מחקר נתמך על ידי ניו המפשייר- INBRE באמצעות פרס פיתוח מוסדי (IDeA), P20GM103506, מהמכון הלאומי למדעי הרפואה הכללית של NIH.

<ol>
	<li>Shimada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+serotyping+scheme+for+Vibrio+cholerae.">Extended serotyping scheme for Vibrio cholerae.</a> Curr. Microbiol. 28 (3), 175-178 (1994).</li><li>Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+serogroups+of+Vibrio+cholerae+non-O1+non-O139+with+specific+reference+to+their+ability+to+produce+cholera+toxin,+and+addition+of+novel+serogroups.">Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups.</a> Jpn. J. Infect. Dis. 71 (10), 1037-1045 (1997).</li><li>Karaolis, D. K., Lan, R., Reeves, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+sixth+and+seventh+cholera+pandemics+are+due+to+independent+clones+separately+derived+from+environmental,+nontoxigenic,+non-O1+Vibrio+cholerae.">The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae.</a> J. Bacteriol. 177 (11), 3191-3198 (1995).</li><li>Albert, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+epidemic+of+cholera-like+disease+in+Bangladesh+caused+by+Vibrio+cholerae+O139+synonym+Bengal.">Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal.</a> Lancet. 342 (8868), 387 (1993).</li><li>Barua, D., Barua, D., Greenough III, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=History+of+Cholera.">History of Cholera.</a> Cholera. , 1-36 (1992).</li><li>Morales, R., Delgado, G., Cravioto, A., Faruque, S. M., Nair, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population+Genetics+of+Vibrio+cholerae.">Population Genetics of Vibrio cholerae.</a> Vibrio cholerae-Genomics and Molecular Biology. , 29-47 (2008).</li><li>Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+of+classical+and+El+Tor+cholera+in+Dhaka,+Bangladesh:+17-year+trends.">Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends.</a> Trans. R. Soc. Trop. Med. Hyg. 77 (6), 853-856 (1983).</li><li>Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Vibrio+cholerae+O1+El+Tor+biotype+variant+clinical+isolates+from+Bangladesh+and+Haiti,+including+a+molecular+genetic+analysis+of+virulence+genes.">Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes.</a> J. Clin. Microbiol. 49 (11), 3739-3749 (2011).</li><li>Ghosh-Banerjee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholera+toxin+production+by+the+El+Tor+variant+of+Vibrio+cholerae+O1+compared+to+prototype+El+Tor+and+classical+biotypes.">Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes.</a> J. Clin. Microbiol. 48 (11), 4283-4286 (2010).</li><li>Ansaruzzaman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholera+in+Mozambique,+variant+of+Vibrio+cholerae.">Cholera in Mozambique, variant of Vibrio cholerae.</a> Emerg. Infect. Dis. 10 (11), 2057-2059 (2004).</li><li>Ansaruzzaman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+diversity+of+El+Tor+strains+of+Vibrio+cholerae+O1+with+hybrid+traits+isolated+from+Bangladesh+and+Mozambique.">Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique.</a> Int. J. Med. Microbiol. 297 (6), 443-449 (2007).</li><li>Lan, R., Reeves, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pandemic+spread+of+cholera:+genetic+diversity+and+relationships+within+the+seventh+pandemic+clone+of+Vibrio+cholerae+determined+by+amplified+fragment+length+polymorphism.">Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism.</a> J. Clin. Microbiol. 40 (1), 172-181 (2002).</li><li>Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+variants+of+Vibrio+cholerae+O1+biotype+El+Tor+with+attributes+of+the+classical+biotype+from+hospitalized+patients+with+acute+diarrhea+in+Bangladesh.">New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh.</a> J. Clin. Microbiol. 40 (9), 3296-3299 (2002).</li><li>Nair, G. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Vibrio+cholerae+O1+strains+similar+to+pre-seventh+pandemic+El+Tor+strains+during+an+outbreak+of+gastrointestinal+disease+in+an+island+resort+in+Fiji.">Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji.</a> J. Med. Microbiol. 55 (11), 1559-1562 (2006).</li><li>Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y., Faruque, S. M., Nair, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+hybrid+variants+of+Vibrio+cholerae+O1.">Emerging hybrid variants of Vibrio cholerae O1.</a> Vibrio cholerae—Genomics and Molecular Biology. , 179-190 (2008).</li><li>Safa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+characteristics+of+Matlab+variants+of+Vibrio+cholerae+O1+that+are+hybrids+between+classical+and+El+Tor+biotypes.">Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes.</a> J. Med. Microbiol. 55 (11), 1563-1569 (2006).</li><li>Nusrin, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+CTX+phages+among+toxigenic+Vibrio+cholerae+O1+and+O139+strains+isolated+between+1994+and+2002+in+an+area+where+cholera+is+endemic.">Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic.</a> J. Clin. Microbiol. 42 (12), 5854-5856 (2004).</li><li>Carignan, B. M., Brumfield, K. D., Son, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+nucleotide+polymorphisms+in+regulator-encoding+genes+have+an+additive+effect+on+virulence+gene+expression+in+a+Vibrio+cholerae+clinical+isolate.">Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate.</a> mSphere. 1 (5), e00253 (2016).</li><li>Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture+conditions+for+stimulating+cholera+toxin+production+by+Vibrio+cholerae+O1+El+Tor.">Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor.</a> Microbiol. Immunol. 30 (11), 1075-1083 (1986).</li><li>DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulatory+cascade+controls+virulence+in+Vibrio+cholerae.">Regulatory cascade controls virulence in Vibrio cholerae.</a> Proc. Natl. Acad. Sci. USA. 88 (12), 5403-5407 (1991).</li><li>Kovacikova, G., Lin, W., Skorupski, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duel+regulation+of+genes+involved+in+acetoin+biosynthesis+and+motility/biofilm+formation+by+the+virulence+activator+AphA+and+the+acetate-responsive+Lys-R+type+regulator+AlsR+in+Vibrio+cholerae.">Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae.</a> Mol. Microbiol. 57 (2), 420-433 (2005).</li><li>Vogel, H. J., Bonner, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylornithinase+of+Escherechia+coli:+partial+purification+and+some+properties.">Acetylornithinase of Escherechia coli: partial purification and some properties.</a> J. Biol. Chem. 218 (1), 97-106 (1956).</li><li>Son, M. S., Taylor, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+and+biochemical+assays+to+characterize+Vibrio+cholerae+O1+biotypes:+classical+and+El+Tor.">Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor.</a> Curr. Protoc. Microbiol. , 6A.2.1-6A.2.17 (2011).</li><li>Kovacikova, G., Skorupski, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+virulence+gene+expression+in+Vibrio+cholerae+by+quorum+sensing:+HapR+functions+at+the+aphA+promoter.">Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter.</a> Mol. Microbiol. 46 (4), 1135-1147 (2002).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+prevalence+of+functional+quorum-sensing+systems+in+recently+emerged+Vibrio+cholerae+toxigenic+strains.">The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains.</a> Environ. Microbiol. Rep. 3 (2), 218-222 (2011).</li><li>Sanders, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aseptic+laboratory+techniques.">Aseptic laboratory techniques.</a> J. Vis. Exp. (63), e3064 (2012).</li><li>Martinez, R. M., Megli, C. J., Taylor, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+laboratory+maintenance+of+Vibrio+cholerae.">Growth and laboratory maintenance of Vibrio cholerae.</a> Curr. Protoc. , 6A.1.1-6A.1.6 (2010).</li></ol>

למחברים אין מה לחשוף.

של מעל 200 מזוהה V. Cholerae serogroups, רק O1 ו O139 יש פוטנציאל מגיפה. ניתן לחלק את הסרוגרופ O1 לשני ביו-טיפוסים: קלאסית ואל טור. עם זאת, זנים היברידיים, הנקראים אל ור גורפים 13 , 17 , התברר כי בעלי רקע ביוטיפ אל Tor, ומאפיינים קלאסיים הנמל 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . הפרוטוקולים המתוארים בכתב יד זה נועדו לספק לחוקרים, המעוניינים לאפיין ו / או להבחין בין מבודדים קליניים ולא קליניים שונים של V. cholerae, עם אמיניםרב assay מערכת זיהוי. שימוש רב מהימן assay מערכת זיהוי כחלופה היא שיפור מעל בעבר הוקמו יחיד assay מערכות זיהוי ומסכים גנטית אינטנסיבית עבודה. כל מבחני genotypic ו פנוטיפי צריך לכלול WT קלאסית זן O395 ו WT אל זנים C6706 ו N16961 להשוואה ( טבלה 1 ). בעוד הזנים הקלאסיים ו El Tor ביוטיפ כלולים עבור התייחסות, מבודד, כגון MQ1795 ו BAA-2163 כלולים במחקר שלנו, יכולים להציג פרופילים פנוטיפי מ ביוטיפ או ( איור 2 , איור 3 , איור 4 , איור 5 , איור 6 , איור 7 , טבלה 2 ), המדגים את הצורך בניתוח של תכונות גנוטיפיות ופנוטיפיות רבות לאפיון אמין. כל פרוטוקולים צריך להתבצע aseptical26 בטמפרטורת החדר, אלא אם צוין אחרת. אשר Cholerae הוא רמה 2 של Biosafety 2 (BSL-2) פתוגן כי הוא סוכן etiological של קטלני מחלה קטלנית קטלני; טיפול נאות וסילוק של כל החומרים ומוצרי הפסולת חייבים להיות נאכפים לפי תקנות מוסדיות, מקומיות, מדינה ופדרליות. הכנה של כל חומרי התקשורת ואת ריאגנטים חייב להתבצע באמצעות ריאגנטים כיתה אנליטית ו ultrapure מים deionized לרגישות מינימלית של 18 MΩ ס&quot;מ. לפני עיבוד, התקשורת צריכה להיות מוכנה ומותר יבש מספיק (1-2 ימים); לוחות נחשבים יבש מספיק כאשר נוזל נשאר על פני השטח של אגר. בשל טווח המוטציה ואזורי הסילוק המקיפים את הגידול החיידקי, לוחיות הניידות והחלביות צריכות להיות מוכנות במנות פטרי גדולות (150 מ&quot;מ x 15 מ&quot;מ) עד 50 מ&quot;ל לכל צלחת, וניתן לאחסן אותן עד שבוע עטוף בפלסטיק , LiD בצד למטה ב 4 מעלות צלזיוס. בנוסף, ריכוז אגר של לוחות התנועה יכול להיות מותאם להאט את תנועתיות; עם זאת, לא מומלץ יעלה על 3 גרם של אגר לכל פתרון 500 מ&quot;ל, כמו זה יהיה להפחית באופן משמעותי את התנועה הכללית כך ההבדלים לא יהיה ניתן לצפייה. כל שאר התקשורת צלחת צריך להיות מוכן כ 25 מ&quot;ל לכל צלחת בגודל סטנדרטי פטרי צלחות (100 מ&quot;מ x 15 מ&quot;מ) והוא יכול להיות מאוחסן עד שישה חודשים עטוף פלסטיק, בצד המכסה למטה ב 4 מעלות צלזיוס. להכנת צלחות פולימקסין B, חשוב לאפשר מדיה מותכת להתקרר לאחר מעוקר לפני הוספת polymyxin B, כמו חום מוגזם יכול להשפיל אנטיביוטיקה. צלחות Polymyxin B ניתן לאחסן עד 3 חודשים עטוף פלסטיק, המכסה בצד למטה ב 4 מעלות צלזיוס. הבדיקות שנדונו בכתב יד זה דורשות יום לצמיחה של מושבה אחת (12-16 שעות), יום נוסף לצמיחה של תרבויות לילה (12-16 שעות), ויום שלישי לשיקולים של גנוטיפי (~ 4 שעות עבור DN כרומוזומליבידוד ו 3 שעות עבור PCR) או מבחני פנוטיפי (18-48 ח &#39;, טבלה 2 ). לפני הניתוח הביוכימי של מבחני פנוטיפי המתוארים בכתב יד זה, תרבויות יש לשטוף 1x PBS כדי למנוע תרבות שיורית התקשורת carryover מתוצאות מוטה. בנוסף, polyyxin B, ציטראט, פעילות פרוטאז, המוליזה, מבחני התנועה עשוי להיות מחוסן בו זמנית באמצעות תרבות לילה שטף אחד. כאשר מציגים מדיה מצופה, מתיז של תרבויות עשוי להתרחש והוא יכול לגרום זיהום לחצות בין זנים. כדי למנוע מתיז, למנוע לחלוטין פולטת תרבות פיפטה, במקום להפסיק את פליטת התרבות בתחנה הראשונה של פיפטה. בנוסף, לאפשר כתמים לספוג באופן מלא לתוך פני אגר לפני הדגירה, ולוודא לא לנקב את אגר, אשר יכול להשפיע על התוצאות. מבחני פנוטיפי המביאים לאזורי סריקה ( איור 4 , איור 5 , טבלה 2)) ו / או תנועתיות ( איור 6 , טבלה 2 ) סביב הנקודה של חיסון, צריך להיות מרווח מרבי כדי למנוע מיזוג של אזורים של סיקול או צמיחה, בהתאמה, שבו בקטרים ​​בהתאמה ניתן למדוד לניתוח השוואתי. לאחר הדגירה פעמים, מבודדים ניתן הדמיה ונותחו ביחס זנים התייחסות ביוטיפ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961). המסכים הגנטיים מבוססי PCR באמצעות רצף המתואר בכתב היד הזה ניתן להשתמש כדי לזהות את הרקע הבודד של הבודד ביחס ctxB ו tcpA , בעקבות הגברה הראשונית PCR. הנחיות סטנדרטיות רצף דורשים כמות מסוימת של מוצר PCR בהתאם לגודל של האזור מוגבר (580 bp עבור ctxB ו 1420 bp עבור tcpA ), ועל הגדרת התגובות, פרוטוקולים הוקמה ניתן לעקוב. בקצרה, קדימה הפרט וראוורור רצף התגובות צריך להיות מוכן עם 3-5 pmol של פריימר / תגובה, ואת נפח צריך להיות מותאם μl 20 עם מים ultrapure סטרילית צינור microcentrifuge 1.5 מ&quot;ל. לסיוע בעיצוב פריימר עבור הגברה PCR ו רצף, כלי עיצוב פריימר NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ יכול להיות מנוצל. הגברה מוצלחת ורצף של ctxB ו- tcpA הושגו באמצעות הפריימרים הבאים (5 &#39;→ 3&#39;): ctxB- קדימה GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB הפוך CATXCGAACCACAAAAACTCTTACTGAGG, tcpA - קדימה CCGCACCAGATCCACGTAGGTGGG, tcpA - הפוך GTCGGTACATCACCTGCTGTGGGGGCAG. יש לציין כי כל אזור קידוד של ctxB נשמר על פני שני ביוטיפים למעט עמדות בסיס 115 ו 203 (שניהם ציטוזין קלאסית ו תימין באל טור). בנוסף, ב tcpA , שינויי בסיס מרובים נשמרים בין biotypes כי דעפר על פני שני ביוטיפים ( טבלה 1 ), אשר ניתן להשתמש בהם כדי לעזור להבחין בין biotypes. במחקרים מעבדה רבים הקשורים אורגניזם מודל V. Cholerae, תחזוקה נכונה וטכניקות culturing הם קריטיים 27 . שיעורי הצמיחה של V נפוץ. Cholerae ביוטיפ זנים התייחסות, כגון WT קלאסית זן O395 ו WT אל Tor זן N16961, יכול לספק תובנה שימושית אפיון אל מבודדים אל Tor משתנה ( איור 1 : טבלה 2 ). בגלל שיעורי הצמיחה המשתנים על פני V. Cholerae מבודד, חשוב לקחת קריאת ספקטרופוטומטר קריאות בכל שעה עד התרבויות להגיע עכירות מקסימלית במהלך השלב נייח מאוחר. אמצע המוות עד שלב מאוחר לא יכול להיות דמיינו בשל הרמה עכירות הנובעות עודף פסולת הסלולר. דילול 1: 4 של תרבות סטרילית L<html> B תוצרת צריכה להתבצע כדי להשיג עקומת צמיחה מלאה ולשמור על דיוק של המכשיר, כמו הקריאה ספיגת שיא ב OD 600 ≈ 1.0. בעת ביצוע עקומות הצמיחה על זנים מרובים, קריאות ספיגה צריך להיות מתוזמן כ 5 דקות בנפרד עבור כל זן כדי להבטיח עקביות בין הקריאות. הבנת V. Cholerae ביוטיפ שיעורי הצמיחה הם קריטיים עבור חקירות רבות, כולל ארסיות ביטוי גנים מחקרים, ניתוח של פעילויות מטבוליות, ראוי culturing ותנאי אחסון. עבור ניתוח שלאחר מכן, תרבויות לילה צריך להיות מעובד ביומן מאוחר בשלב נייח מוקדם של צמיחה (12-16 שעות) כדי למקסם את צמיחת התאים עדיין לשמור על שלמות הסלולר. התנאים התרבויות עבור זנים קלאסיים אל טור ביוטיפ דומים, עם זאת, ניתוח של ביטוי גנים ארסיות ב V. Cholerae דורש ביוטיפ ספציפי ארסיות גרימת תנאיםRef. &quot;19. שני הגורמים העיקריים ארסיות CT ו- TCP, נשלטים על ידי הרגולטור הראשי ToxT, והם באים לידי ביטוי אופטימלי בתנאי צמיחה ספציפיים, למשל, תחת אל Tor ארסיות גרימת התנאים ToxT ניתן לנתח על ידי עיבוד תמצית התא כולו ( WC), או גלולה התא, בשעה 3.5 שעות, בעוד ביטוי CT ו- TCP ניתן לנתח על ידי עיבוד supernatant ללא תאים ו WCE ב 7.5 שעות, בהתאמה 8 , 20. תכונות גנוטיפיות שונות פנוטיפי שהודגם לאורך כתב היד הזה מלמדים כיצד מגוון רחב של ביוטיקים מסוג Cholerae יכול להיות, ולהמחיש את הצורך חלופה בשימוש בעבר אפיון יחיד ביוטיפ assay.

כולרה היא מחלה של המעי הדק הרחוק שנגרם על ידי הצריכה של מזון מזוהם או מים המכילים את החיידק הגראמי שלילי חיידקים Vibrio cholerae. תסמינים של כולרה כוללים הקאות ושילשול מימי בלתי נשלט, מה שמוביל להתייבשות קשה, אשר אם לא מטופלים כראוי, יביא למוות. אשר Cholerae יכול להיות מחולק ליותר מ 200 serogroups מבוסס על המבנה של משטח התא lipopolysaccharide O- אנטיגן. עם זאת, רק 2 serogroups, O1 ו O139, הראו מגיפה או פוטנציאל מגיפה 1 , 2 . יתר על כן, serogroup O139 היה מבודד בעיקר בדרום מזרח אסיה 3 , 4 , בעוד serogroup O1 מופץ ברחבי העולם. יתר על כן, ניתן לחלק את הסרוגרופוס O1 לשני ביו-טיפוסים עיקריים: קלאסית ואל טור. הביוטיפ הקלאסי היה אחראי על מגיפת הכולרה הראשונהS בין 1817 ו 1923. המגיפה השביעית המתמשכת היא תוצאה של ביוטיפ אל טור, אשר גלשו באופן גלובלי את הביוטיפ הקלאסי בסביבה 5 , 6 , 7 . לאחרונה נוצרו זנים המכילים מאפיינים ייחודיים של ביו-טיפוסים קלאסיים ואל-טוריים 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 ומאז נקראו אל וריאנטים של אל טור 13 , 17 . כמה גרסאות של אל-טור הראו יכולות ארסיות גבוהות עם התקדמות מחלה מהירה וחמורה יותר ממה שנצפתה קודם לכן, והדגישהצורך בגישה מקיפה יותר לזיהוי סוכן ומניעת מחלות וטיפול 8 , 9 , 18 . בעוד הזיהוי של ביו-טיב אינו מכתיב מיד טיפול, התקדמות נוספת בפיתוח החיסונים ובסוכני הטיפול העתידיים עשויה להפיק תועלת מהבחנה ביו-טייתית. הסדרה הראשונה של הפרוטוקולים המפורטים כאן תאפשר לחוקרים לשמור כראוי V. Cholerae זנים במעבדה הגדרה. עקביות וניתוח שלאחר מכן דורש הכנת מלאי וצמיחה של מבודדים, אשר אינו תלוי ביו-טיב. עם זאת, כדי לגרום באופן אופטימלי ביטוי גנים ארסיות, ביוטיפ עצמאית טכניקות culturing ספציפיים נדרשים 19 . בנוסף, הכנה לבדיקות גנטיות וביוכימיות שונות מתוארים בכתב יד זה. כולרה רעלן (CT) ואת רעלן שיתוף reגלוטן gulated (TCP) הם שני הגורמים העיקריים ארסיות נשלט על ידי הרגולטור הראשי ToxT בשני biotypes של V. Cholerae O1 serogroup 20 . CT הוא רעלן דו-חמצני המורכב מחמש CtxB תת יחידות המקיפות יחידה אחת של CtxA, ואחראית על אובדן אלקטרוליטים מהיר הקשור לכולרה. TCP הוא סוג IV פילוס מקודדים על ידי tcp operon ( tcpABqCRDSTEF ), והוא מעורב בהתקשרות ו קולוניזציה של המעי הדק הרחוק. TcpA הוא הגן הראשון של אופרון tcp אשר מקודד את יחידות יחידת הפרט Pilin חיוני לבנייה של הפילוס 8 . רצף הגן עבור ctxA נשמר לחלוטין בין ביוטיקים קלאסיים אל Tor, בעוד ctxB ו tcpA נבדלים על פני שני biotypes אבל נשמרים בתוך כל ביוטיפ 8 . CtxB נשמר לחלוטין בין biotypes למעט שתי posi בסיסTions (115 ו 203). ב biotype אל Tor, thymine מתגורר בנקודות הבסיס 115 ו 203, בעוד הביוטיפ הקלאסי מכיל ציטוזין בבסיסים אלה. Tcpa נשמר לחלוטין בתוך כל ביוטיפ, אך נבדלים בסיסים מרובים בין biotypes. הבדלים גנטיים אלה משמשים כסימני זיהוי ביו-טיים ראשוניים, ולאחר סידור תגובת תגובת שרשרת הפולימרז (PCR), כולל אלה, ניתן לבודד רצפים מבודדים עם O395 או WT El N1696 הקלאסית מסוג Wild-type כדי לקבוע את הרקע הביוטיפי של CT ו- TCP, בהתאמה, ב V. cholerae נתון לבודד. פרוטוקולים רבים פותחו על מנת לאפיין את ההבחנות הפנוטיפיות בין הביוטיקים הקלאסיים לאל טור , 21 , 22 , 23 . Polymyxin B הוא אנטיביוטיקה פפטיד כי compromises את יושרה של קרום התא החיצוני ב- Gram שלילי bacTeria, ואת התנגדות polyixxin B יכול להיות דמיינו דרך assay התנגדות polymyxin B 21 . ציטרט הוא המצע העיקרי של מחזור של Kreb, ואת היכולת metabolize ציטרט כמקור פחמן יחיד ניתן לקבוע באמצעות assay מטבוליזם ציטראט 22 . HapR מקודד הרגולטור העולמי ו הרגולטור חישה המניין קוורום ב V. cholerae, HapR, אשר נקשר לאזורים שונים האמרגן מסדיר ביטוי הגן האופרה 24 . כמה זנים פתוגניים של V. cholerae יש באופן טבעי מוטציה משמרת מסגרת בגן hapR שגרם זה צפיפות תלויה תקנה של ביטוי גנים ארסיות לאיבוד 24 , 25 . מדידת פעילות פרוטאז HAPR-regulated באמצעות מדיה אגר חלב מאפשר החוקר כדי לזהות אם לבודד מסוים מכיל HAPR תפקודית 23 . הבדיקות המוליזה של המעי הגס על יכולתו של מתח להפריש אנזימים hemolytic כי lyse תאי דם אדומים; את מידת המוליזה יכול להיות דמיינו על צלחות אגר דם 23 . תנועתיות קשורה לעיתים קרובות עם ארסיות V. cholerae וניתן לנתח באמצעות לוחות אגר התנועה 23 . מבחני ה- Voges-Proskauer בודקים את יכולתו של זן להסיס את הגלוקוז כמקור פחמן יחיד ומייצרים את התוצר האסייתי 21 . עם הופעת גרסאות אל Tor, קשה לחזות את התוצאות של assay פנוטיפי נתון ללא בדיקות genotypic נרחב, ולפני deducing את הרקע של ביוטייפ של V. Cholerae מבודד, מומלץ לבצע את הרכבה זו של מבחני 23 ולהשוות את התוצאות זנים התייחסות כמו בטבלה 2 . כאן, יש לנו סדרה מתקדמת של פרוטוקולים, באופן קולקטיבי ניצול foreeeהבחינו genotypic ו מבחני פנוטיפי לגישה מקיפה יותר לאפיון V. ביוטכנולוגי כולרה . יתר על כן, יש לנו תיאר את ההבחנה גנוטיפי פנוטיפי של V ידוע. Cholerae אל Tor וריאנטים (MQ1795 ו BAA-2163), בהשוואה זנים התייחסות ביוטיפ נפוץ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961, טבלה 1 ). הופעתה של גרסאות אל Tor הציגה אתגרים האמינות של המועסקים בעבר פרוטוקול יחיד אפיון ביו-טיוב אפיון; עם זאת, זה מספר רב של מערכת זיהוי assay יאפשר אפיון אמין יותר של קליני וסביבתי V. כולסטרס מבודד.

<table border="0" cellpadding="0" cellspacing="0" width="1403">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:367px;">1 kb DNA Ladder</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:171px;">N3232S</td>
			<td style="width:683px;">https://www.neb.com/products/n3232-1-kb-dna-ladder</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">60% Glycerol</td>
			<td>Calbiochem</td>
			<td>356352</td>
			<td>http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar</td>
			<td>Becto, Dickinson and Co.</td>
			<td>214030</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar with brain-heart infusion</td>
			<td>Becto, Dickinson and Co.</td>
			<td>237500</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose</td>
			<td>Peqlab</td>
			<td>732-2789</td>
			<td>https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&#38;_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&#38;_dynSessConf=1766917479792147141&#38;targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&#38;lastLanguage=en&#38;/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&#38;_D%3AcurrentLanguage=+&#38;currentLanguage=en&#38;_D%3AlastLanguage=+&#38;_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anhydrous K2HPO4</td>
			<td>Fisher Scientific</td>
			<td>P288-500</td>
			<td>https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&#38;searchTerm=P288500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Blood Agar Plates</td>
			<td>Remel</td>
			<td>R01200</td>
			<td>Store at 4 &#176;C;&#160; http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td>Fisher Scientific</td>
			<td>A73-500</td>
			<td>https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&#38;searchTerm=A73500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bromothymol Blue</td>
			<td>Fisher Scientific</td>
			<td>B388-10</td>
			<td>https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&#38;searchTerm=B38810&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cirtric acid &#183;H2O</td>
			<td>Fisher Scientific</td>
			<td>S72836-3</td>
			<td>https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Deoxynucleotide (dNTP) Solution Kit</td>
			<td>New England Biolabs</td>
			<td>N0446S</td>
			<td>Store at -20 &#176;C;&#160; https://www.neb.com/products/n0446-deoxynucleotide-solutionset</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Disodium EDTA</td>
			<td>Fisher Scientific</td>
			<td>S311-500</td>
			<td>https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&#38;searchTerm=S311500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNA Clean &#38; Concentrator&#8482; -25 Kit</td>
			<td>Zymo Research</td>
			<td>D4007</td>
			<td>http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GelGreen Nucleic Acid Stain</td>
			<td>Biotium</td>
			<td>41005</td>
			<td>https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10000x-in-water/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Genesys 10SUV-VIS Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>840-208100</td>
			<td>https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentra Puregene Yeast/Bact. Kit</td>
			<td>Qiagen</td>
			<td>158567</td>
			<td>https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HCl</td>
			<td>Fisher Scientific</td>
			<td>A144-212</td>
			<td>Corrosive;&#160; https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&#38;searchTerm=A144212&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KCl</td>
			<td>Fisher Scientific</td>
			<td>P217-500</td>
			<td>https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&#38;searchTerm=P217500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KH2PO4</td>
			<td>Fisher Scientific</td>
			<td>P285-500</td>
			<td>https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&#38;searchTerm=P285500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KOH</td>
			<td>Fisher Scientific</td>
			<td>P250-500</td>
			<td>https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&#38;searchTerm=P250500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Le Loop</td>
			<td>Decon Labs Inc.</td>
			<td>MP190-25</td>
			<td>http://deconlabs.com/products/leloop/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Le Stab</td>
			<td>Decon Labs Inc.</td>
			<td>MP186-5</td>
			<td>http://deconlabs.com/products/lestab/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgSO4&#183;7H2O</td>
			<td>Fisher Scientific</td>
			<td>M63-500</td>
			<td>https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&#38;searchTerm=M63500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mini-Sub Cell GT Horizontal Electrophoresis System</td>
			<td>Bio Rad Labs</td>
			<td>1704406</td>
			<td>http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&#38;WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&#38;WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MR-VP Broth</td>
			<td>Difco</td>
			<td>216300</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Na2HPO4</td>
			<td>Fisher Scientific</td>
			<td>S374-500</td>
			<td>https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&#38;searchTerm=S374500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td>Fisher Scientific</td>
			<td>S271-10</td>
			<td>https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&#38;searchTerm=S27110&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaHCO3</td>
			<td>Fisher Scientific</td>
			<td>S233-500</td>
			<td>https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&#38;searchTerm=S233500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaNH4HPO4&#183;4H2O</td>
			<td>Fisher Scientific</td>
			<td>S218-500</td>
			<td>https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&#38;searchTerm=S218500&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoDrop Lite Spectrophtometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td>https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonfat dry milk</td>
			<td>Nestle Carnation</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Peptone</td>
			<td>Becto, Dickinson and Co.</td>
			<td>211677</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Petri Dishes (100 mm x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>FB0875712</td>
			<td>https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Petri Dishes (150 mm x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>FB0875714</td>
			<td>https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&#38;searchTerm=FB0875714&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polymyxin B sulfate salt</td>
			<td>Sigma-Aldrich</td>
			<td>P1004-10MU</td>
			<td>Store at 2-4 &#176;C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&#38;region=US</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England Biolabs</td>
			<td>M0273S</td>
			<td>Store at -20 &#176;C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>M0273S</td>
			<td>Store at -20 &#176;C;&#160; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermal Cycler Bio-Rad C1000 Touch&#8482;&#160;</td>
			<td>Bio Rad Labs</td>
			<td>1840148</td>
			<td>http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&#38;_pageLabel=search_page&#38;sfMode=search&#38;sfStartNumber=1&#38;clearQR=true&#38;js=1&#38;searchString=1840148&#38;database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&#38;tabName=DIVISIONNAME</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Triphenyltetrazolium chloride</td>
			<td>Alfa Aesar</td>
			<td>A10870</td>
			<td>https://www.alfa.com/en/catalog/A10870/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-1</td>
			<td>https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&#38;searchTerm=BP1521&#38;searchType=RAPID</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris&#8729;HCl</td>
			<td>Calbiochem</td>
			<td>9310</td>
			<td>http://www.emdmillipore.com/US/en/product/OmniPur-TRIS-Hydrochloride---CAS-1185-53-1---Calbiochem,EMD_BIO-9310-OP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tryptone</td>
			<td>Becto, Dickinson and Co.</td>
			<td>211705</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>Becto, Dickinson and Co.</td>
			<td>212750</td>
			<td>http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&#38;parentCategory=&#38;parentCategoryName=&#38;categoryId=&#38;categoryName=&#38;searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">&#945;-napthol</td>
			<td>MP Biomedicals</td>
			<td>204189</td>
			<td>http://www.mpbio.com/product.php?pid=05204189</td>
		</tr>
	</tbody>
</table>

laboratory techniques used to maintain and differentiate biotypes of vibrio cholerae clinical and environmental isolates

החיידק הגרימי שלילי של גראם הוא Vibrio cholerae הוא הסוכן האטיולוגי של כולרה זיהומית זיהומית. בשל השכיחות והחומרה הגלובלית של המחלה, V. Cholerae נחקרה בהרחבה הן בהגדרות סביבתיות והן במעבדה, המחייבת תחזוקה נאותה וטכניקות טיפוח. קלאסי ואל טור הם שני ביו-טיפוסים עיקריים המרכיבים את ה- V. Cholerae O1 serogroup, שכל אחד מהם מציג מאפיינים גנוטיפיים ופנוטיפיים ייחודיים המספקים מנגנונים אמינים לאפיון ביוטיפ, ודורשים ארסיות מובהקות הגורמות לתרבות. ללא קשר לביוטיפ של זן סיבתי עבור כל זיהום או פרוץ מסוים, הטיפול הסטנדרטי עבור המחלה כולל טיפול rehydration בתוספת משטר של אנטיביוטיקה. עם זאת, סיווג ביוטיפ עשוי להיות נחוץ ללימודי מעבדה ועלולות להיות השפעות רחבות יותר בתחום הביו-רפואי.בתחילת שנות האלפיים, זוהו הבדידות הקליניות, אשר הציגו תכונות גנוטיפיות ופנוטיפיות הן מהביוטיקים הקלאסיים והן מהאל-טור. ההיברידיות שזוהו לאחרונה, המכונה אל וריאציות של אל-טור, גרמו לקליניקה ולסביבה לזהות בידוד ביו-טיפוסי כדי להיות מורכבות יותר מאשר בפרוטוקולי זיהוי מסורתיים בודדים. בנוסף לתיאור V. Cholerae תחזוקה כללית ו culturing טכניקות, כתב היד הזה מתאר סדרה של גנים ספציפיים ( ctxB ו tcpA ) מסכי PCR מבוססי PCR ו מבחנים פנוטיפי (התנגדות polyyxin B, מטבוליזם ציטראט, פעילות proteolytic, פעילות hemolytic, תנועה, ומטבוליזם גלוקוז באמצעות Voges- Assay Proskauer) השתמשו באופן קולקטיבי לאפיין ו / או להבדיל בין ביוטוסים קלאסיים לאל טור. יחד, מבחני אלה מספקים גישה שיטתית יעילה לשמש חלופה, או בנוסף, יקר, ניסויים עתירי עבודה ב characterizaשל V. Cholerae קליני (וסביבתי) מבודד.

עבור תחזוקה נאותה ושימוש בכל זן חיידקי, מומלץ לדעת את זמן הכפלה של זן (ים) של עניין. הנה, את שיעורי הצמיחה המשתנים של V נפוץ. זנים cholerae הודגמו דרך עקומת הצמיחה, ואת זמני הכפלה משוער חושבו באמצעות רגרסיה ליניארית. WT El Tor N16961 ו El Tor וריאנט MQ1795 הוכיחו פעמים הכפלת קצר (~ 1 שעה ו ~ 1 שעות, בהתאמה) מאשר WT קלאסי O395 (~ 2 שעות) ( איור 1 , טבלה 2 ). V. cholerae מניפולציה גנטית ניתוח שלאחר מכן לעתים קרובות מסתמך על היכולת להבחין כראוי בין biotypes. PCR מבוסס גנטי מסכי מבחני פנוטיפי יושמו באופן קולקטיבי כמערכת אמינה להבחין בין רקע ביוטיפ של V. Cholerae קליני וסביבתי iסולטים; עבור ייצוג, זנים ייחוס ביוטיפ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961) וכן אלגורנטים נציג אל (MQ1795 ו BAA-2163) נכללו ( טבלה 1 ). WT קלאסי O395 הפגינו ctxB קלאסי רצפים tcpA. לעומת זאת, WT אל Tor זנים N16961 ו C6706 הפגינו אל Tor ctxB ו tcpA sequences. מעניין, MQ1795 ו BAA-2163 הכיל את ביוטיפ קלאסי ctxB יחידת משנה להשוות O395, אך שתי גירסאות אל Tor הכיל את tcpA מעיד על רקע ביוטיפ אל Tor ( טבלה 1 ). WT קלאסי ביוטיפ זן O395 הראו רגישות polyyxin B, בעוד זנים WT אל טור ביוטיפ (C6706 ו N16961) הראו התנגדות הציג צמיחה על צלחות אגר LB בתוספת פולימקסין B. נציג אל טור זנים שונים (MQ1795 ו BAA-2163) הפגינו התנגדות דומה לאנטיביוטיקה ביחס ל - WT El Bi biotype stra(C6706 ו- N16961) ( איור 2 : טבלה 2 ). WT קלאסי ביוטיפ זן O395 לא גדל על התקשורת ציטראט מינימלית, ואילו WT אל זנים Tor (C6706 ו N16961) היו מסוגלים לנצל ציטרט כמקור פחמן צמיחה בתערוכות ציטראט מינימלי. נציג אל טור זנים ביוטיפ משתנה (MQ1795 ו BAA-2163) הפגינו צמיחה דומה לזו של זנים BiType WT אל טור (C6706 ו N16961) ( איור 3 , טבלה 2 ). WT קלאסי זן O395 ו WT אל Tor זן N16961 להחזיק HAPR לא פונקציונלי, ולכן, לא להפגין HAPR- מוסדר פעילות פרוטאז; WT אל Tor זן C6706, וכן נציג אל Tor וריאנטים (MQ1795 ו BAA-2163) הם hapR -positive-visualized כאזור של סיקול הנובע מנקודת החיסון ( איור 4 , טבלה 2 ). WT קלאסית זן O395 אינו מפריש האנזימים hemolytic והיה שםE-γ-hemolytic, בעוד זנים ביוטיפ WT אל WT Tor (C6706 ו N16961) ו נציג אל Tor זר סוגים שונים (MQ1795 ו BAA-2163) להפריש אנזימים hemolytic כי לחלוטין lyse תאי דם אדומים המקיפים את נקודת החיסון הראו β המוליזה ( איור לוח 2 ). תנועתיות משתנה על פני, ובתוך, זנים ביוטיפ; עם זאת, WT אל Tor זן N16961 ו אל Tor וריאנטים (MQ1795 ו BAA-2163) הפגינו יתר על המידה בהשוואה נימה WT קלאסית פחות יחסית O395 ו WT אל זן C6706 ( איור 6 , טבלה 2 ). WT קלאסי O395 ו נציג אל וריאנטים נציג לא metabolize גלוקוז לייצר אצטון, ואילו זן WT אל ביוטיפ זנים מיוצר אצטון כתוצר לוואי של תסיסה גלוקוז, כפי שצוין על ידי פיתוח של צבע אדום עמוק במהלך Assay Voges-Proskauer ( איור 7 לוח 2 ). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td rowspan="2"> מתח </td><td colspan="3"> CtxB ג &#39;ין </td><td> TcpA </td><td rowspan="2"> התייחסות </td></tr><tr><td> בסיס 115 </td><td> בסיס 203 </td><td> ביוטיפ </td><td> ביוטיפ </td></tr><tr><td> O395 </td><td> ג </td><td> ג </td><td> קלַאסִי </td><td> קלַאסִי </td><td> 8 </td></tr><tr><td> C6706 </td><td> T </td><td> T </td><td> אל טור </td><td> אל טור </td><td> 8 </td></tr><tr><td> N16961 </td><td> T </td><td> T </td><td> אל טור </td><td> אל טור </td><td> 8 </td></tr><tr><td> MQ1795 </td><td> ג </td><td> ג </td><td> קלַאסִי </td><td> אל טור </td><td> 13 </td></tr><tr><td> BAA-2163 </td><td> ג </td><td> ג </td><td> קלַאסִי </td><td> אל טור </td><td> 8 </td></tr></tbody></table> טבלה 1: ביוטיפ תלוי גנטי הבחנות של Vibrio cholerae הפניה זנים. שמופיעים בטבלה זו הם השינויים בסיס DNA ו עמדות יחסית גנים ctxB ו tcpA . WT קלאסי O395 ו WT אל זנים N16961 ו C6706 משמשים בדרך כלל זנים התייחסות ביוטיפ. MQ1795 ו BAA-2163 ידועים וריאנטים El Tor. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td rowspan="2"> Assay </td><td rowspan="2"> יישום </td><td rowspan="2"> בחירה בינונית </td><td rowspan="2"> דְגִירָה </td><td colspan="5"> תוצאות צפויות </td></tr><tr><td> O395 </td><td> C6706 </sTrong&gt; </td><td> N16961 </td><td> MQ1795 </td><td> BAA-2163 </td></tr><tr><td> 2.3) עקומת הצמיחה 27 </td><td> קובע זמני הכפלה של זני כולסטרס שונים </td><td> 1.2) LB Liquid נוזלי </td><td> עד 30 שעות (37 ° C עם אוורור) </td><td> ~ 2 שעות </td><td> ND * </td><td> ~ 1 h </td><td> ~ 1 h </td><td> ND * </td></tr><tr><td rowspan="2"> 3.1) PCR מבוסס מסך גנטי באמצעות ctxB ו tcpA 8 </td><td> מבחין בין רקע קלאסי אל ביוטיפ אל טור של ctxB </td><td> N / A </td><td> N / A </td><td> קלַאסִי </td><td> אל טור </td><td> אל טור </td><td> קלַאסִי </td><td> קלַאסִי </td></tr><tr><td> מבדיל בין רקע קלאסי אל ביוטיפ אל Tor של tcpA </td><td> N / A </td><td> N / A </td><td> קלַאסִי </td><td> אל טור </td><td> אל טור </td><td> אל טור </td><td> אל טור </td></tr><tr><td> 3.2) התנגדות Polymyxin B 21 </td><td> רגישות לפולימיקסין אנטיביוטי ב </td><td> 1.5) LB אגר צלחות בתוספת polyyxin B </td><td> 18 שעות (37 ° C) </td><td> - </td><td> + </td><td> + </td><td> + </td><td> + </td></tr><tr><td> 3.2) מטבוליזם של ציטראט 22 </td><td> יכולת חילוף חומרים ציטראט כמקור פחמן יחיד </td><td> 1.6) מינימלי ציטרט בינוני אגר צלחות </td><td> 24 שעות (37 ° C) </td><td> - </td><td> + </td><td> + </td><td> + </td><td> + </td></tr><tr><td> 3.2) קזין הידרוליזה 23 </td><td> HAPR-regulated פעילות פרוטאז </td><td> 1.7) לוחות אגר חלב </td><td> 18 שעות (37 ° C) </td><td> - </td><td> - </td><td> + </td><td> + </td><td> + </td></tr><tr><td> 3.2) המוליזה 23 </td><td> מודד פעילות המוליטית </td><td> לוחות אגר דם </td><td> 48 שעות (37 ° C) </Td&gt; <td> גמא </td><td> בטא </td><td> בטא </td><td> בטא </td><td> בטא </td></tr><tr><td> 3.3) תנועתיות 23 </td><td> מידת התנועה של התנועה </td><td> 1.8) לוחות אגר </td><td> 14-24 שעות (37 ° C) </td><td> 10 מ&quot;מ </td><td> 15 מ&quot;מ </td><td> 21 מ&quot;מ </td><td> 25 מ&quot;מ </td><td> 29 מ&quot;מ </td></tr><tr><td> 3.4) Voges-Proskauer 21 </td><td> מודד יכולת התסיס גלוקוז לייצר אצטון כתוצר לוואי </td><td> 1.9) בינוני נוזלי Voges-Proskauer </td><td> עד 4 שעות (טמפרטורת החדר) </td><td> - </td><td> + </td><td> + </td><td> - </td><td> - </td></tr><tr><td colspan="9"> הערה: &quot;ND *&quot; מציין לא נקבע; &quot;+&quot; מציין תוצאה חיובית; &quot;-&quot; מציין תוצאה שלילית </td></tr></tbody></table> טבלה 2: סיכום המבחנים הגנטיים והפנוטיפיים המשמשים עבור </stRong&gt; ויבריו cholerae ביוטיפ הבחנה. טבלה זו מסכמת את המבחנים הגנטיים והפנוטיפיים השונים, היישומים, והתוצאות הצפויות המשמשות להבדיל בין ביו-טיפוסים קלאסיים לאל-טור המשמשים במחקר זה. מספרי פרוטוקול והפניות לפרוטוקולים ספציפיים מסומנים בעמודה Assay. &quot;ND *&quot; מציין לא נחוש; &quot;+&quot; מציין תוצאה חיובית; &quot;-&quot; מציין תוצאה שלילית. <img alt="איור 1" class="xfigimg" src="/files/ftp_upload/55760/55760fig1.jpg" /> איור 1: V. Cholerae צמיחה עקומה של WT קלאסי O395, WT אל Tor N16961, ו אל Tor Variant MQ1795. שיעורי הצמיחה של זנים התייחסות ביוטיפ (WT קלאסי O395 ו WT אל Tor N16961) נציג אל Tor וריאנט MQ1795, גדל במרק LB עם אוורור ב 37 מעלות צלזיוס, נותחו על ידי מדידת OD 600 eשעה מאוד מתחילה ב- T 0 . עקומות הצמיחה בוצעו על 8 משכפל ניסיוני עצמאי, עם כל לשכפל המייצג אירוע culturing עצמאית עבור כל משפט. WT אל Tor זן N16961 ו אל Tor וריאנט MQ1795 הוכיחו פעמים הכפלת קצר (~ 1 שעה ו ~ 1 שעות, בהתאמה) ביחס WT קלאסית זן O395 (~ 2 שעות), כפי שנצפה על ידי זמן הכפלה ארוכה יותר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" class="xfigimg" src="/files/ftp_upload/55760/55760fig2.jpg" /> איור 2: קביעת ההתנגדות Polymyxin B באמצעות LB Agar מוסף עם Polymyxin B. ההתנגדות לאנטיביוטיקה peptide polymyxin B נקבע על ידי היכולת לגדול על אגר LB בתוספת 50 IU / μLx פולימקסין B. WT זן קלאסי O395 הראה שום צמיחה על אגר An UniversityEmented עם polymyxin B ונחשב רגיש לאנטיביוטיקה. בעוד WT אל Tor זנים (C6706 ו N16961) ונציג אל ור גירסאות (MQ1795 ו BAA-2163) הציג צמיחה בנוכחות אנטיביוטיקה נחשבו עמידים polymyxin ב צלחות הודגרו ב 37 מעלות צלזיוס במשך 18 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" class="xfigimg" src="/files/ftp_upload/55760/55760fig3.jpg" /> איור 3: מדידת מטבוליזם של סיטראט באמצעות מדיה מינימלית של ציטראט. היכולת לנצל ציטרט כמקור פחמן יחיד נקבעה על ידי יכולתו של הבודד לגדול באמצעי ציטראט מינימלי. WT קלאסית זן O395 לא גדל על מדיה ציטראט מינימלי (שלילי). הצמיחה ניכרת בכל זני WT El Tor (C6706 ו- N16961) ונציג אלוריאציות טור (MQ1795 ו BAA-2163), אשר הוכיחו את היכולת לנצל ציטרט כמקור פחמן יחיד (חיובי). צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" class="xfigimg" src="/files/ftp_upload/55760/55760fig4.jpg" /> איור 4: מדידת HAPR- מוסדר Proteolytic קאסין הידרוליזה באמצעות חלב אגר מדיה. CASIN הידרוליזה דרך HAPR- מוסדר פעילות פרוטאז נקבע על ידי אזור חזותי של אישור סביב נקודת החיסון על אגר חלב. זנים המכילים HAPR לא פונקציונלי, כגון WT קלאסית זן O395 ו WT אל זן N16961, לא לייצר אזור של סיקול סביב הנקודה של חיסון ( hapR- שלילי). WT אל Tor זן C6706 נציג אל וריאנטים אל Tor (MQ1795 ו BAA-2163) מכילים HAPR פונקציונלי, אשר יכול להיות דמיינו כמו אזורי גודל משתנה של אישור ( hapR- positive). צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" class="xfigimg" src="/files/ftp_upload/55760/55760fig5.jpg" /> איור 5: מדידת הפעילות המוליטית באמצעות אגר דם מדיה. הפעילות המוליטית נמדדה באמצעות צלחות אגר בתוספת דם של כבשים. WT קלאסי זן O395 אינו מפריש אנזימים כי lyse תאי דם אדומים (γ-hemolytic). WT אל Tor זנים (N16961 ו C6706) ו נציג אל ור גירסאות (MQ1795 ו BAA-2163) להפריש אנזימים hemolytic, אשר הביא לאזור שקופה של סיקול סביב נקודת החיסון (β-hemolytic). צלחות הודגרו בגיל 37° C במשך 48 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig5large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" class="xfigimg" src="/files/ftp_upload/55760/55760fig6.jpg" /> איור 6: קביעת תנועתיות באמצעות לוחות אגר ניידות. האזור של תנועתיות צוין על ידי שינוי צבע ויזואלי של TTC מלח אשר הופך מאדום לאדום כאשר מטבוליזם, המציין היכן חיידקים עברו. WT הקלאסי O395 (10 מ&quot;מ) ו WT אל טור זן C6706 (15 מ&quot;מ) הוכיחו תנועתיות מינימלית, ואילו אל הטור N16961 (21 מ&quot;מ) ונציג אל וריאנטים (MQ1795 (25 מ&quot;מ) ו BAA-2163 (29 מ&quot;מ) ) הפגינו תנועתיות יתר ביחס ל- O395 ו- C6706. צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig6large.jpg" target="_blank">בבקשה תלחץ</a>כאן כדי להציג גרסה גדולה יותר של דמות זו. <img alt="איור 7" class="xfigimg" src="/files/ftp_upload/55760/55760fig7.jpg" /> איור 7: Voges-Proskauer Assay. ייצור Acetoin באמצעות תסיסה גלוקוז נקבע באמצעות Assay Voges-Proskauer. WT קלאסי זן O395 ו נציג אל וריאנטים אל Tor (MQ1795 ו BAA-2163) לא לייצר אצטון כתוצאה תסיסה גלוקוז (שלילי). WT אל זנים Tor (N16961 ו C6706) הפיק את התוצר אצטון והוא יכול להיות דמיינו על ידי שינוי צבע אדום עמוק (חיובי). צינורות הודגרו בטמפרטורת החדר למשך 4 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55760/55760fig7large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates at JoVE.com

Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates

כתב יד זה מתאר ראוי Vibrio cholerae טכניקות תחזוקה בנוסף סדרה של מבחני ביוכימי, מנוצל קולקטיבית עבור הבחנה מהירה ואמינה בין קליני וסביבתי V. ביו-טיפוסים של כולרה במעבדה.

טכניקות מעבדה המשמשות לשמירה על ביו-טיפוסים של<em&gt; ויבריו כולרה</em&gt; בידוד קליני ואיכותי

The aquatic Gram-negative bacterium Vibrio cholerae is the etiological agent of the infectious gastrointestinal disease cholera. Due to the global ...

laboratory-techniques-used-to-maintain-differentiate-biotypes-vibrio

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates

10.8K Views.  Plymouth State University.  כתב יד זה מתאר ראוי Vibrio cholerae טכניקות תחזוקה בנוסף סדרה של מבחני ביוכימי, מנוצל קולקטיבית עבור הבחנה מהירה ואמינה בין קליני וסביבתי V. ביו-טיפוסים של כולרה במעבדה. 

Video: Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

באמצעות assay הפאן ויראלי microarray (Virochip) אל מסך דוגמאות קליניות עבור פתוגנים ויראליים

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Multiplex זיהוי של חיידקים דוגמאות מורכבות קלינית הסביבה באמצעות oligonucleotide מצמידים פלורסנט microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Colonization of Euprymna scolopes Squid by Vibrio fischeri

Specific bacteria are found in association with animal tissue1-5. Such host-bacterial associations (symbioses) can be detrimental (pathogenic), have no fitness consequence (commensal), or be beneficial (mutualistic). While much attention has been given to pathogenic interactions, little is known about the processes that dictate the reproducible acquisition of beneficial/commensal bacteria from the environment. The light-organ mutualism between the marine Gram-negative bacterium V. fischeri and the Hawaiian bobtail squid, E. scolopes, represents a highly specific interaction in which one host (E. scolopes) establishes a symbiotic relationship with only one bacterial species (V. fischeri) throughout the course of its lifetime6,7. Bioluminescence produced by V. fischeri during this interaction provides an anti-predatory benefit to E. scolopes during nocturnal activities8,9, while the nutrient-rich host tissue provides V. fischeri with a protected niche10. During each host generation, this relationship is recapitulated, thus representing a predictable process that can be assessed in detail at various stages of symbiotic development. In the laboratory, the juvenile squid hatch aposymbiotically (uncolonized), and, if collected within the first 30-60 minutes and transferred to symbiont-free water, cannot be colonized except by the experimental inoculum6. This interaction thus provides a useful model system in which to assess the individual steps that lead to specific acquisition of a symbiotic microbe from the environment11,12.
Here we describe a method to assess the degree of colonization that occurs when newly hatched aposymbiotic E. scolopes are exposed to (artificial) seawater containing V. fischeri. This simple assay describes inoculation, natural infection, and recovery of the bacterial symbiont from the nascent light organ of E. scolopes. Care is taken to provide a consistent environment for the animals during symbiotic development, especially with regard to water quality and light cues. Methods to characterize the symbiotic population described include (1) measurement of bacterially-derived bioluminescence, and (2) direct colony counting of recovered symbionts.

Colonization of Euprymna scolopes Squid by Vibrio fischeri

The method outlines the procedure by which the Hawaiian bobtail squid, Euprymna scolopes and its bacterial symbiont, Vibrio fischeri, are raised separately and then introduced to allow for specific colonization of the squid light organ by the bacteria. Colonization detection by bacterially-derived luminescence and by direct colony counting are described.

קולוניזציה של Euprymna scolopes קלמארי על ידי Vibrio fischeri</em

Specific bacteria are found in association with animal tissue1-5. Such host-bacterial associations (symbioses) can be detrimental (pathogenic), have no ...

TransFLP &#x2014; A Method to Genetically Modify Vibrio cholerae Based on Natural Transformation and FLP-recombination

Several methods are available to manipulate bacterial chromosomes1-3. Most of these protocols rely on the insertion of conditionally replicative plasmids (e.g. harboring pir-dependent or temperature-sensitive replicons1,2). These plasmids are integrated into bacterial chromosomes based on homology-mediated recombination. Such insertional mutants are often directly used in experimental settings. Alternatively, selection for plasmid excision followed by its loss can be performed, which for Gram-negative bacteria often relies on the counter-selectable levan sucrase enzyme encoded by the sacB gene4. The excision can either restore the pre-insertion genotype or result in an exchange between the chromosome and the plasmid-encoded copy of the modified gene. A disadvantage of this technique is that it is time-consuming. The plasmid has to be cloned first; it requires horizontal transfer into V. cholerae (most notably by mating with an E. coli donor strain) or artificial transformation of the latter; and the excision of the plasmid is random and can either restore the initial genotype or create the desired modification if no positive selection is exerted. Here, we present a method for rapid manipulation of the V. cholerae chromosome(s)5 (Figure 1). This TransFLP method is based on the recently discovered chitin-mediated induction of natural competence in this organism6 and other representative of the genus Vibrio such as V. fischeri7. Natural competence allows the uptake of free DNA including PCR-generated DNA fragments. Once taken up, the DNA recombines with the chromosome given the presence of a minimum of 250-500 bp of flanking homologous region8. Including a selection marker in-between these flanking regions allows easy detection of frequently occurring transformants.
This method can be used for different genetic manipulations of V. cholerae and potentially also other naturally competent bacteria. We provide three novel examples on what can be accomplished by this method in addition to our previously published study on single gene deletions and the addition of affinity-tag sequences5. Several optimization steps concerning the initial protocol of chitin-induced natural transformation6 are incorporated in this TransFLP protocol. These include among others the replacement of crab shell fragments by commercially available chitin flakes8, the donation of PCR-derived DNA as transforming material9, and the addition of FLP-recombination target sites (FRT)5. FRT sites allow site-directed excision of the selection marker mediated by the Flp recombinase10.

A quick method to modify the genome of V. cholerae is described. These modifications include the deletion of single genes, gene clusters and genomic islands as well as the integration of short sequences (e.g. promoter elements or affinity-tag sequences). The method is based on the natural transformation and FLP-recombination.

TransFLP - שיטה גנטית לשינוי<em&gt; Vibrio cholerae</em&gt; בהתבסס על שינוי הטבעי וFLP-רקומבינציה

Several methods are available to manipulate bacterial chromosomes1-3. Most of these protocols rely on the insertion of conditionally replicative plasmids ...

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

שינוי שיטת EPA 1623 שמשתמש תזרים משיק הולו סיבים Ultrafiltration ומחממים צעדים ניתוק לזהות waterborne<em&gt; Cryptosporidium</em&gt; ו<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Safety Precautions and Operating Procedures in an (A)BSL-4 Laboratory: 1. Biosafety Level 4 Suit Laboratory Suite Entry and Exit Procedures

Biosafety level 4 (BSL-4) suit laboratories are specifically designed to study high-consequence pathogens for which neither infection prophylaxes nor treatment options exist. The hallmarks of these laboratories are: custom-designed airtight doors, dedicated supply and exhaust airflow systems, a negative-pressure environment, and mandatory use of positive-pressure (&#8220;space&#8221;) suits. The risk for laboratory specialists working with highly pathogenic agents is minimized through rigorous training and adherence to stringent safety protocols and standard operating procedures. Researchers perform the majority of their work in BSL-2 laboratories and switch to BSL-4 suit laboratories when work with a high-consequence pathogen is required. Collaborators and scientists considering BSL-4 projects should be aware of the challenges associated with BSL-4 research both in terms of experimental technical limitations in BSL-4 laboratory space and the increased duration of such experiments. Tasks such as entering and exiting the BSL-4 suit laboratories are considerably more complex and time-consuming compared to BSL-2 and BSL-3 laboratories. The focus of this particular article is to address basic biosafety concerns and describe the entrance and exit procedures for the BSL-4 laboratory at the NIH/NIAID Integrated Research Facility at Fort Detrick. Such procedures include checking external systems that support the BSL-4 laboratory, and inspecting and donning positive-pressure suits, entering the laboratory, moving through air pressure-resistant doors, and connecting to air-supply hoses. We will also discuss moving within and exiting the BSL-4 suit laboratories, including using the chemical shower and removing and storing positive-pressure suits.

Safety Precautions and Operating Procedures in an ABSL-4 Laboratory: 1. Biosafety Level 4 Suit Laboratory Suite Entry and Exit Procedures

Although researchers are generally knowledgeable about procedures and safety precautions required for biosafety level 1 or 2 (BSL-1/2) experiments, they may not be familiar with experimental procedures in BSL-4 suit laboratories. This article provides a detailed visual demonstration of BSL-4 suit laboratory systems check, laboratory entry, movement, and exit procedures.

אמצעי בטיחות ונהלי הפעלה בבית (א) BSL-4 מעבדה: 1. רמת בטיחות ביולוגית 4 Suit כניסה ויציאה ונהלים Suite מעבדה

Biosafety level 4 (BSL-4) suit laboratories are specifically designed to study high-consequence pathogens for which neither infection prophylaxes nor ...

A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis

The isolation of giant viruses is of great interest in this new era of virology, especially since these giant viruses are related to protists. Giant viruses may be potentially pathogenic for many species of protists. They belong to the recently described order of Megavirales. The new lineage Faustovirus that has been isolated from sewage samples is distantly related to the mammalian pathogen African swine fever virus. This virus is also specific to its amoebal host, Vermamoeba vermiformis, a protist common in health care water systems. It is crucial to continue isolating new Faustovirus genotypes in order to enlarge its genotype collection and study its pan-genome. We developed new strategies for the isolation of additional strains by improving the use of antibiotic and antifungal combinations in order to avoid bacterial and fungal contaminations of the amoeba co-culture and favoring the virus multiplication. We also implemented a new starvation medium to maintain V. vermiformis in optimal conditions for viruses co-culture. Finally, we used flow cytometry rather than microscopic observation, which is time-consuming, to detect the cytopathogenic effect. We obtained two isolates from sewage samples, proving the efficiency of this method and thus widening the collection of Faustoviruses, to better understand their environment, host specificity and genetic content.

A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis

We describe here the latest advances in viral isolation for the characterization of new genotypes of Faustovirus, a new asfarvirus-related lineage of giant viruses. This protocol can be applied to the high throughput isolation of viruses, especially giant viruses infecting amoeba.

אסטרטגית ראפיד עבור הבידוד של ניו Faustoviruses ממדגמים סביבת שימוש<em&gt; Vermiformis Vermamoeba</em

The isolation of giant viruses is of great interest in this new era of virology, especially since these giant viruses are related to protists. Giant ...

Developing a Salivary Antibody Multiplex Immunoassay to Measure Human Exposure to Environmental Pathogens

The etiology and impacts of human exposure to environmental pathogens are of major concern worldwide and, thus, the ability to assess exposure and infections using cost effective, high-throughput approaches would be indispensable. This manuscript describes the development and analysis of a bead-based multiplex immunoassay capable of measuring the presence of antibodies in human saliva to multiple pathogens simultaneously. Saliva is particularly attractive in this application because it is noninvasive, cheaper and easier to collect than serum. Antigens from environmental pathogens were coupled to carboxylated microspheres (beads) and used to measure antibodies in very small volumes of human saliva samples using a bead-based, solution-phase assay. Beads were coupled with antigens from Campylobacter jejuni, Helicobacter pylori, Toxoplasma gondii, noroviruses (G I.1 and G II.4) and hepatitis A virus. To ensure that the antigens were sufficiently coupled to the beads, coupling was confirmed using species-specific, animal-derived primary capture antibodies, followed by incubation with biotinylated anti-species secondary detection antibodies and streptavidin-R-phycoerythrin reporter (SAPE). As a control to measure non-specific binding, one bead set was treated identically to the others except it was not coupled to any antigen. The antigen-coupled and control beads were then incubated with prospectively-collected human saliva samples, measured on a high throughput analyzer based on the principles of flow cytometry, and the presence of antibodies to each antigen was measured in Median Fluorescence Intensity units (MFI). This multiplex immunoassay has a number of advantages, including more data with less sample; reduced costs and labor; and the ability to customize the assay to many targets of interest. Results indicate that the salivary multiplex immunoassay may be capable of identifying previous exposures and infections, which can be especially useful in surveillance studies involving large human populations.

In the current climate of scarce resources, new technologies are emerging that allow researchers to conduct studies cheaper, faster and with more precision. Here we describe the development of a bead-based salivary antibody multiplex immunoassay to measure human exposure to multiple environmental pathogens simultaneously.

פיתוח Immunoassay רוק נוגדן Multiplex כדי לאמוד את חשיפת אדם לפתוגנים הסביבה

The etiology and impacts of human exposure to environmental pathogens are of major concern worldwide and, thus, the ability to assess exposure and ...

Development of a More Sensitive and Specific Chromogenic Agar Medium for the Detection of Vibrio parahaemolyticus and Other Vibrio Species

Foodborne infections in the US caused by Vibrio species have shown an upward trend. In the genus Vibrio, V. parahaemolyticus is responsible for the majority of Vibrio-associated infections. Thus, accurate differentiation among Vibrio spp. and detection of V. parahaemolyticus is critically important to ensure the safety of our food supply. Although molecular techniques are increasingly common, culture-depending methods are still routinely done and they are considered standard methods in certain circumstances. Hence, a novel chromogenic agar medium was tested with the goal of providing a better method for isolation and differentiation of clinically relevant Vibrio spp. The protocol compared the sensitivity, specificity and detection limit for the detection of V. parahaemolyticus between the new chromogenic medium and a conventional medium. Various V. parahaemolyticus strains (n=22) representing diverse serotypes and source of origins were used. They were previously identified by Food and Drug Administration (FDA) and Centers for Disease Control and Prevention (CDC), and further verified in our laboratory by tlh-PCR. In at least four separate trials, these strains were inoculated on the chromogenic agar and thiosulfate-citrate-bile salts-sucrose (TCBS) agar, which is the recommended medium for culturing this species, followed by incubation at 35-37 &#176;C for 24-96 hr. Three V. parahaemolyticus strains (13.6%) did not grow optimally on TCBS, nonetheless exhibited green colonies if there was growth. Two strains (9.1%) did not yield the expected cyan colonies on the chromogenic agar. Non-V. parahaemolyticus strains (n=32) were also tested to determine the specificity of the chromogenic agar. Among these strains, 31 did not grow or exhibited other colony morphologies. The mean recovery of V. parahaemolyticus on the chromogenic agar was ~96.4% relative to tryptic soy agar supplemented with 2% NaCl. In conclusion, the new chromogenic agar is an effective medium to detect V. parahaemolyticus and to differentiate it from other vibrios.

Development of a More Sensitive and Specific Chromogenic Agar Medium for the Detection of Vibrio parahaemolyticus and Other Vibrio Species

Detection and isolation of clinically relevant Vibrio species require selective and differential culture media. This study evaluated the ability of a new chromogenic medium to detect and identify V. parahaemolyticus and other related species. The new medium was found to have better sensitivity and specificity than the conventional medium.

פיתוח בינוני אגר chromogenic רגיש וספציפי יותר לצורך זיהוי של<em&gt; Parahaemolyticus Vibrio</em&gt; ו אחר<em&gt; Vibrio</em&gt; מינים

Foodborne infections in the US caused by Vibrio species have shown an upward trend. In the genus Vibrio, V. parahaemolyticus is responsible for the ...

Precision-cut Mouse Lung Slices to Visualize Live Pulmonary Dendritic Cells

Inhalation of allergens and pathogens elicits multiple changes in a variety of immune cell types in the lung. Flow cytometry is a powerful technique for quantitative analysis of cell surface proteins on immune cells, but it provides no information on the localization and migration patterns of these cells within the lung. Similarly,&#160;chemotaxis assays can be performed to study the potential of cells to respond to chemotactic factors in vitro, but these assays do not reproduce the complex environment of the intact lung. In contrast to these aforementioned techniques, the location of individual cell types within the lung can be readily visualized by generating Precision-cut Lung Slices (PCLS), staining them with commercially available, fluorescently tagged antibodies, and visualizing the sections by confocal microscopy. PCLS can be used for both live and fixed lung tissue, and the slices can encompass areas as large as a cross section of an entire lobe. We have used this protocol to successfully visualize the location of a wide variety of cell types in the lung, including distinct types of dendritic cells, macrophages, neutrophils, T cells and B cells, as well as structural cells such as lymphatic, endothelial, and epithelial cells. The ability to visualize cellular interactions, such as those between dendritic cells and T cells, in live, three-dimensional lung tissue, can reveal how cells move within the lung and interact with one another at steady state and during inflammation. Thus, when used in combination with other procedures, such as flow cytometry and quantitative PCR, PCLS can contribute to a comprehensive understanding of cellular events that underlie allergic and inflammatory diseases of the lung.

We describe a method for generating Precision-cut Lung Slices (PCLS) and immunostaining them to visualize the localization of various immune cell types in the lung. Our protocol can be extended to visualize the location and function of many different cell types under a variety of conditions.

Precision-לחתוך פרוסות ריאת עכבר לדמיין תאי דנדריטים ריאה חיים

Inhalation of allergens and pathogens elicits multiple changes in a variety of immune cell types in the lung. Flow cytometry is a powerful technique for ...