפעה אצווה, ובכך יאפשר תוצאות דומות יותר רצף בין מעבדות.

<table>
	<tbody>
		<tr>
			<td>Primers</td>
			<td>Integrated DNA Technologies (IDT)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Extraction solution</td>
			<td>Sigma-Aldrich</td>
			<td>E7526</td>
			<td></td>
		</tr>
		<tr>
			<td>Dilution solution</td>
			<td>Sigma-Aldrich</td>
			<td>D5688</td>
			<td></td>
		</tr>
		<tr>
			<td>Kapa HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPABIOSYSTEMS</td>
			<td>KK2601</td>
			<td>PCR Master mix</td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Reagent kit</td>
			<td>Invitrogen</td>
			<td>P7589</td>
			<td>dsDNA quantify reagent</td>
		</tr>
		<tr>
			<td>MinElute Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28606</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Amresco</td>
			<td>0710-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra Pure Water Dnase and Rnase Free</td>
			<td>Biological Industries</td>
			<td>01-866-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS assay kit</td>
			<td>Molecular probes</td>
			<td>Q32854</td>
			<td>dsDNA detecting kit</td>
		</tr>
		<tr>
			<td>High Sensitivity D1000</td>
			<td>Agilent Technologies</td>
			<td>Screen Tape 5067-5582</td>
			<td>separation and analysis</td>
		</tr>
		<tr>
			<td>Screen Tape Assay</td>
			<td>Agilent Technologies</td>
			<td>Reagents 5067-5583</td>
			<td>for DNA libraries</td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>15017666</td>
			<td>control library</td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v2 (500 cycle)</td>
			<td>Illumina</td>
			<td>MS-102-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Amresco</td>
			<td>E406-10mL-TAM</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL collection tubes</td>
			<td>SARSTEDT</td>
			<td>72.695.400</td>
			<td>Safe Seal collection tubes</td>
		</tr>
		<tr>
			<td>Plastic stick swab in PP test tube</td>
			<td>STERILE INTERIOR</td>
			<td>23117</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Machine</td>
			<td>Applied Biosystems</td>
			<td>2720 Thermal Cycler</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequncing Machine</td>
			<td>Illumina</td>
			<td>Miseq</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR workstation</td>
			<td>Biosan</td>
			<td>UV-cleaner</td>
			<td></td>
		</tr>
		<tr>
			<td>scissors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>vortexer</td>
			<td>Scientific Industries</td>
			<td>Vortex-Genie 2</td>
			<td></td>
		</tr>
	</tbody>
</table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

Microbiome מעיים אנושיים ממלאת תפקיד מרכזי בהגנה על התאים מפני פגיעה, עיבוד אנרגיה וחומרים מזינים, ובקידום חסינות. סטיות מן מה נחשב קומפוזיציה microbiota בריא (dysbiosis) עשוי לפגום תפקידים חיוניים מובילים לתנאים פיפטות. מאמצי מחקר האחרונות ומתמשכים מכוונת כלפי אפיון השיוכים בין הרכב מיקרוביאלי, מחלה ובריאות האדם.
ההתקדמות טכנולוגיות רצף תפוקה גבוהה מאפשרים אפיון ההרכב חיידקים במעיים. שיטות אלה כוללות 16 rRNA-אמפליקון רצף ורצף רובה ציד. מטוסי אף-16 rRNA-אמפליקון רצף משמש פרופיל taxonomical הרכב, ואילו רובה רצף מספקת מידע נוסף אודות הגן תחזיות, ביאור פונקציונלי. יתרון באמצעות שיטה רצף יישוב של rRNA 16 גנים באזור משתנה הוא עלותו נמוכות משמעותית לעומת רובה רצף. רצף הבדלים ג'ין rRNA מטוסי אף-16 משמשים כמו טביעת חיידקים כדי לזהות ולכמת taxa שונים בתוך דוגמה אישית.
המאמצים הבינלאומיים הגדולים נשאר תקנים עבור מטוסי אף-16 rRNA-אמפליקון רצף. עם זאת, מספר מחקרים מדווחים ממקור משותף של וריאציה הנגרמת על ידי אפקט אצווה. כדי למזער את האפקט הזה, פרוטוקולים במדים לאיסוף הדגימה, עיבוד, ורצף חייב ליישם. פרוטוקול זה מציע השילוב של פרוטוקולים משמש בהרחבה מתחיל מאוסף דגימת צואה ניתוח נתונים. פרוטוקול זה כולל גישה ישירה-PCR ללא עמודים, המאפשרת טיפול בו זמנית, הפקת דנ א מספרים גדולים של דגימות צואה, יחד עם ה-PCR הגברה של אזור V4. בנוסף, הפרוטוקול מתאר את הצינור ניתוח ומספק קובץ script באמצעות הגירסה העדכנית ביותר של QIIME (QIIME 2 גירסה 2017.7.0 ו- DADA2). פרוטוקול צעד אחר צעד זה נועד כדי להנחות את אלו המעוניינים ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, מפורט.

איור סכמטי הפרוטוקול מוצג באיור1.
אספנו פרוספקטיבי דגימות צואה של מאושפזים חולים עם חשד שלשול זיהומיות. הדגימות הוגשו למעבדה למיקרוביולוגיה קלינית במרכז הרפואי שיבא בין פברואר מאי 2015, כפי שתואר לעיל1. דגימות צואה נחשפו לתרבות מיקרוביולוגית קונבנציונאלי שבוצעה במעבדה למיקרוביולוגיה קלינית וכדי רחב תפוקה גבוהה 16-seq במקביל. בנוסף, דגימות צואה של מבוגרים בריאים היו רציף להשוואה.
ניתוח זה, הפוקוס היה על בקרת האיכות של נתונים, וכן תוצאות נציג של הפלט המתקבל QIIME217. בתחילה, נבחנו תוצאות רצף בתאריך 6 דוגמאות שליטה שלילי עבור בקרת איכות כולל: i) PCR בלי תבנית ii) PCR על דגימות נקי וסטרילי בפתרון החילוץ, דילול, iii) PCR על הוצאה מעורבת, דילול פתרונות. בטבלה 2 מראה שיש כל שליטה שלילי דוגמאות ≤118 הכולל קריאות (ממוצע של רצפי 29), בעיקר מן taxa Mycoplasma, בעוד אחרים כל דוגמאות ניתח הראה אומר סה כ קורא של 10622.57 (שגיאת התקן ±1211.34) ולקרוא Mycoplasma אין עברו את בקרת האיכות של הדגימות הראשי.
דוגמאות 16 כי אחד מקורם צואה אותו אבל עבר הכנה בספרייה אחרת עם תחל לבר-קוד הפוכה שונים שימשו כפקדי חיובי. הדגימות 16 כלל 8 עם תרבויות חיוביות קמפילובקטר, סלמונלהאו שיגלה אשר דווחו על ידי המעבדה למיקרוביולוגיה קלינית ו- 8 זה דווחו כבעלי תרביות שליליות. מגרש שטח ברמת phyla מוצג באיור2. דוגמאות מקורם צואה אותו, אך עבר בספרייה אחרת הכנה לבר-קוד הפוכה שונים תחל להראות עקבי מאוד יחסית שפע (מבחן מדף בין כפילויות השפע היחסי בטקסונומיה רמת מערכה ערכים מדומה ערך-p = עונה 1 פרק 10-04 בהתבסס על משכפל 9999).
ניתוח נקודות הציון העיקריות (PCoA), אשר מפחית-ממדיות של נתוני הקלט, שימש על המטריצה UniFrac לחקור באופן חזותי מדגם ההפרדה ואת הדמיון. ב- איור 3A, דגימות ברצף שמקורם באותה דגימת זרע המקורי שרפרף אך עבר הכנה בספרייה אחרת צבעוניים אותו ואכן, אלה מצויים יחסית מקרוב בעלילה PCoA (האח מבחן בין כפילויות PC1 PC2 ערכים מדומה ערך-p = 1e-04 בהתבסס על משכפל 9999). בנוסף, המרחק גיוון בטא unifrac unweighted הממוצע בין דגימות במחקר זה הוא 0.706, ואילו המרחק הממוצע בין שני כפילויות הוא 0.235 (סכום דרגה Wilcoxon לבדוק ערך-p = 4.205 x 10-11). מעניין, דגימות שהיו תרבות חיובי עבור קמפילובקטר, סלמונלהאו שיגלה enteropathogens הראו ערכי PC1 שונה באופן משמעותי (סכום דרגה Wilcoxon לבדוק ערך-p = 0.011) לעומת דגימות עם תוצאות שליליות תרבות. איור 3B מציגה עלילה PCoA זהה אך עכשיו דוגמאות הן צבעוניות על ידי שפע יחסי של פרוטאובקטריה. בדגימות עם שפע פרוטאובקטריה גבוהה היה שונה באופן משמעותי PC1 ערכים (מתאם ספירמן r =-0.533, ערך-p = 0.000975). תוצאות אלה עקביים עם ניתוח קודמות של נתונים אלה, שבו מאושפזים יש עליות עמוקה ב taxa מפרוטאובקטריה מערכה1. כאן הראינו כי PC1 הוא מתואם עם שפע פרוטאובקטריה, עם דוגמאות חיוביות התרבות קיבוץ באשכולות בעיקר בצד אחד של PC1 ציר ותרבות שלילי הדגימות קיבוץ באשכולות בעיקר בצד השני, יחד עם הדגימות בריא.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56845/56845fig1.jpg"> איור 1 : תרשים זרימה של דגימות צואה לשפע מיקרוביאלי יחסית. 1) טיפול לדוגמה: שמאל, דגימות צואה נאספים בשפופרת ספוגית סטרילית. . נכון, גודל מקל אוזניים מותאמת על ידי חיתוך זה כדי לאפשר סגירת שפופרת 2 מ"ל ואחסון. 2) הפקת דנ א: ה-DNA מופק על ידי גישה נטולת עמודות ה-PCR ישירה. 3) ספריית הכנה: שמאל, μL 4 של ה-DNA שחולץ מוגבר עם קדימה/הפוכה-אינדקס תחל. פריימר הפוכה כל מכיל ברקוד בסיס 12. כל מדגם מוגבר דולר. צלחת 96-ובכן מכיל 32 ברקודים שונים. נכון, לשלב כל ברקוד triplicate לתוך צינור אחסון יחיד. צלחת 96-ובכן מכיל 96 ברקודים שונים. 4) ספריית כמת: החלונית העליונה, הקרנת עבור דגימות חיוביות, amplicons אותרו על ג'ל שהוכתמו אתידיום ברומיד agarose 1%. פאנל התחתונה, כימות amplicons חיובי כדי להגיע equimolar ריכוז אמפליקון ng 500 מ כל מדגם לתוך בריכה בספריה מסוימת. 5) ספריית טיהור: החלונית העליונה, ספריית במאגר היא ג'ל שחולצו עבור בחירת גודל והיטהרות. בחלונית התחתונה, גודל מדויק הספרייה הריכוז נמדד. 6) רצף: תפוקה גבוהה רצף של הספרייה במאגר. 7) ניתוח המידע רצף על ידי צינור bioinformatic עבור מטוסי אף-16 rRNA-אמפליקון אקולוגיה מיקרוביאלית. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56845/56845fig2.jpg"> איור 2 : שפע יחסית עקבית בין דגימות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת. השפע היחסי בטקסונומיה ברמת מערכה מוצג עבור דגימה כמצוין. השפע היחסי מוצג עבור 16 דגימות צואה המתקבל חולים מאושפזים עם שלשול זיהומיות חשד כי אחד עבר הכנה בספרייה אחרת (כפולים 1 ו- 2) עם תחל שונים לבר-קוד הפוכה, של פקדים בריא 3. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56845/56845fig3.jpg"> איור 3 : גיוון פילוגנטי להראות תוצאות עקביות עבור דגימות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת. ניתוח נקודות הציון העיקריות (PCoA) המפחיתה-ממדיות של נתוני הקלט שימש על המטריצה UniFrac לחקור באופן חזותי מדגם ההפרדה ואת הדמיון. המרחק בין שני מדגמים מייצגת את ההבדל בהרכב microbiome שלהם. מגרש UniFrac PCoA Unweighted (א). כל נקודה מייצגת דוגמה אחת ברצף. דוגמאות מקורם של צואה המקורית באותו צבעוניים אותו דגימות מחולים מאושפזים עם התרבות צואה חיוביים שדווחו על-ידי ה מיקרוביולוגיה קלינית1 שסומנו על-ידי ריבועים, חולים מאושפזים עם התרבות שלילית אצל משולשים1, ומבוגרים בריאים מריצה רצף נפרד1 מסומנים עם מלא במעגלים. (B) PCoA אותו כמו A, אך דוגמאות עכשיו צבעוניים על ידי שלהם שפע יחסי של פרוטאובקטריה, כמצוין. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>פריימר שם</td>
			<td>פריימר רצף</td>
			<td>תיאור פריימר</td>
		</tr>
<tr>
<td>פריימר לפנים</td>
			<td>AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>5' מתאם רצף - pad פריימר לפנים - קדימה מקשר פריימר - פריימר לפנים</td>
		</tr>
<tr>
<td>הפוך אינדקס פריימר</td>
			<td>CAAGCAGAAGACGGCATACGAGAT - CC. תודה על הטרמפ - AGTCAGTCAG - - GACTACHVGGGTWTCTAAT</td>
			<td>הפוך המשלים של 3' מתאם רצף - ברקוד Golay - פריימר הפוכה pad - מקשר פריימר הפוכה - הפוכה פריימר</td>
		</tr>
<tr>
<td>1 קריאה רצף פריימר</td>
			<td>TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>להעביר משטח פריימר - קדימה מקשר פריימר - פריימר לפנים</td>
		</tr>
<tr>
<td>פריימר רצף קריאה 2</td>
			<td>AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT</td>
			<td>הפוך פריימר pad - מקשר פריימר הפוכה - פריימר הפוכה</td>
		</tr>
<tr>
<td>אינדקס רצף פריימר</td>
			<td>ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT</td>
			<td>הפוך המשלים של פריימר הפוכה - הפוכה המשלים של מקשר פריימר הפוכה - המשלים הפוכה של משטח פריימר הפוכה</td>
		</tr>
</tbody></table>טבלה 1: רשימת פריימר.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>מדגם</td>
			<td>מספר קריאות פוסט בקרת איכות הראשונית ב QIIME</td>
		</tr>
<tr>
<td>PCR-מטליות נקי בפתרון החילוץ, דילול-1</td>
			<td>118</td>
		</tr>
<tr>
<td>PCR-מטליות נקי בפתרון החילוץ, דילול-2</td>
			<td>39</td>
		</tr>
<tr>
<td>PCR בלי תבנית-1</td>
			<td>0</td>
		</tr>
<tr>
<td>PCR בלי תבנית-2</td>
			<td>0</td>
		</tr>
<tr>
<td>PCR על שילוב פתרונות חילוץ, דילול - 1</td>
			<td>16</td>
		</tr>
<tr>
<td>PCR על שילוב פתרונות חילוץ, דילול - 2</td>
			<td>0</td>
		</tr>
<tr>
<td>דוגמאות (זאת אומרת ± תקן שגיאה)</td>
			<td>10622.57 ± 1211.34</td>
		</tr>
</tbody></table>טבלה 2: מספר קריאות עבור פקדים שלילי, דגימות צואה.
1 חומר משלים: עיבוד נתונים script. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl1_script.txt">אנא לחץ כאן כדי להוריד את הקובץ.</a>
2 חומר משלים: מיפוי קובץ. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl2_map.txt">אנא לחץ כאן כדי להוריד את הקובץ.</a>
3 חומר משלים: ערכת פריימר. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56845/56845_Suppl3_schematic_primers_representation.pptx">אנא לחץ כאן כדי להוריד את הקובץ.</a>

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

כתב יד זה מתאר פרוטוקול מתוקננת מפורט של תפוקה גבוהה מטוסי אף-16 rRNA-אמפליקון רצף. הפרוטוקול מציג פרוטוקול משולב, לובשי מדים, ריאלי וזולה החל באיסוף הנתונים ניתוחים דגימת צואה. פרוטוקול זה מאפשר ניתוח של מספר רב של דוגמאות עם סטנדרטים קפדניים מספר פקדים.

פרוטוקול מודרך לקבלת צואה אפיון חיידקים על ידי מטוסי אף-16 rRNA-אמפליקון רצף

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Nanyang Technological University

Research

JoVE Journal

Biology

19.4K Views.  Sheba Medical Center. כתב יד זה מתאר פרוטוקול מתוקננת מפורט של תפוקה גבוהה מטוסי אף-16 rRNA-אמפליקון רצף. הפרוטוקול מציג פרוטוקול משולב, לובשי מדים, ריאלי וזולה החל באיסוף הנתונים ניתוחים דגימת צואה. פרוטוקול זה מאפשר ניתוח של מספר רב של דוגמאות עם סטנדרטים קפדניים מספר פקדים.

Video: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Pyrosequencing for Microbial Identification and Characterization

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains, and detect genetic mutations that confer resistance to anti-microbial agents. In this video, the procedure for microbial amplicon generation, amplicon pyrosequencing, and DNA sequence analysis will be demonstrated.

Pyrosequencing לזיהוי ואפיון חיידקים

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

במעקב 4 ממדי Vivo של תאי גזע ואבות היווצרות דם במבוגרי עכבר calvarial מח עצם

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

רצף של הדור הבא של 16S ריבוזומלי amplicons ג&#39;ין RNA

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

קשירת יעילה ביותר של RNA קטן מולקולות לMicroRNA Quantitation על ידי רצף תפוקה גבוהה

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

ממוקד DNA מתילציה ניתוח על ידי רצף של הדור הבא

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

בידוד של אזורים הגנומי ספציפיים וזיהוי של Associated מולקולות על ידי enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

ניתוח Glucocorticoid צואה: לא פולשני ניטור הכליה ב Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

הפקת חומצות גרעין יעיל 16S rRNA ג&#39;ין רצף עבור בקטריאלי קהילת אפיון

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 &#946;-lactamase selected at a clinically relevant dosage of ampicillin are provided.

פרוטוקול והערכה תפקודית של ספריות mutagenesis רווית Whole-חלבון ניצול רצף תפוקה גבוהה

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to poorly folding proteins or random open reading frames. We have developed a strategy where, by using TEM-1 &#946;-lactamase (the enzyme conferring ampicillin resistance) on a genomic scale, we can select collections of correctly folded protein domains from the coding portion of the DNA of any intronless genome. The protein fragments obtained by this approach, the so called &#34;domainome&#34;, will be well expressed and soluble, making them suitable for structural/functional studies.
By cloning and displaying the &#34;domainome&#34; directly in a phage display system, we have showed that it is possible to select specific protein domains with the desired binding properties (e.g., to other proteins or to antibodies), thus providing essential experimental information for gene annotation or antigen identification.
The identification of the most enriched clones in a selected polyclonal population can be achieved by using novel next-generation sequencing technologies (NGS). For these reasons, we introduce deep sequencing analysis of the library itself and the selection outputs to provide complete information on diversity, abundance and precise mapping of each of the selected fragment. The protocols presented here show the key steps for library construction, characterization, and validation.

The protocols described allow the construction, characterization and selection (against the target of choice) of a &#34;domainome&#34; library made from any DNA source. This is achieved by a research pipeline that combines different technologies: phage display, a folding reporter and next generation sequencing with a web tool for data analysis.

Interactome-Seq: פרוטוקול עבור ספריית Domainome ובניה, אימות בחירה Phage התצוגה ורצף הדור הבא

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...