Method Article
Here, we demonstrate the in vivo function of cutaneous dendritic cell subsets in Th17 immunity of deep dermal Candida albicans infection.
The skin is the outermost barrier organ in the body, which contains several types of dendritic cells (DCs), a group of professional antigen-presenting cells. When the skin encounters invading pathogens, different cutaneous DCs initiate a distinct T cell immune response to protect the body. Among the invading pathogens, fungal infection specifically drives a protective interleukin-17-producing Th17 immune response. A protocol was developed to efficiently differentiate Th17 cells by intradermal Candida albicans infection to investigate a subset of cutaneous DCs responsible for inducing Th17 immunity. Flow cytometry and gene expression analyses revealed a prominent induction of Th17 immune response in skin-draining lymph nodes and infected skin. Using diphtheria toxin-induced DC subset-depleting mouse strains, CD301b+ dermal DCs were found to be responsible for mounting optimal Th17 differentiation in this model. Thus, this protocol provides a valuable method to study in vivo function of differential subsets of cutaneous DCs to determine Th17 immunity against deep skin fungal infection.
The skin is the outermost barrier organ, which protects the body from invading external pathogens and stimuli1. Skin is composed of two distinct layers, including the epidermis-a stratified epithelium of keratinocytes-and the underlying dermis-a dense network of collagen and other structural components. As a primary epithelial barrier tissue, the skin chiefly provides physical barriers and contributes to additional immunological barriers as it contains numerous resident immune cells2,3. Among the cutaneous immune cells, dendritic cells (DCs) are a type of professional antigen-presenting cells, which actively take up self- and non-self-antigens and migrate to the regional lymph nodes (LNs) to initiate antigen-specific T cell responses and tolerance according to the nature of antigens4.
The skin harbors epidermal antigen-presenting cells, namely the Langerhans cells (LCs) and at least two types of DCs, including dermal type 1 conventional DCs (cDC1) and dermal type 2 conventional DCs (cDC2)5. Epidermal LCs are of embryonic monocytic origin and maintain their cell number by self-perpetuation under homeostatic conditions6. In contrast, dermal cDC1 and cDC2 are of hematopoietic stem cell origin and are continuously replenished by DC-committed progenitors5. Cutaneous DCs are characterized by their surface markers, roughly divided into Langerin+ (including LCs and cDC1) and CD11b+Langerin- populations (mainly cDC2). In addition, this group has revealed that the CD11b+Langerin- DC population is further classified into two subsets according to CD301b expression7.
The important functional features of cutaneous DCs are centered on a division of labor, determined mainly by the intrinsic nature of each subset of DCs, in situ locations of the DCs, the tissue microenvironment, and local inflammatory cues8. These functional characteristics of cutaneous DCs necessitate the investigation of the role of specific subsets of DCs during certain types of immune response of the skin. Upon antigenic stimulation by cutaneous DCs in the draining LNs, naïve CD4+ T cells differentiate into specific subsets of helper T cells, which produce a set of defined cytokines for exerting their effector function9. Among the CD4+ helper T cell subsets, interleukin-17 (IL-17)-producing Th17 cells play a crucial role in autoimmune diseases and antifungal immunity10. In this regard, cutaneous fungal infection has been a robust model to study Th17 immunity in vivo11,12,13. When tape-stripped skins are epicutaneously exposed to the Candida albicans (C. albicans) yeast, epidermal LCs play a pivotal role in driving antigen-specific Th17 differentiation14.
Protective immunity against intradermal C. albicans infection requires innate immunity such as the fibrinolytic activity of fibroblasts and phagocytes15. However, little is known about the role of cutaneous DC subsets in establishing Th17 immunity in deep dermal C. albicans infection. This paper describes a method of intradermal skin infection of C. albicans, which produces local and regional Th17 immune responses. The application of diphtheria toxin (DT)-induced DC subset depletion mouse strains revealed that CD301b+ dermal DCs are crucial for Th17 immunity in this model. The approach described here allows for the study of the Th17 response to deep dermal invasive fungal infection.
NOTE: All animal experiments were approved by the Institution Animal Care and Use Committee (IACUC, Approval ID: 2019-0056, 2019-0055). Seven to 9-week-old wild-type (WT) C57BL/6 female mice weighing 18-24 g were used for this study. Some studies were performed using female Langerin-diphtheria toxin receptor (DTR) and CD301b-DTR mice of the same age and weight. Four to six mice were used in each group for an experiment, and the data are representative of three independent experiments. This work was conducted under Biosafety Level 3 conditions, which could also be carried out under Biosafety Level 2 conditions according to institutional guidelines (room temperature 23 °C ± 3 °C, humidity 50% ± 10%).
1. Preparation of Candida albicans
NOTE: Experiments in this section were performed in a biological safety cabinet.
2. Mouse footpad infection with C. albicans
Figure 1: Schematic diagram of intradermal Candida albicans infection model. (A) The hind footpads of mice were injected intradermally with 1 × 107 C. albicans. After 7 days, the footpads of mice were re-exposed to 1 × 107 HK C. albicans by intradermal injection, and the delayed-type hypersensitivity response was measured 24 h after antigen challenge. Local Immune response during C. albicans sensitization was analyzed after 7 days in skin-draining LNs. (B, C) Images of footpads before intradermal footpad injection with C. albicans. (D, E) Injection of C. albicans into the deep dermis of the right footpad. (F, G) Clinical signs of redness and swelling following footpad injection of the right footpad. (H) A sketch showing lymphatic pathways from the footpad to popliteal LNs following C. albicans injection. (I) Exposed popliteal LNs located behind the knee 7 days after C. albicans injection and (J) without injection. Abbreviations: HK = heat-killed; LNs = lymph nodes. Please click here to view a larger version of this figure.
3. Diphtheria toxin-induced dendritic cell depletion in vivo
NOTE: In this study, both Langerin-DTR and CD301b-DTR mice were treated with DT 1 day before and after intradermal sensitization to C. albicans.
4. Quantitative real-time polymerase chain reaction
5. Cell isolation and flow cytometric analysis
Here, we demonstrated an intradermal infection model of C. albicans to study the role of cutaneous DC-mediated Th17 immune response in vivo. Following an initial intradermal injection with C. albicans into the footpad, the skin-draining LNs were enlarged (Figure 2A). During the sensitization period, the ratio of CD4+ to CD8+ effector T cells was notably increased (Figure 2B,C). Additionally, the effector CD4+ T cells abundantly produced IL-17A relative to the effector CD8+ T cells (Figure 2D,E). These results indicated that intradermal C. albicans infection potently drives IL-17A-producing-CD4+ T cell immunity.
The expression of interferon gamma (Ifnγ), Il4, and Il17a was observed in the challenged footpad skin with C. albicans (Figure 3). Although the initial sensitization with C. albicans led to increased levels of Ifnγ and Il4 mRNA at day 7, there was no increase in Il17a at this time point. Importantly, the mice showed a profound elevation of local Il17a expression 24 h after C. albicans re-exposure. However, the challenge with C. albicans did not further increase the mRNA levels of Ifnγ and Il4. These results indicated that re-exposure to C. albicans via the intradermal route, described in this protocol, efficiently induces an antigen-specific IL-17 response in the skin.
Skin DCs migrate and present antigens in the skin-draining LNs after exposure to antigens, initiating antigen-specific immune responses. A DT-induced, DC subset-depleted mouse system was used to determine which DC subsets are responsible for the Th17 immunity to C. albicans. Depletion of Langerin+ DCs (LCs and cDC1) resulted in comparable ratios of CD4+ to CD8+ T cells (Figure 4A-C) and IL-17A production from CD44+ effector CD4+ T cells in skin-draining LNs (Figure 4D,E). Meanwhile, the depletion of CD301b+ cDC2 significantly attenuated IL-17A expression along with a relative decline in CD4+ T cells (Figure 4A-E). These findings demonstrate that CD301b+ dermal DCs invoke a protective Th17 immune response against deep dermal C. albicans infection in vivo.
Figure 2: Intradermal Candida albicans infection induces Th17 cell differentiation in skin-draining LNs. (A) Representative images of skin-draining LNs in naïve (upper) or C. albicans-sensitized mice (lower) 7 days after intradermal injection into the footpad. (B) Gating strategies for the effector T cells of skin-draining LNs at day 7 post-infection. (C) The proportion of CD4+ to CD8+ effector T cell population in skin-draining LNs 7 days after intradermal sensitization. (D) Representative flow cytometric plots of intracellular IL-17A expression from effector CD4+ T cells or CD8+ T cells in skin-draining LNs 7 days after intradermal infection. (E) The absolute cell numbers of IL-17A-producing cells from effector CD4+ or CD8+ T cells. Data are from at least two independent experiments with four to seven mice per group. Error bars indicate mean ± standard error of the mean. ***, p<0.001. Abbreviations: LNs= lymph nodes; CD = cluster of differentiation; IL = interleukin; FSC = forward scatter; SSC = side scatter; A = area of peak; H = height of peak; TCR = T cell receptor; ns = not significant. Please click here to view a larger version of this figure.
Figure 3: The lesional skin re-exposed to Candida albicans characteristically exhibits an antigen-specific IL-17 response. Gene expression analysis of Ifng, Il4, and Il17a in the footpad skin before (7 days after sensitization) and 24 h after HK C. albicans challenge via intradermal injection compared to the naïve skin. Data are from at least two independent experiments with four to five mice per group. Error bars indicate mean ± standard error of the mean. **, p<0.005. Abbreviations: HK = heat-killed; IL = interleukin; Ifng = interferon gamma gene; ns = not significant. Please click here to view a larger version of this figure.
Figure 4: CD301b+ dermal DCs drive Th17 immunity against deep dermal Candida albicans infection. The skin-draining LNs of naïve, WT, Langerin-DTR, and CD301b-DTR mice with DT treatment were analyzed by flow cytometry 7 days after intradermal C. albicans infection. (A) Validation for the depletion of specific DC subsets in the epidermis and dermis of WT, Langerin-DTR, and CD301b-DTR mice after DT treatment. (B) Gating strategies for the CD4+ and CD8+ T cells of skin-draining LNs at day 7 post-infection. (C) The ratios of CD4+ to CD8+ T cells in each experimental group. (D) Representative flow cytometric plots of intracellular IL-17A production from CD44+CD4+ effector T cells in each experimental group. (E) The absolute numbers of IL-17A-producing Th17 cells in each experimental group. Data are from at least two independent experiments with five to six mice per group. Error bars indicate mean ± standard error of the mean. **, p<0.005; ***, p<0.001. Abbreviations: DCs = dendritic cells; WT = wild-type; DTR = diphtheria toxin receptor; DT = diphtheria toxin; CD = cluster of differentiation; LNs = lymph nodes; IL = interleukin; Th17 = T helper 17 cells; ns = not significant. Please click here to view a larger version of this figure.
Genes | Forward | Reverse |
Hprt | TCAGTCAACGGGGGACATAAA | GGGGCTGTACTGCTTAACCAG |
Il4 | AGATCATCGGCATTTTGAACG | TTTGGCACATCCATCTCCG |
Il17a | CAGCAGCGATCATCCCTCAAAG | CAGGACCAGGATCTCTTGCTG |
Ifng | GATGCATTCATGAGTATTGCCAAGT | GTGGACCACTCGGATGAGCTC |
Table 1: Primer sequences.
This paper describes a method of intradermal C. albicans infection that allows the study of the role of cutaneous DCs in Th17 immune response in vivo. By applying multiparametric flow cytometric analysis with DT-induced mouse strains, we found that CD301b+ dermal DCs are a crucial cutaneous DC subset for initiating Th17 immunity against deep dermal C. albicans infection. Moreover, the results showed that the IL-17-producing T cell response was mainly produced by CD4+ but not by CD8+ T cells, indicating that this model is a faithful model of Th17 immunity in vivo.
Previous elegant studies have shown that epicutaneous C. albicans infection led to Th17 immunity through IL-6-producing epidermal LCs14,16. Moreover, a Th17 response to C. albicans epicutaneous infection was specifically induced by the yeast form but not by the hyphal form of C. albicans, suggesting that the morphology of C. albicans is crucial for antifungal Th17 immunity16. Therefore, this protocol also utilizes the yeast form of C. albicans, which would transform into the hyphal form under nutrition-enriched and higher temperature conditions17. It is unclear whether an intradermal injection of C. albicans hyphae would induce Th17 immunity. Although previous studies have demonstrated the role of innate immunity against intradermal C. albicans hyphal infection that resulted in a high interferon-γ immune response, they did not evaluate the IL-17 response15,18. Future studies would be needed to demonstrate differences in Th17 immunity between the yeast and hyphal forms of intradermal infection.
The dermis contains all subsets of cutaneous DCs. In contrast to epicutaneous infection, this protocol shows that CD301b+ dermal DCs are crucial for inducing Th17 immunity against intradermal C. albicans infection in the regional LNs. Compared to the epicutaneous infection of C. albicans, an intradermal administration route could bypass the persistent exposure of C. albicans on the epidermal surface and the resultant epidermal injury mediated by C. albicans pseudohyphae invasion14. This might induce a lesser degree of epidermal LC activation, which requires IL-1β production and subsequent keratinocyte-derived tumor necrosis factor-alpha (TNF-α) for their migration to regional LNs19.
Furthermore, an initial intradermal location of C. albicans would lead to strong activation and enhanced uptake by dermal DCs. Among the dermal DCs, previous studies have shown that CD11b+ cDC2 and CD301b+ cDC2 mediate a Th17 immune response both in the intestine and the skin7,20. The results herein demonstrate the crucial role of CD301b+ dermal DCs for Th17 cell priming in the intradermal C. albicans infection model. Thus, this model provides an important experimental protocol to study Th17-centered immunological features of deep dermal fungal infection, which is more prevalent in immunocompromised individuals21. The use of immunodeficient mouse strains in this protocol will shed light on the new immunopathogenesis of the deep cutaneous fungal infection.
For a successful experiment to analyze the Th17 immune response to deep dermal C. albicans infection, users must be familiar with the anatomical dissection of skin-draining popliteal LNs (Figure 1). In addition, users must be trained in multicolor flow cytometric analysis of T cells in the LNs. Advanced knowledge of cutaneous immunology is also required to follow this protocol. The use of this method is therefore ideal to better understand the roles of each cutaneous DC subset during deep fungal skin infections.
The authors have no conflicts of interest to declare.
This research was supported by Samjung-Dalim Faculty research grant of Yonsei University College of Medicine (6-2019-0125), by a Basic Science Research Program through the National Research Foundation of Republic of Korea funded by the Ministry of Education (2019R1A6A1A03032869) and Ministry of Science and Information and Communications Technology (2018R1A5A2025079, 2019M3A9E8022135, and 2020R1C1C1014513), and by Korea Centers for Disease Control and Prevention (KCDC, 2020-ER6714-00).
Name | Company | Catalog Number | Comments |
0.3 mL (31 G) insulin syringe | BD | 328822 | |
1x Perm/Wash buffer | BD | 554723 | |
1 mL (30 G) syringe insulin syringe | BD | 328818 | |
24 well-plate | Falcon | 353047 | |
50 mL conical tube | Falcon | 50050 | |
70 μm strainer | Falcon | 352350 | |
70% ethanol | |||
ABI StepOnePlus real-time PCR system | Applied Biosystems | ||
Anesthesia chamber | Harvard Apparatus | ||
Brefeldin A | BD | BD 555029 | |
β-Mercaptoethanol | Gibco | 21985023 | |
Candida albicans strain SC5314 | provided by Daniel Kaplan at Pittsburgh University | ||
CD3 | BioLegend | 100216 | Clone 17A2 |
CD301b-DTR mice | provided by Akiko Iwasaki at Yale University | ||
CD4 | BioLegend | 100408 | Clone GK1.5 |
CD44 | eBioscience | 47-0441-80 | Clone IM7 |
CD8a | BD Biosciences | 553031 | Clone 53.6.7 |
Centrifuge | |||
Clicker counter | |||
Cuvette | Kartell | KA.1938 | |
Cytofix/Cytoperm solution | BD | 554722 | |
Diphtheria toxin (DT) | Sigma | ||
Dulbecco's phosphate-buffered saline (DPBS) | Welgene | LB001-02 | |
FACS (Fluorescence-activated cell sorting) buffer | In-house | ||
Fc receptor blocker | BD | 553142 | |
Fetal bovine serum (FBS) | Welgene | S101-07 | |
Forceps | Roboz | for harvesting sample | |
Hemocytometer | Fisher Scientific | 267110 | |
Hybrid-R total RNA kit | GeneAll Biotechnology | 305-101 | |
hydroxyethyl piperazine ethane sulfonic acid (HEPES) | Gibco | 15630-080 | |
IL-17A (intracellular cytokine) | BioLegend | 506912 | Clone TC11-18H10.1 |
Ionomycin | Sigma | I0634 | |
Isoflurane | |||
Langerin-DTR | provided by Heung Kyu Lee at Korea Advanced Institute of Science and Technology | ||
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit | Invitrogen | L34957 | |
Loop and Needle | SPL | 90010 | |
Monensin | BD | BD554724 | |
NanoDrop 2000 | Thermo Scientific | ||
Penicillin | Gibco | 15140-122 | |
Petri dish | SPL | 10090 | |
Phorbol 12-myristate 13-acetate (PMA) | Sigma | P8139 | |
PrimeScript RT Master Mix | Takara Bio | RR360A | |
RPMI 1640 | Gibco | 11875-093 | |
Scissors | Roboz | for harvesting sample | |
Stainless Steel Beads, 5 mm | QIAGEN | 69989 | |
Sterile pipette tip | |||
SYBR Green Premix Ex Taq II | Takara Bio | RR820A | |
TCRβ | BioLegend | 109228 | Clone H57-597 |
ThermoMixer C | Eppendorf | ||
TissueLyser | QIAGEN | ||
UV-VIS spectrophotometer | PerkinElmer | ||
Wild-type C57BL/6 mice | Orient Bio | 7- to 9-week-old mice were used | |
Yeast-peptone-dextrose-adenine (YPDA) medium, liquid, sterile (1% yeast extract, 2% Bacto peptone, 2% dextrose) | |||
YPDA agar plate, sterile (1% yeast extract, 2% Bacto peptone, 2% dextrose, 2% Bacto agar) |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved