ברצוננו להודות למוניקה Tarnowska, קורנליה אלברכט, והאווה Skoczylas לקבלת סיוע טכני מעולה. מחקר זה מומן על ידי CRSI33-125,073 מענק SNF Sinergia לPP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

המחברים מצהירים שום אינטרסים מתחרים.

גישות עריכת מעצב מונע nuclease הגנום הרחיבו באופן משמעותי את מגוון מינים ניתנים לשינויים ממוקדים של הגנום שלהם 10,12. בעכברים, בתאי גזע עובריים גן המיקוד כבר טכניקה סטנדרטית ליותר משני עשורים; עם זאת, היא הוכיחה קשה להסתגל לתאי גזע עובריים ממינים אחרים מאשר העכבר, למרות שיש כבר כמה הצלחה האחרונה בתאי גזע עובריים חולדה. אפילו עם הזמינות של שיבוטים &quot;ה-off-המדף&quot; ממוקד גן העכבר ES תא הניתנים על ידי קונסורציומים כגון EUCOMM, KOMP, או 3 NorCOMM עריכת הגנום ידי ZFN וTalen מספק דיוק וגמישות בנושא הספקטרום של שינויים שיכולים להיות גבוהים יותר הציג לתוך גנום העכבר. נראות חיות מייסד נושאות מוטציות בתיווך nuclease להיות ניבט קו מאוד 4-6,20,21 המוסמכים, וזה לא תמיד במקרה של מפלצות שמקורם זריקות הבלסטוציסט של תאי גזע עובריים. לפיכך, במקרים מסוים של microinjection desnucleases igner יכול לגרום לדור מהיר יותר באופן משמעותי של קווי עכבר רומן עם שינויי הגנום ממוקדים. הדור המוצלח של עכברים בנוקאאוט על ידי הזרקה של ZFN וTalen תלוי במידה רבה על פעילותם של זוג nuclease המוזרק. TALENs הוכחו יש שיעור הצלחה גבוה במיקוד מגוון רחב של גנים במספר אורגניזמים; עם זאת, מחקרים שנערך לאחרונה מצביעים על כך שTalen מחייב רגיש למתילציה ציטוזין 30,31. לכן, זוגות nuclease שנוצרו זה עתה, למשל TALENs משובטים לתוך וקטורי pCAG-T7, ניתן transfected transiently לקו תא עכבר כגון NIH-3T3 או נוירו -2a, המחקה את מצב הכרומטין של עובר העכבר במידה מסוימת. כאן, פעילות nuclease ניתן להעריך באמצעות assay endonuclease T7 או לעכל הגבלה של המוצר ה-PCR כאמור בסעיף 5 לפני סינתזת ה-mRNA וmicroinjection. אנו ממליצים רצף של האזור הגנומי של עניין בכבודive קו סלולרי וזן העכבר המשמש לניסויי microinjection. בzygotes עכבר, זוגות Talen או ZFN שונים יעבדו בצורה אופטימלית בריכוזים ה-mRNA שונים, ולכן ריכוז העבודה האופטימלי של ה-mRNA nuclease microinjected יצטרך להיקבע באופן ניסיוני. בהתאם לזוג nuclease, נמוך מדי ריכוז יגרום שום מחשוף ואילו גבוהים מדי יכול לגרום הקטלניות עובר. בהתאם לזוג nuclease, יש לנו הצלחה באמצעות ריכוזי mRNA כולל נמוכים כמו 2 ng / μl וגבוה ככל 200 מיקרוגרם / ul. תופעות אלה הן קשות לחיזוי מניסויים בתרבית תאים והריכוז האופטימלי nuclease עבור שתי הישרדות העובר ושיעור שינוי של מוקד היעד צריך להיקבע באופן אמפירי. ZFN מאוד פעיל או Talen יכול לבקע רצף היעד שלהם מעבר לשלב אחד התא של עובר microinjected ובכך לגרום דפוסים מורכבים של mutagenesisפסיפס ד במקימים. אנו ואחרים 4 הבחנו שלושה או יותר אללים מוטציה מובחנים במייסד יחיד (איור 5 ג). לכן, כאשר הקמת קו עכבר חדש ממייסדים אלה, צאצאים צריכים להיות מוקרנים בזהירות על ידי רצף לנוכחות של המוטציה החיובית מאז מבחני עיכול לספק ראיות היחידה שמוטציה לא מוגדרת היא הווה. אחת הביקורות שהושמע נגד לעתים קרובות מערכות ZFN וTalen היא האפשרות כי nucleases אלה הם גם מסוגל ביקוע רצפי הווה במקום אחר בגנום הדומים לאתרי היעד. כגון השפעות מחוץ היעד כבר נצפו עם ריאגנטים דור מוקדם באמצעות תחום FokI homodimeric, ומבני heterodimer נועדו להקל על תופעות מחוץ יעד 25. ניתן לחזות באתרים מחוץ היעד פוטנציאליים במידה מסוימת בסיליקו 32,33 והוקרנו על ידי PCR וסדר. O יתרון ברורו באמצעות ZFNs וTALENs ליצירת עכברים ולא שורות תאים הוא האפשרות של הסרת ממוטציות היעד לא צמודות לשינוי הגנום רצוי על ידי ביצוע כמה הכלאות לאחור לזן פראי סוג של בחירה. לניתוח של מספר רב של עכברי מייסד, רצף עמוק של הדור הבא של מוצרי ה-PCR שנוצרו מהלוקוס ממוקד nuclease וסיליקו חזו מחוץ יעד לוקוסים עשויים להציע קריאת נתונים איכותיות וכמותית חלופה למבחני העיכול של מוצרי ה-PCR. טכניקות רבייה בסיוע מתוארות בפרוטוקול זה מותאמות לזני עכבר סטנדרטיים המשמשים לניסויי microinjection כגון C57BL/6J או B6D2F1. עכברים של מקורות שונים, כגון זני outbred, יכולים בעיקרון לשמש לגישות עריכת הגנום ועשויים לספק רקע גנטי מתאים יותר לשאלות מחקר ספציפיות. הביצועים של טכניקות רבייה בסיוע כגון superovulation יכולים להיות predicted למספר הזנים 34-36 אבל עשוי לדרוש אופטימיזציה נוספת לזנים סטנדרטיים על מנת לקבל מספר מספיק של עוברים לmicroinjection nuclease. חוץ מZFN וTalen, nucleases המעצב החדש כגון מערכת CRISPR/Cas9 מודרך RNA 9,37,38 יש עכשיו כבר הציג עבור יישומי עריכת הגנום. כל השיטות לmicroinjection וניתוח של בעלי החיים מייסד המתוארים כאן תקפות גם לCRISPR/Cas9 ומצבים עתידיים של עריכת הגנום.

עכברים הם ללא ספק הפלטפורמה הפופולרית ביותר ליצירת מודלים של בעלי חיים מהונדסים. ארגז הכלים תכליתיים להנדסה גנטית של עובר עכבר 1-3 הורחב לאחרונה על ידי גישות עריכת הגנום מבוססות על nucleases מעצב כגון nucleases אצבע אבץ (ZFN) 4-6, nucleases שעתוק כמו activator-מפעיל (Talen) 7,8, וחוזר התקבצו interspaced באופן קבוע הקצר palindromic (CRISPR) / מערכת (CAS) 9 הקשורים CRISPR 9. ZFN ותפקוד Talen כזוגות של שני תחומים מותאמים במיוחד המבוסס על חלבון קושר DNA (מערכים של חלבוני אצבע אבץ וחזור משתנה di-שאריות (RVDs), בהתאמה), שכל אחד מהם מצמידים את endonuclease FokI 10-12. לעומת זאת, את הספציפיות של מחשוף ה-DNA בתיווך Cas9 מסופקת על ידי transactivating RNAs CRISPR (crRNA וtracrRNA, אשר יכול גם להיות משולב לתוך מולקולת RNA chimeric בודדת RNA מדריך כינה) 11 הפועלים בקומפלקס עםחלבון CRISPR. TALENs עם רצף מוגדר של RVDs ניתן לבנות במהירות על ידי הנסיינים בודדים עם שפע של אסטרטגיות הרכבה לבחירה 13-17. CRISPR/Cas9 מבטיח דור עתיר עבודה אפילו פחות מnucleases המעצב, לעומת זאת את הספציפיות של מדריך RNA-DNA מחייב עדיין לא נפתרו לחלוטין 18,19. דור של ZFNs המותאם אישית עד כה היה מוגבל למעבדות אקדמיות ומקצועיות לספקים מסחריים כגון Sangamo Biosciences ושירות Sigma CompoZr. באופן כללי, הגנום עריכה עם nucleases מעצב מטרתו החדרת הפסקות גדיל כפולים (DSB) בלוקוסים הגנומי מוגדרים, אשר לאחר מכן למשוך סוף nonhomologous להצטרף (NHEJ) או רקומבינציה הומולוגית מנגנונים 10,12 (HR) תיקון DNA. תיקון תיווך NHEJ של DSB לעתים קרובות תוצאות במבוא של הוספות ומחיקות בסמיכות לאתר של תיקון. תיקון ג וכך NHEJניתן לנצל ללדפוק את הפונקציה של גן מטרה על ידי החדרת מוטציה מסגרת משמרת בתוך 4,7,9 רצף מקודד חלבוני גנים. לחלופין, תוספת או החלפה של מידע גנטי מוגדרים יכולה להיות מושגת על ידי מתן תורם DNA ביחד עם nucleases המעצב. תורם ה-DNA מורכב מרצפי DNA-נועד חוקר מוקף אזורים של הומולוגיה עם מוקד היעד, ובכך משמשים כתבנית לתיקון DSB על ידי משאבי אנוש. פלסמידים שני 5,6,20 וoligonucleotides חד גדילי 8,9,21 שימשו בהצלחה כתורמים. לא NHEJ-ולא עריכת הגנום בתיווך משאבי אנוש דורש את ההקדמה של סמן לבחירה לתוך הגנום של עובר העכבר, מה שהופך את האסטרטגיות האלה גם מתאימות במיוחד ליצירת שינויים קטנים ברצף נוקליאוטידים מבלי להפריע הארכיטקטורה הגנטית בכללותה. בפרוטוקול זה אנו מתארים את כל הליכים החיוניים לעריכת הגנום בעובר עכבר באמצעות TALENs. אלה כוללים 1) זיהוי של אתר יעד Talen 22, 2) הבנייה של TALENs ידי שיבוט שער זהב 13, 3) סינתזה במבחנה של Talen-mRNA, 4) microinjection של Talen mRNA לביציות מופרות עכבר, 5) ניתוחים לעוברים , וניתוח של mutagenesis-Induced Talen בבעלי חיים מייסד 6). אנו מתמקדים בmicroinjection Talen mRNA והקרנה של מייסדים להוספות / מחיקות-Induced NHEJ. לשם כך יש לנו שנוצרו מבני Talen bifunctional המאפשרים גם ביטוי בתאי יונקים כאשר transfected כפלסמידים ובסינתזת מבחנה של Talen mRNA עבור microinjection לעוברי עכבר. מבנים אלה מהווים את עמוד השדרה לסיפור קטוע 23 התמזגו FokI heterodimeric תחומים 24,25 לעריכת הגנום אופטימלית בתאי יונקים. פרוטוקול זה גם יכול להיות מאומץ לmicroinjection של nucleases מעצב האחר, או לזריקות בשילוב של nucleases המעצבומבנים תורמים (עיצוב של תורמי DNA תואר בפרסומים טכניים מעולים על ידי Wefers et al. 26,27). הצהרה אתית כל הניסויים בבעלי החיים בוצעו בהתאם להנחיות והתקנות של משרד וטרינרית Cantonal של קנטון ציריך.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

עכברים הטרנסגניים ביצוע שינויים ספציפי באתר הגנום (נוקאאוט, לדפוק ב) הם בעלי חשיבות חיונית ללנתח מערכות ביולוגיות מורכבות, כמו גם לדוגמנות מחל אנושיות ובדיקת אסטרטגיות טיפוליות. ההתקדמות שחלה באחרונה בשימוש בnucleases המעצב כגון nucleases אצבע אבץ (ZFNs), nucleases מפעיל כמו activator-שעתוק (TALENs), וחוזר palindromic הקצר interspaced באופן קבוע באשכולות (CRISPR) / מערכת (CAS) הקשורים CRISPR 9 לאתר הנדסת הגנום ספציפית לפתוח את האפשרות לבצע שינוי הגנום ממוקד מהיר כמעט בכל מיני מעבדה, ללא הצורך להסתמך על גזע עוברי טכנולוגיית תא (ES). ניסוי עריכת הגנום בדרך כלל מתחיל עם זיהוי של אתרי יעד nuclease מעצב בתוך גן של עניין ואחרי הבנייה של תחומים-DNA מחייבת מותאמים אישית כדי לכוון את פעילות nuclease למוקד גנומית המוגדר על ידי החוקר. פלסמידים nuclease מעצב הם במבחנה &lt;/ Em&gt; עיבד ליצירת ה-mRNA לmicroinjection של ביציות מופרות בעכבר. כאן, אנו מספקים פרוטוקול להשגת שינוי הגנום ממוקד על ידי הזרקה ישירה של Talen mRNA לביציות מופרות בעכבר.

אנו נבנו פלסמידים יעד תואמים את ההרכבה גולדן GateTALEN פורסמה על ידי צ&#39;רמאק et al. 13 המאפשרים ביטוי של TALENs בתאי יונקים, כמו גם סינתזת ה-mRNA במבחנה מאמרגן הפאג T7 (תרשים 1C). פלסמידים אלה נושאים תחומים heterodimeric FokI (מוטציות ELD או KKR) אשר הוכחו כדי להפחית את ההשפעות מחוץ היעד ביחס לhomodimers FokI וכדי לשפר את פעילות מחשוף בהשוואה לדור הראשון FokI heterodimers 25,29. תגובת הרכבה שער זהב # 1 # 2 הם בדרך כלל יעיל מאוד וכל לבן מושבה, כאשר נותח על ידי המושבה PCR, מציגה את הדפוס הצפוי למספר המסוים של RVDs המשובט (איורים 1B ו 1D). ניתוח של ג&#39;ל במבחנה mRNA מסונתז (איור 2) צריך לחשוף להקה להבחין יחידה עם כתם קטן או לא עבור כל מדגם ניתח. לא צריך להיות שינוי בגודל ברור בין דגימות L1/R1 וL2/R2, L3/R3, אשר מציין polyadenylation המוצלח. בעלי חיים מייסד יכולים להיות מוקרנים ל- Induced NHEJ אללים מוטציה באמצעות גנוטיפ PCR ואחריו גם עיכול endonuclease T7 (איור 3) או לעכל הגבלה באמצעות אנזים המסלק את הרצף מהסוג בר בתוך אזור spacer של צמד nuclease (איור 4). Assay endonuclease T7 הוא ישים לכל סוג של מוטציה ללא התחשבות ברצף הגנומי הספציפי בתוך אזור spacer של צמד nuclease הזריק; עם זאת, הוא מזהה חוסר התאמה רק בין גדילי דנ&quot;א במוצרי ה-PCR heteroduplex. לפיכך, במקרה הנדיר שמייסד נושא שני אללים מוטציה זהה, מוצרי ה-PCR לא מראים שום דפוס עיכול T7. הבחנה כזו היא, לעומת זאת, תמיד אפשרית כאשר אתר הגבלה ספציפי ממוקם בתוך אזור spacer nuclease שיבוטל על ידי NHEJמושרה הוספות / מחיקות (איור 5). הנה, להקות מעוכלים להעיד על הנוכחות של מוטציות, והעדר כל מוצרים מתעכלים מצביע בצורה חזקה מייסד נושא מוטציות בשני אללים של הגן הממוקד (מסומן בכוכביות באיור 4). <img alt="איור 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> איור 1. שיבוט שער זהב של RVDs Talen לתוך וקטורי pCAG-T7-יעד heterodimeric.) אסיפה של מערכי RVD לוקטורי pFUS. כאן מוצגת דוגמא לזוג Talen עם מערכים לסיפור אישיים הכוללים 15 RVDs ו17 RVDs, בהתאמה (עבור מערכים לסיפור ארוכים יותר מ21 RVDs, שלוש אסיפות pFUS-RVDs נדרשות, לא מוצגות). חצים מצביעים על פריימרים לpFUS ספציפי PCR תגובות המושבה. מוצרי B) PCRמוגבר של מכלולי pFUS נכונים בדרך כלל יופיע להקה מקבילה לאורך המשולב של כל משובט RVDs (למשל סביב 1.1 kb ל10 RVDs) וC &quot;הסולם&quot; של להקות פחות בולטות קטנות יותר בשל האופי חוזר ונשנה של מערכי RVD.) הרכבה סופית של מערכי pFUS-RVD ופלסמיד המכיל חוזר האחרון (PLR) לוקטורי ביטוי heterodimeric Talen עם גרסאות FokIELD וFokIKKR, בהתאמה. עמוד השדרה Talen (המבואר כN ו-C) דומה לארכיטקטורה שפורסמה על ידי מילר ואח&#39;. 23 אמרגן CAG (אלמנט משפר מוקדם CMV / עוף ביתא אקטין) מבטיח רמות ביטוי גבוה בתאי יונקים transfected, בעוד אמרגן הפאג T7 מאפשר ב סינתזת המבחנה mRNA (להשתמש SACI לינאריזציה של הווקטור במורד הזרם של קודון STOP nuclease). ד) המושבה PCR באמצעות פריימרים מסומנים על ידי חצים בC) מאפשר זיהוי של TALENs התאסף בצורה נכונה. מלא lengtמוצרי h-PCR הם לעתים קרובות פחות בולטים בזמן &quot;אפקט הסולם&quot; מייצג אינדיקטור חזק של הרכבה מוצלחת. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">לחצו כאן לצפייה בתמונה גדולה יותר.</a> <img alt="איור 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> איור 2. . בקרת איכות nuclease mRNA בסינתזת מבחנה באמצעות ג&#39;ל אלקטרופורזה agarose mRNAs ZFN מוצג כדוגמא (L, עזב ZFN; R, ZFN מימין). דוגמאות L1/R1 להראות mRNA לפני polyadenylation, דגימות מופע L2/R2 polyadenylated mRNA וL3/R3 להראות mRNA polyadenylated מטוהר. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">לחץ כאן לצפייה בתמונה גדולה יותר.</a> <img<html> alt = &quot;איור 3&quot; עבור: תוכן width = &quot;6in&quot; עבור: רוחב src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; = &quot;600&quot; /&gt; איור 3. דוגמא של assay endonuclease T7 המשמש לזיהוי של בעלי חיים מייסד נושאים מוטציות הנגרם nuclease של מוקד היעד. א) זוג Talen נועד לבקע בתוך אזור הקידוד של גן חלבון פריון העכבר (Prnp, רצף יעד Talen יכול להיות מסופק על פי דרישה). מוצר ה-PCR מופק באמצעות פריימר קדימה (F) ממוקם 110 נ&quot;ב במעלה הזרם ופריימר הפוכה (R) 250 נ&quot;ב במורד הזרם של אתר המחשוף Talen. ב &#39;) המוצר ה-PCR הוא נתון בהמשך לheteroduplex היווצרות ועיכול endonuclease T7. C) mutagenesis-Induced Talen בתוך אזור גנומי הממוקד של מייסדים אחת מתגלה על ידי הנוכחות של מוצר ה-PCR באורך מלא עם מוצרי עיכול של 250 ו110 bps.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; לחץ כאן לצפייה בתמונה גדולה יותר. <img alt="איור 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> איור 4. דוגמא לתקציר הגבלה של מוצרי ה-PCR משמשים לזיהוי של בעלי חיים מייסד נושאים מוטציות הנגרם nuclease של מוקד היעד. ספציפי ZFN למוקד היעד 29 העכבר Rosa26 אתר הגבלת XbaI בתוך אינטרון 1. מייסדים) הוקרנו על ידי genotyping-PCR באמצעות פריימר קדימה (F) ממוקם 500 נ&quot;ב במעלה הזרם ופריימר הפוכה (R) 250 נ&quot;ב במורד הזרם של אתר המחשוף. ב &#39;) עיכול של מוצרי ה-PCR עם XbaI מגלה דפוסי עיכול מצביעים על עכברים עם מוטציות דו allelic (מסומנים בכוכביות), מונו -Allelic מוטציות (להקות מעוכלות והבלתי מעוכלים, למשל בעלי חיים 2)סידור ועכברי WT (עיכול שלם, למשל בעלי החיים 21). C) של עכברים עם שינויים דו allelic פוטנציאל מראה עד 3 (בעלי חיים 24 הוספות / מחיקות) מובחנות. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">לחץ כאן לצפייה בתמונה גדולה יותר.</a> <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> שמו של פריימר </td><td> רצף 5 &#39;ל 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> טבלת 1. רצפים של צבעי יסוד המשמש לPCRs מושבה ורצף בתוך מכלול שער זהב Talenפרוטוקול. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> פלסמיד / אוסף </td><td> תורם </td><td> Addgene מזהה </td><td> תגובות </td></tr><tr><td> שער זהב Talen וטל Effector ערכת 2.0 </td><td> מעבדה Voytas </td><td> 1000000024 </td><td> מכיל את כל פלסמידים הדרושים להרכבת שער זהב Talen </td></tr><tr><td> וקטורי יעד pCAG-T7-Talen -KKR/ELD </td><td> מעבדה פלזר </td><td> 40,131, 40132 </td><td> Add-on פלסמידים לביטוי Talen בתאי יונקים ובסינתזת ה-mRNA במבחנה </td></tr></tbody></table> טבלה 2. ניתן להשיג פלסמידים ואוספי פלסמיד הנדרשים להרכבת שער זהב Talen מAddgene <a href="http://www.addgene.org">(www.addgene.org).</a> <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> באינטרנטמשאב </td><td> תגובות </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> עיצוב של Talen; תחזית מחוץ יעד Talen </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> עיצוב של Talen, OPEN ZFN, קודה ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> עיצוב של Talen, CRISPR/Cas9; CRISPR/Cas9 חיזוי מחוץ היעד </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> הרכבה של Talen רצפים לאישור תוצאות רצף </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> עיצוב של ההרכבה מודולרי ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> עיצוב של ההרכבה מודולרי ZFN </td></tr></tbody></table> לוח 3. משאבים מקוונים לעיצוב ZFN, Talen, וCRISPR/Cas9. </sטרונג&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

nucleases מעצב כגון nucleases אצבע אבץ (ZFNs) וnucleases מפעיל כמו activator-שעתוק (TALENs) יכול לשמש כדי לשנות את הגנום של עוברי preimplantation עכבר על ידי מפעילה שני סוף nonhomologous להצטרף (NHEJ) ורקומבינציה הומולוגית מסלולים (HR). מקדמות אלה לאפשר את הדור המהיר של עכברים עם שינויים גנטיים מדויקים.

עכבר הגנום הנדסה באמצעות nucleases מעצב

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Nanyang Technological University

Research

JoVE Journal

Biology

28.7K Views.  University of Zurich.  nucleases מעצב כגון nucleases אצבע אבץ (ZFNs) וnucleases מפעיל כמו activator-שעתוק (TALENs) יכול לשמש כדי לשנות את הגנום של עוברי preimplantation עכבר על ידי מפעילה שני סוף nonhomologous להצטרף (NHEJ) ורקומבינציה הומולוגית מסלולים (HR). מקדמות אלה לאפשר את הדור המהיר של עכברים עם שינ...

Video: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Dissection גרוס פיין epithelia של האוזן הפנימית חושית למבוגרים דג הזברה ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

הנדסה Cell-חדיר חלבון

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

הגנום כולו ניתוח (טעינה) רמות Aminoacylation של tRNA שימוש microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

הגנום כולו ניתוח באמצעות שבב זיהוי איזופורם ספציפי מטרות ג&#39;ין

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

בשנת vivo ההדמיה לטיפולים במודל עכבר orthotopic של סרטן השחלות

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Cytometry זרימה טיהור תאים עכבר meiotic

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

הגנום כולו מסך עבור מטרות מירנה שימוש יעד המשימה ספריית מזהה

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

הגנום עורך עם אצבע CompoZr nucleases אישית אבץ (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

בדוגמנות Vivo של הגנום האנושי החולנית באמצעות Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

הגנום עריכה<em&gt; Astyanax mexicanus</em&gt; שימוש תמלול Activator דמוי מפעיל nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...