We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

יש צמחי תאים קירות תא נוקשים, סיבים קשים, קריסטלים, ואת תכולת מים גבוהה כי לגרום לבעיות קריעת רקמות במהלך חתך רקמות צמח. למרות חתך מבוסס פרפין משמש לעתים קרובות עבור רקמות צמח, את הגבישים אנדוגני לעתים קרובות לקרוע את רקמת הצמח במהלך החתך (איור 1). בגלל תכולת מי מטבעם הגבוה בתוך בתאי הצמח, חתך מבוסס cryostat לעתים קרובות גורם לתאי שבור וחתכי רקמות סדוקים. במחקר הנוכחי, פרוטוקול פרפין הטבעה ו cryosection בשילוב בשם Hybrid-Cut פותח וקטעי רקמה באיכות טובות התקבלו. פרוטוקול זה פותר את הבעיה קשורה תכולת מים גבוהה על ידי החדרת הטבעת פרפין, ומצמצם את אפקט הקריעה על ידי הקשחת פראפין תחת בטמפרטורה נמוכה במהלך החתך (איור 3). לכן, פרוטוקול שונה זו יש יתרון על פני משני sectio פרפין המבוססנינג או Cryosectioning עבור שמירה על שלמות רקמות הצמח. כתב יד זה מדגים כי השיטה ההיברידית-Cut משמר שלמות רקמות ברקמות רבות של סחלב Phalaenopsis כגון ניצן השחי, זרע, ו PLB, וכו &#39;המכילות רמות גבוהות של גבישים (איורים 3-4). יתר על כן, פרוטוקול זה ניתן פלח כגון איברי רבייה ועלים של אורז, תירס, חיטה המכילים סיליקה גבוהה (איורים 5-6). יש להניח, פרוטוקול זה ניתן להחיל את וודי צמחים המכילים סיבים תזונתיים גבוהים. באופן כללי, רקמת תיקון ביסודיות חשובה מאוד על Cut ההיברידי. מצאנו כי חומצת פורמלדהיד-חומצי-אלכוהול (FAA) מקבע עדיף PFA כדי לשמור על שלמות הרקמה של רקמות סרבניות מסוימות כגון בלוטות axially, שורשים, וכו &#39;עם זאת, PFA עובד טוב יותר מאשר ה- FAA בשימור שלמות RNA. לכן PFA מומלץ לתקןמדגם עבור כלאה באתרו (שאני עורך) עבודה. הפרוטוקול המתואר כאן נועד לניסוי RNA שאני עורך. לכן, כל ריאגנטים הוכנו כדי למנוע השפלה RNA על ידי ביטול זיהום RNase ידי טיפול DEPC. אם סעיף Hybrid-Cut הוא ללימודי אנטומיים, אוסמוזה ההפוכה רגילים (RO) מי חיץ הנגזרות שלה או ריאגנטים כשרים. צמצום דגימת גודל ועובי כדי פחות מ -3 מ&quot;מ מועיל עבור חדירה. יתר על כן, זמן טבילה גובר התייבשות וחדירה נחוץ רקמות מרקם קשות. הגבלת פרוטוקול זה עלולה עקב בעיות שנגרמות על ידי קיבעון לקוי, התייבשות, וחדירה של דגימה. לכן, התאים זמן עיבוד בכל צעד קריטי לייצר בלוק פרפין באיכות טובה. בדרך כלל, רקמה קשה צריכה עוד זמן עיבוד מאשר רקמה רכה. בנוסף, הראינו כי Hybrid-Cut עבד בהצלחה wi שילובשאני עורך ה לספק פריסה המרחבית של התמלילים שנבחרו (איור 7). לסיכום, פרוטוקול זה שימושי לחקר אנטומיה של צמח ומספק מפת RNA ספציפי רקמות של הגנים הנבחרים. בנוסף הוא עשוי להיות מיושם על מחקרים מולקולריים אחרים כגון תיוג סוף מסוף deoxynucleotidyl transferase dUTP ניק (TUNEL) assay, הקרינה הכלאה באתרו (FISH), וטכניקות immunostaining. לסיכום, פרוטוקול חתך רקמות משופר זו הוא גם שימושי ומועיל לחוקרים בקהילות צמח.

שיטת החתך מבוסס פרפין היא טכניקה בשימוש נרחבת עבור מחקרים אנטומיים. שימור האנטומיה רקמות שלמות חשוב ללימודי מורפולוגיים וביולוגיים. הטכניקה חתכה-מוטבע פרפין יש יתרון משום-הטבעת פרפין שומרת מורפולוגיה תאים ורקמות. בנוסף, בלוקי פרפין ניתן לאחסן בנוחות לתקופות זמן ארוכות. עם זאת, חתך-מוטבע פרפין אינו מתאים רקמות הצמח המכיל גבישי תאיים. קריסטלים בתוך התאים לעתים קרובות לקרוע סרטים פרפין שלמות רקמות נזק במהלך חתך. בניגוד חתך פרפין, cryosectioning הוא מהיר יחסית וחתכים ניתן להשיג ללא קיבוע, התייבשות סדרתי או הטבעה חדירה 1 בינוני. Cryosections תואם יישומים רבים כגון אימונוהיסטוכימיה, כלאה באתרו, ואנזים היסטוכימיה. היתרון השני של cryosectioning הואהשיטה זו אינה עוברת תהליכי denaturation פוטנציאל כגון טמפרטורה גבוהה טיפולים כימיים, כך מולקולות הסלולר נשמרות היטב בתוך קטעי הרקמה 2. Cryosectioning מעדיף בדרך כלל מעל מבוססי פרפין חתך ללימודים ברקמות בעלי חיים. עם זאת, cryosectioning הוא לא הבחירה הראשונה בצמחים כי טמפרטורה מקפיאה לפעמים גורם להיווצרות גבישי קרח המשפיעים על איכות שלמות סעיף. למרות ויסות האוסמוטי כגון פתרונות סוכרוז, פוליאתילן גליקול (PEG), או גליצרול 3 דווחה להפחית היווצרות קרח קריסטל בתנאי הקפאה, השיפור רחוק מלהיות אופטימלי. כדי להסתגל לסביבות שונות, צמחים שונים יש לעתים קרובות תאי מרקם צמח רקמות ברורים התפתחו כדי ליצור קירות תא נוקשים, סיבים קשים, וקריסטלים 4,5. לדוגמא, גבישים אוקסלט מסיסים וגופים סיליקה הם די נפוציםצמחים 6. גופי סיליקט / דווחו גבישים כדי לסייע לשמור על אדריכלות צמח, תְמִירוּת, ולמנוע מחלות או מזיקים בצמחי דגנים 7-9. הסחלבים בעציץ וחותך-הפרח בשוק הסחלב פורח וזה ענף צומח. אפרודיטה Phalaenopsis (סחלב עש) היא אחד צמחי נוי יצוא החשובים ביותר בטייוואן. במאמצים משמעותיים נעשו כדי להבין את השינויים מורפולוגיים פיסיולוגיים של התהליכים הפורחים סחלבי Phalaenopsis. קוצים פרחוניים של סחלבי Phalaenopsis יזומים מן ניצני בית השחי בבסיס עלה. לאחר תקופה של טמפרטורת סביבה מגניבה (כ אחת וחצי חודשים), בלוטות בית השחי להגדלה, לשבור תרדמת, ו לבלוט מהבסיס עלה להתפתח קוצים פרחוניים צעירים. כדי להבין את פיזיולוגיים, הסלולר, ותהליכים מולקולריים חניכת ספייק, זה הכרחי כדי לפתח טכניקת אנטומיים חזקה כדי visuaרקמות או סמנים Lize מבעוד מועד. עם זאת, הנוכחות של גבישים בכל מקום ברקמות סחלב, במיוחד ניצני בית השחי, עושה עבודה אנטומיים קשה. כאן אנו בקשנו לשפר שלמות סעיף של רקמות צמח סרבניות כי כבר ראו עד כה מאתגר מבחינה טכנית. כאן אנו מציגים פרוטוקול משופר בשם Hybrid-Cut. זוהי שיטת חתך מבוסס פרפין כי מתבצעת באמצעות cryostat. הטבעת פרפין פותר תכולת מים גבוהה ברקמות צמח. חתך מתחת לטמפרטורה נמוכה מקשה את בלוק פרפין, מפחית קריסטל קורע בעיה, ומשפר שלמות רקמות משמעותית. פרוטוקול זה משפר שלמות רקמות משמעותית עבור דגימות צמח סרבניות.

<table border="0" cellpadding="0" cellspacing="0" width="734">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Embedding Center model EC780-1</td>
			<td style="width:127px;">CSA</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Microtome model RM2255</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Cryostat model CM 1950</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Axio Scope A1 microscope&#160;</td>
			<td style="width:127px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Murashige &#38; Skoog medium including vitamins</td>
			<td style="width:127px;">Duchefa Biochemia</td>
			<td style="width:119px;">M0222.0050</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">RNase free surface decontaminant</td>
			<td style="width:127px;">Apex</td>
			<td style="width:119px;">10-228</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Diethyl pyrocarbonate (DEPC)</td>
			<td style="width:127px;">Bio Basic Inc.&#160;</td>
			<td style="width:119px;">D801154</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium chloride (NaCl)</td>
			<td style="width:127px;">MDBio, Inc.</td>
			<td style="width:119px;">101-7647-14-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:321px;">Potassium chloride, crystal (KCl)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">7447-40-7</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sodium phosphate dibasic (NA2HPO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7558-79-4</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Potassium phosphate monobasic (KH2PO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7778-77-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraformaldehyde (PFA)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">16005</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium hydroxide (NaOH)</td>
			<td style="width:127px;">Showa</td>
			<td style="width:119px;">19430160</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sulfuric acid (H2SO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7664-93-9</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glutaraldehyde solution</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">111-30-8</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9005-64-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Octyl Phenol Ethoxylate (Triton X100)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9002-93-1</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glass scintillation vials</td>
			<td style="width:127px;">Newastar</td>
			<td style="width:119px;">DG60805-00020</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:321px;">Desiccator vacuum</td>
			<td style="width:127px;">Violet Bioscience Inc.</td>
			<td style="width:119px;">TS-402030</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Rotary vane pump RZ2.5</td>
			<td style="width:127px;">Vacuubrand</td>
			<td style="width:119px;">36149406</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Ethanol</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">64-17-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sub-X&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803670</td>
			<td style="width:167px;">Xylene substitute</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraplast Plus&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">39602004</td>
			<td style="width:167px;">Tissue embedding paraffin</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SUPERFROST micro slide glass</td>
			<td style="width:127px;">Matsunami</td>
			<td style="width:119px;">S7441</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:321px;">FSC 22 Clear&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801480</td>
			<td style="width:167px;">Optimal Cutting Temperature compound (OCT)&#160;</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Xylenes, Purified</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803665</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hematoxylin</td>
			<td style="width:127px;">Merck</td>
			<td style="width:119px;">HX305311</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hydrochloric acid (HCl)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7647-01-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Micromount</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801731</td>
			<td style="width:167px;">Mounting medium</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">pGEM T-easy vector</td>
			<td style="width:127px;">Promega</td>
			<td style="width:119px;">A1360</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Proteinase K</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">3115879001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SP6/T7 DIG RNA Labeling Kit</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11175025910</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">NBT/BCIP stock solution</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11681451001</td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

סעיף צמח שמירה על שלמות חיונית ללימוד מבנים אנטומיים מפורטים על הסלולר, הרקמות, או אפילו ברמת איברים. עם זאת, תאים ולשתול יש קירות תא נוקשים, סיבים קשים וקריסטלים (סידן אוקסלט, סיליקה, וכו &#39;), ואת תכולת מים גבוהה כי לעתים קרובות לשבש שלמות רקמות במהלך חתך רקמות הצמח. מחקר זה קובע שיטת חתך רקמות פשוט חותך-היברידיות. פרוטוקול זה משנה טכניקת חתך מבוסס פרפין משפר את שלמות סעיפי רקמות מצמחים שונים. רקמות צמח היו מוטבעות פרפין לפני החתך בתוך cryostat ב C -16 °. חתך מתחת לטמפרטורה נמוכה מוקשה האבנית פרפין, קריעה מופחתת מגרדת, שלמות רקמות השתפרה משמעותית. פרוטוקול זה יושם בהצלחה לרקמות סחלב Phalaenopsis עשירי סידן אוקסלט וכן רקמות סרבניות כגון orga רבייהns ועלים של אורז, תירס, חיטה. בנוסף, באיכות גבוהה של קטעי רקמה מן-Cut היברידי יכול לשמש בשילוב עם הכלאה באתרו (שאני עורך) כדי לספק דפוסי הביטוי המרחבי של הגנים של עניין. לסיכום, פרוטוקול זה שימושי במיוחד עבור רקמות צמח סרבניות המכילות תוכן קריסטל או סיליקה גבוה. איכות טובה סעיפי רקמות לאפשר מחקרים ביולוגיים מורפולוגיים אחרים.

Hybrid-Cut משפרת את שלמות סעיפי רקמות הבנת האנטומיה של המבנה הפרחוני הרבייה חשובה על חקירת המנגנון הבסיסי של חניכת פרחי סחלבים. עם זאת, הצטברות של גבישי אוקסלט תאיים סחלבים Phalaenopsis עושה מחקרים כאלה משימה מאתגרת. כדי לעקוף את הבעיות הקשורות קריעה הנגרמת על ידי גבישים במהלך תהליך חתך (איור 1), פיתחנו מערכת והענקנו Hybrid-Cut. פרוטוקול זה משלב טכניקות הטבעת פרפין מסורתיות cryosection. ראשון בדקנו Hybrid-חותך ניצני בית השחי של סחלב Phalaenopsis כי הם ידועים לשמצה קשיחה רקמות ותוכן קריסטל גבוה. רקמת ניצן השחי נקבעה 4% PFA (ראה פרוטוקול, צעד 1.3). לאחר התייבשות אתנול סדרה ואני שעוות פרפיןnfiltration, באיבו בבית השחי ננעץ בלוק פרפין. הבלוק היה מטופח עד לגודל מתאים לפני החתך (איור 2 א). כמות קטנה של אוקטובר יושמה אז למרכז הבמה cryostat (איור 2 ב). בלוק פרפין אז דבק הבמה באמצעות OCT. הבמה הייתה מודגרות cryostat במשך 10 דקות כדי לאפשר התמצקות מלאה של אוקטובר לפני חתך (איור 2 ג) ולאחר מכן cryosection בוצעה בתוך -16 תא ° C (איור 2 ד). לשם השוואה, בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון חתך microtome קבוע. כפי שניתן לראות בתרשים 1 א &#39;, קריעה חמורה של סרטי פרפין נצפתה לאחר חתך microtome. שלמות רקמות המבנה התאי נפגע גם (איור 1B). Hybrid-Cut, ומצד שני,סעיפי רקמות ללא פגע פיק (איור 3 א) עם שלמות מבנית השתמרה (האיור 3B). יישום של Hybrid-גזור רקמות שונות של פ אַפְרוֹדִיטָה כדי להמשיך לבדוק רמת המוכנות של-Cut היברידי, בדקנו רקמות שונות של סחלבים Phalaenopsis. היא לעתים קרובות קשה להשיג חלקים של זרעים עם שלמות רקמות טובה בגלל מעטת הזרע הקשוחה. שימוש בפרוטוקול זה, מבנים מפורטים של זרעים נשתמרו לאחר החתך (איור 4 א). כפי שניתן לראות בתרשים 4A, גופים חלבון, מוצרי אחסון משותף 14, ניתן היה לזהות בבירור. Hybrid-Cut גם עבד בהצלחה והראה המבנים המפורטים של meristem פסגת לירות של protocorm הישן של חודש אחד (המבנה ניבט מזרע) (איור 4 ב) וprotocorm כמו- גופים (PLBs, איור 4C). הגבישים תאיים נצפו קטעי PLB. סחלבים Phalaenopsis יש עלים עבים ועסיסיים, והם מבצעים מטבוליזם של חומצת הטבוריתיים (CAM) -type הפוטוסינתזה 15. הסעיף הרוחבי של להב עלה הראה תאי mesophyll גדולים חבילות וסקולרית המכיל עצה ואת השיפה (איור 4D). פתחי הפיוניות מעטים נצפו על פני העלה abaxial בשעות היום (4D איור). למעשה, צמחי CAM התפתחו על מנת למקסם רווח פחמן אך בו זמנית להקטין את איבוד מים על ידי פתיחת stomates שלהם בלילה בתנאים צחיחים 15,16. Meristem פסגת שורש פ אפרודיטה מוצגת באיור 4E. תאי קצה השורש הופיעו להכיל מספר לא מבוטל של גבישים, אשר מאוד השתמרו היטב לאחר החתך (4E איור). סעיפים אורכים של קוצים פרחוניים צעירים היוו אינפורמטיון על הארכיטקטורה של primordials הפרחוני הצעיר (איור 4F). יתר על כן, עלי גביע, עלי כותרת, שפית, ו pollinia ניתן היה לזהות בבירור ממדור האורך של ניצני פרחים צעירים שסיימו בידול זה 5 מ&quot;מ ניצן של פרח (איור 4G). שים לב כי גבישים שנצברו עליי הגביע של בלוטות פרחוניות צעירות. בקיצור, פרוטוקול זה עובד באופן עקבי כדי לשמור על שלמות רקמות מייצר מורפולוגיה שלמה המאפשר מחקרים הסלולר אנטומיים והאפשריים. Hybrid-Cut שומר שלמות רקמות ב פלח גם בדקנו Hybrid-גזור על פלחה כגון אורז, חיטה ותירס המכילים תוכן סיליקה גבוהה 17,18. כפי שניתן לראות בתרשים 5, על שלמות רקמות סעיפים הרוחביים של אורז, חיטה, תירס ועלים שופרה באופן משמעותי על ידי Hy<html> Brid-Cut השיטה. העצה, השיפה, תאי mesophyll, stomates, ותאי bulliform שולט מתגלגל של הלהב עלה כדי למנוע אובדן מים זוהו בבירור ממקטעים של עלים אורזים. האנטומיה קרנץ, תאי mesophyll, וצרורות כלי דם של עלה התירס 19,20 זוהו בבירור. זה היה מסקרן למצוא צפיפות גבוהה של stomates משני צדדי adaxial ו abaxial עלי תירס (איור 5). יחס הפיוניות adaxial ו abaxial של 0.7 תירס דווח בעבר 21. בנוסף, פרוטוקול זה גם עבד בהצלחה לספק את מורפולוגיה התא המפורטת של spikelets מאורז, חיטה, תירס (איור 6). Spikelets ידוע מכיל סיליקה 9 בשפע. בדרך כלל, דבר גורם קושי בקיום חתך רקמות. ב הכלאה באתרה = &quot;1&quot;&gt; הגנום וגישות transcriptomic משמשים כדי ויסמנו את הפונקציות של גנים. מתן פריסה המרחבית של תמלילי הגנים של עניין בהקשרים התפתחותיים או סביבתיים חשוב להוסיף תובנה חדשה הפונקציות האפשריות של הגנים. In-situ כלאה (שאני עורך) פותח כדי למקם דפוסי ביטוי גנים ברמת הרקמה 11, 22-25. בנוסף, שאני עורך יכול לספק הסלולר, ובמקרים מסוימים משנה הסלולר, ברזולוציה של הפצת mRNA באורגניזמים רב-תאי 26. במהלך שאני עורך, רנ&quot;א שלם רקמות הוא חיוני כדי להשיג מידע מרחבים אמין על התמליל שנבחר. בדקנו שאני עורך באמצעות פרוטוקול היברידי-Cut הגן אקטין (PATC157348) שובט באמצעות פריימרים 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;ו 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; כדי לקבל amplicon 242 נ&quot;ב PCR B1 Cyclin:.. 1 (PATC146999) גן ספציפי רצף קידוד פריימרים באמצעות 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39;ו 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; כדי לקבל 327 נ&quot;ב amplicon PCR. אחרי שאני עורך, אקטין Cyclin B1: ביטוי גנים 1 היה פיקוח ב ניצני בית השחי צעירים בוגרים (איור 7). גני שניהם באו לידי ביטוי בתאי meristematic של 2 nd ו -3 ניצני rd השחי, עם זוהו אותות חזקים ב 3 rd ניצני בית השחי. תוצאות אלו הראו כי Hybrid-Cut לשמור האנטומיה טובה ולספק דפוס ביטוי גנים מרחבית. <img alt="איור 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> איור 1: סעיף פרפין מסורתי גורם קריעה חמורה של רקמות בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון חתך microtome קבוע.. קריעה חמורה של סרטי פרפין נצפתה לאחר חתך microtome מסורתי (א) </strong&gt;. שלמות רקמות המבנה התאי נפגע גם (B). החיצים מראים את הקריעה החמורה של פרוסת הרקמות. ראש החץ מציג את הגופות קריסטל. סרגל קנה מידה -100 מיקרומטר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> איור 2:. Hybrid-Cut חתך שיטת רקמת ניצן השחי נקבעה PFA והרקמות היו מיובשות, הסתננו עם שעוות פרפין, ומוטבעי בלוק פרפין. בלוק פרפין היה גזוז לגודל מתאים (א). מתחם חיתוך טמפרטורה אופטימלית (אוקטובר) היה מוחל על מרכז הבמה cryostat (B). בלוק פרפין מצורף ב- OCT על במת cryostat. תחת בטמפרטורה נמוכה, בלוק פרפין<html> ששקדו על הבמה cryostat באמצעות אוקטובר (C). בחתכי רקמה היו מחולקים בתא cryostat ב -16 ° C (D). ברים סולם מייצגים 0.5 ס&quot;מ (א), 1 ס&quot;מ (BD). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> איור 3: Hybrid-Cut משפר Integrity סעיף בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון-Cut ההיברידי חתך (א) ואת השיטה ההיברידית-Cut פיק קטעים עם שלמות רקמות מצוינת (B).. ראש החץ מראה את גופות קריסטל אנדוגני משובצות ברקמת ניצן השחי. סרגל קנה מידה -100 מיקרומטר.r קבל = &quot;_ blank&quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> איור 4: יישום של Hybrid-חותך סעיפי רקמות שונים של סחלב Phalaenopsis סחלב שונה. רקמות היו מחולקות בשיטת Hybrid-Cut, כגון חתך לאורך של זרע סחלב בשלב הבוגר (א), סעיף אורך של protocorm (B), חתך לאורך של גופי protocorm דמוי (PLB) (ג), סעיף רוחבי של להב עלה (D), חתך לאורך של השורש (E), חתך לאורך של ספייק פרח הצעיר (F), וסעיף אורך של ניצני פרחים צעירים (G). סעיפי רקמות הוכתמו על ידי hematoxylin. SC, קליפת הזרע; PB, גוף חלבון; M,meristem; MP, אמא PLB; עקור, בת PLB; מודעות, משטח עלה adaxial; Ab, משטח עלה abaxial; St, הפיוניות; MC, תא mesophyll; VB, צרור וסקולרית; RC, כובע שורש; FB, ניצן של פרח; Se, עָלֶה גָבִיעַ; Pe, עלה כותרת; La, שפית; פו, pollinia; Ro, rostellum; Ca, יבלת. ראשי חץ להראות גבישים. ברי סולם מייצגים 20 מיקרומטר (AE) ו -200 מיקרומטר (FG). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> איור 5:. Hybrid-Cut שומר Integrity רקמת העלה ב פלחה מספר השוואה של רקמת העלה בשיטת פרפין המסורתית (בחלונית הימנית) ואת הטכניקה Hybrid-Cut שפותחה במחקר זה (פאנל הימני). תמונות להראות עלו סעיפים רוחביים של אורז, חיטה, תירס. MC, תא mesophyll; Ph, השיפה; St, הפיוניות; לפנה&quot;ס, bu<html> תא lliform. חצים מראים הקריעה של פרוסת רקמה. ראשי חץ להראות גופות סיליקה. העיגולים מקווקוים הכחולים עולים האנטומיה קרנץ ב תירס C4. סולם bars 20 מיקרומטר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> איור 6:. Hybrid-Cut שומר שלמות רקמות Spikelet ב פלחה כמה השוואת שלמות רקמות סעיפים spikelet בין פרפין המסורתי ושיטות Hybrid-Cut. חצים מראים הקריעה של פרוסת רקמה. ראשי חץ עולה גופים סיליקה. ברי סולם 20 מיקרומטר (אורז), ו -200 מיקרומטר (חיטה ותירס). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> אף אוזן גרון &quot;FO: keep-together.within-page =&quot; 1 &quot;&gt; <img alt="איור 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> איור 7: באתרו הכלאה של אקטין CyclinB1; 1 דפוסי הביטוי של ובלוטות באד של סחלב Phalaenopsis בחתכי רקמה של ניצן 2 nd ניצנים בית השחי ו -3 rd השחי הוכנו תוך שימוש בשיטת Hybrid-Cut.. סך של 40 ng של אקטין CyclinB1; 1 חללית DIG שכותרתו שמש הכלאה. חללית התחושה שמשה כביקורת שלילית. החצים מצביעים על meristem הרבייה של ניצן השחי. סולם bars 100 מיקרומטר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

-Cut ההיברידי: שיטת חתך משופרת עבור דוגמאות רקמות צמח סרבן

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Nanyang Technological University

Research

JoVE Journal

Biology

18.8K Views.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Video: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

חתך דק של ההכנות פורסים עבור אימונוהיסטוכימיה

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

Testing Nicotine Tolerance in Aphids Using an Artificial Diet Experiment

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well know to have insecticidal properties. One response of tobacco plants to herbivory, or being gnawed upon by insects, is to increase the production of this neurotoxic alkaloid. Here, we will demonstrate how to set up an experiment to address this question of whether a tobacco-adapted strain of the green peach aphid, Myzus persicae, can tolerate higher levels of nicotine than the a strain of this insect that does not infest tobacco in the field.

In this video and assay is demonstrated that tests the tolerance of nicotine to two types of aphids one that infests tobacco plants in the field and one that does not.

בדיקת סובלנות ניקוטין ב כנימות באמצעות ניסוי דיאט מלאכותית

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well ...

Agar-Block Microcosms for Controlled Plant Tissue Decomposition by Aerobic Fungi

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; agar-block). It is well-accepted that soil-block microcosms yield higher decay rates, fewer moisture issues, lower variability among studies, and higher thresholds of preservative toxicity. Soil-block testing is thus the more utilized technique and has been standardized by American Society for Testing and Materials (ASTM) (method D 1413-07). The soil-block design has drawbacks, however, using locally-variable soil sources and in limiting the control of nutrients external (exogenous) to the decaying tissues. These drawbacks have emerged as a problem in applying this method to other, increasingly popular research aims. These modern aims include degrading lignocellulosics for bioenergy research, testing bioremediation of co-metabolized toxics, evaluating oxidative mechanisms, and tracking translocated elements along hyphal networks. Soil-blocks do not lend enough control in these applications. A refined agar-block approach is necessary.
Here, we use the brown rot wood-degrading fungus Serpula lacrymans to degrade wood in agar-block microcosms, using deep Petri dishes with low-calcium agar. We test the role of exogenous gypsum on decay in a time-series, to demonstrate the utility and expected variability. Blocks from a single board rip (longitudinal cut) are conditioned, weighed, autoclaved, and introduced aseptically atop plastic mesh. Fungal inoculations are at each block face, with exogenous gypsum added at interfaces. Harvests are aseptic until the final destructive harvest. These microcosms are designed to avoid block contact with agar or Petri dish walls. Condensation is minimized during plate pours and during incubation. Finally, inoculum/gypsum/wood spacing is minimized but without allowing contact. These less technical aspects of agar-block design are also the most common causes of failure and the key source of variability among studies. Video publication is therefore useful in this case, and we demonstrate low-variability, high-quality results.

This video demonstrates a controlled environment approach to study degradation of lignocellulosic plant tissues by aerobic fungi. The ability to control nutrient sources and moisture is a key advantage of agar-block microcosms, but the approach often yields mixed success. We address critical pitfalls to yield reproducible, low-variability results.

אגר-Block מיקרוקוסמוס של פירוק רקמות הצמח מבוקרת על ידי פטריות אירובית

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors.
PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. 
Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. 
Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size.

The Direct PCR approach presented here facilitates PCR amplification directly from small amounts of unpurified plant and animal tissue.

Genotyping של דוגמאות צמחים ובעלי חיים, ללא טיהור DNA לפני

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an oil-coated graduated cylinder; landing height provided a measure of flight performance by assessing how far flies will fall before producing enough thrust to make contact with the wall of the cylinder. Here we describe an updated version of the flight tester with four major improvements. First, we added a &#34;drop tube&#34; to ensure that all flies enter the flight cylinder at a similar velocity between trials, eliminating variability between users. Second, we replaced the oil coating with removable plastic sheets coated in Tangle-Trap, an adhesive designed to capture live insects. Third, we use a longer cylinder to enable more accurate discrimination of flight ability. Fourth we use a digital camera and imaging software to automate the scoring of flight performance. These improvements allow for the rapid, quantitative assessment of flight behavior, useful for large datasets and large-scale genetic screens.

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Here we describe a method for rapid and accurate measurement of flight performance in Drosophila, enabling high-throughput screening.

שיטה משופרת למדידה מדויקת והמהירה של טיסה בביצועים<em&gt; דרוזופילה</em

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an ...

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the adult plant. The female SMC (megaspore mother cell, MMC) differentiates in the ovule primordium and undergoes meiosis. The selected haploid megaspore then undergoes mitosis to form the multicellular female gametophyte, which will give rise to the gametes, the egg cell and central cell, together with accessory cells. The limited accessibility of the MMC, meiocyte and female gametophyte inside the ovule is technically challenging for cytological and cytogenetic analyses at single cell level. Particularly, direct or indirect immunodetection of cellular or nuclear epitopes is impaired by poor penetration of the reagents inside the plant cell and single-cell imaging is demised by the lack of optical clarity in whole-mount tissues.
Thus, we developed an efficient method to analyze the nuclear organization and chromatin modification at high resolution of single cell in whole-mount embedded Arabidopsis ovules. It is based on dissection and embedding of fixed ovules in a thin layer of acrylamide gel on a microscopic slide. The embedded ovules are subjected to chemical and enzymatic treatments aiming at improving tissue clarity and permeability to the immunostaining reagents. Those treatments preserve cellular and chromatin organization, DNA and protein epitopes. The samples can be used for different downstream cytological analyses, including chromatin immunostaining, fluorescence in situ hybridization (FISH), and DNA staining for heterochromatin analysis. Confocal laser scanning microscopy (CLSM) imaging, with high resolution, followed by 3D reconstruction allows for quantitative measurements at single-cell resolution.

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

We provide here an efficient and reliable protocol for immunostaining, Fluorescence in&#160;situ Hybridization, DNA staining followed by quantitative, high-resolution imaging in whole-mount Arabidopsis thaliana ovules. This method was successfully used to analyze chromatin modifications and nuclear architecture.

שיטה יעילה לניתוח כמותי, תא בודד של הכרומטין שינוי ואדריכלות גרעינית בהר שלם-ביציות ב<em&gt; ארבידופסיס</em

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, techniques for studying the regulatory mechanism of this system are essential to elucidating the cellular and molecular processes of the aforementioned diseases. The use of hemagglutinin derived ubiquitin probes outlined in this paper serves as a valuable tool for the study of this system. This paper details a method that enables the user to perform assays that give a direct visualization of deubiquitinating enzyme activity. Deubiquitinating enzymes control proteasomal degradation and share functional homology at their active sites, which allows the user to investigate the activity of multiple enzymes in one assay. Lysates are obtained through gentle mechanical cell disruption and incubated with active site directed probes. Functional enzymes are tagged with the probes while inactive enzymes remain unbound. By running this assay, the user obtains information on both the activity and potential expression of multiple deubiquitinating enzymes in a fast and easy manner. The current method is significantly more efficient than using individual antibodies for the predicted one hundred deubiquitinating enzymes in the human cell.

The current protocol details a method for measuring the activity of functionally homologous deubiquitinating enzymes. Specialized probes covalently modify the enzyme and allow for detection. This method holds the potential to identify new therapeutic targets.

שיטה למדידת הפעילות של אנזימי Deubiquitinating בשורות תאים ודגימות רקמה

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

A Fast Air-dry Dropping Chromosome Preparation Method Suitable for FISH in Plants

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high quality plant chromosome spreads is challenging due to the rigid cell wall. One of the approved methods for the preparation of plant chromosomes is a so-called drop preparation, also known as drop-spreading or air-drying technique. Here, we present a protocol for the fast preparation of mitotic chromosome spreads suitable for the FISH detection of single and high copy DNA probes. This method is an improved variant of the air-dry drop method performed under a relative humidity of 50%-55%. This protocol comprises a reduced number of washing steps making its application easy, efficient and reproducible. Obvious benefits of this approach are well-spread, undamaged and numerous metaphase chromosomes serving as a perfect prerequisite for successful FISH analysis. Using this protocol we obtained high-quality chromosome spreads and reproducible FISH results for Hordeum vulgare, H. bulbosum, H. marinum, H. murinum, H. pubiflorum and Secale cereale.

A protocol is described for the preparation of high-quality mitotic plant chromosome spreads by a fast air-dry dropping method suitable for the FISH detection of single and high copy DNA probes.

כרומוזום מהיר האוויר יבש השמטת הכנת שיטה מתאימה לדגים בצמחים

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high ...

Improved Swiss-rolling Technique for Intestinal Tissue Preparation for Immunohistochemical and Immunofluorescent Analyses

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current literature describes several different methodological approaches to obtain images of intestinal tissues for data validation. In this paper, we delineate a common protocol relating to the derivation and processing of mouse intestinal tissues. Proper fixation of intestinal tissues and Swiss-roll techniques that enhance intestinal epithelial morphology are discussed. Postresection processing and reorientation of embedded intestinal tissues are critical in obtaining paraffin-embedded blocks that display intact intestinal structural features after sectioning. The Swiss-rolling technique helps in histological assessment of the complete intestinal or colonic sections examined. An ability to differentiate intestinal structural features can be vital in quantitative measurements of intestinal inflammation and tumorigenesis along the entire length. Finally, paraffin-embedded sections are ideal for robust processing using both immunohistochemical and immunofluorescent detection methods. Nonfluorescent immunohistochemical sections provide a vibrant image of the tissue detailing different cellular structural features but do not provide flexibility for intracellular co-localization experiments. Multiple fluorescent channels can be appropriately utilized with immunofluorescent detection for co-localization experiments, lending support to mechanistic studies.

Accurate identification and location of epithelial cells along the intestinal mucosal lining are essential to define different cell lineages. Proper imaging of intestinal tissues is crucial for identification of protein expression patterns with maximum resolution. This study aims to delineate the optimal methods and conditions for processing mouse intestinal tissues.

טכניקה Swiss-מתגלגל משופר עבור הכנת רקמת המעי עבור immunohistochemical ו ניתוח Immunofluorescent

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

שיטה קלה הצמח Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...