Los autores no tienen reconocimientos.

1. concatemerization <ol><li> Cebadores Resuspender Fw y Rv (véase la Tabla de Materiales para las secuencias de primers) a una concentración de 10 mg / l en la biología molecular de grado H 2 O. Luego, mezclar 5 l de Fw y 5 l de imprimación Rv en un tubo de 1.5 ml. </li><li> Mezcla de cebador recocido por calentamiento a la temperatura de recocido correcto (75 ° C para los cebadores descritos aquí) durante 15 min. Deja en el banco para que se enfríe a temperatura ambiente (TA). Prepare el PEG8000 60% durante esta incubación disolviendo en ddH 2 O. </li><li> Añadir 50 l de 60% ​​PEG8000 (para lograr una concentración final de 30%), 10 l de 10x polinucleótido quinasa (PNK) tampón, 27 l de H 2 O, y 3 l de PNK a la mezcla de cebadores. Incubar a 37 ° C durante 2 horas. </li><li> Enfriar a temperatura ambiente y añadir 11 l de tampón de ligasa de ADN. A continuación, añadir 3 U de ADN ligasa y se incuba a 37 ° C durante la noche. </li></ol> 2. DNA Purificationy análisis <ol><li> Añadir 300 l de H 2 O para aumentar el volumen de la mezcla de ligación. Nota: Proceda de una campana de extracción debido a la toxicidad del fenol: cloroformo vapor. </li><li> Añadir 1 volumen (400 l) de fenol: cloroformo y mezclar agitando vigorosamente. </li><li> Se centrifuga a velocidad máxima durante 1 min en una microcentrífuga de sobremesa. Las capas acuosas y de disolventes se separarán con la capa acuosa en la parte superior y una capa blanca de proteína precipitada entre las dos capas. </li><li> Transferir la capa superior a un nuevo tubo mediante una cuidadosa pipeteado (evitar la transferencia de media, capa blanca) </li><li> Repetir los pasos 2.2 y 2.3 al menos dos veces o hasta que no hay proteína precipitada después de la centrifugación. </li><li> Añadir 1 volumen (400 l) de cloroformo y repita los pasos 2.3 a 2.4. </li><li> Añadir 2 volúmenes (800 mu l) de etanol al 100% previamente enfriada y se incuba a 20 ° C durante al menos 1 hora o toda la noche. NOTA: este paso precipita los concatemers ADN. </li><li> Centrifugar a máxima velocidad y supe aspiradornatant. Lavar una vez por la adición de 1 ml de etanol al 70% y dejar secar al aire en la campana de humos. </li><li> ADN Resuspender en 50 l de ddH endotoxina libre 2 O. Nota: El uso de endotoxina libre de reactivos es crítico para la generación de una respuesta inmune innata-específica de ADN en las células e in vivo. </li><li> Quitar una alícuota de 2 l de ADN concatemerized en un tubo nuevo y añadir 1 ml de tampón de carga en gel de ADN. </li><li> Disolver 1% de agarosa en tampón TAE mediante calentamiento a plena potencia en un horno de microondas durante 2 min (o el tiempo que sea adecuada a la potencia del horno y el volumen). </li><li> Vierta gel en aparato de colada, añadir 4 l de colorante fluorescente quelante ADN, inserte un peine, y dejar a temperatura ambiente durante aproximadamente 20 minutos para que el gel se fijó. </li><li> Una vez establecido, quitar el gel de peine y el lugar en el tanque de electroforesis que contiene tampón TAE. Carga 3 l de la muestra de ADN o marcadores de tamaño en los pozos. </li><li> Ejecutar electroforesis en gel durante 30-40 min a 90 V con corriente constante. Visualize el ADN bajo luz ultravioleta para observar concatemerization (Figura 1A). </li><li> Medir la concentración de ADN en el resto de la muestra por espectroscopia de absorbancia de UV. En blanco con el espectrómetro de la misma ddH2O que se utilizó para resuspender el DNA y medir el espectro de absorbancia 200 a 300 nm. NOTA: la concentración de ADN se puede calcular usando la ley de Beer-Lambert, A = e * c * l, donde A es la absorbancia, e el coeficiente de extinción, y l la distancia de la trayectoria de la luz. Para la medición de las concentraciones de ADN de la absorbancia a 260 nm se debe medir y un coeficiente de extinción de 0,027 (mg / ml) -1 cm -1 utilizado. La distancia trayectoria de la luz, l, variará dependiendo del espectrofotómetro. Mientras que la medición de la concentración, tome nota de la relación de absorbancia 260/280 nm como una indicación de la pureza del ADN; Se recomienda un valor para este coeficiente por encima de 2.00. </li></ol> 3. transfección de ADN de doble cadena Concatemers En Vitro <ol><li> Se siembran las células en una placa de cultivo de tejido o placa a 70% de confluencia en el momento de la estimulación. </li><li> Calcular la masa de ADN necesario para la estimulación de las células utilizando una concentración final de 1-10 mg / ml. La masa requerida de ADN se observará como X a continuación. Por ejemplo, si se requiere la estimulación de células en un solo pocillo de una placa de 6 pocillos con 2 ml de medio a una concentración de ADN de 5 g / ml a continuación, una masa de 2 * 5 = 10 g de ADN. </li><li> Añadir 50 * X l de medio libre de suero en un tubo estéril de tamaño adecuado. Pipetear cuidadosamente en el centro del medio, sin tocar el lado del tubo, 2 * X l de reactivo de transfección lípido catiónico y se deja durante 5 min. </li><li> Añadir X g de ADN para el tubo y agitar brevemente. Deja a temperatura ambiente durante al menos 20 min. Para la transfección in vitro añadir esta mezcla directamente a las células para estimular las vías de detección de ADN citoplasmáticos. </li></ol> 4. Transfección de ADN de doble cadena que Concatemersn Vivo <ol><li> Preparar la mezcla de transfección como se describe en 3.1 a 3.5 usando 1 g de ADN, 2 l de reactivo de transfección de lípidos, y 18 l de medio libre de suero por oído del ratón para ser estimulada. Preparar un estéril 20 l Hamilton jeringa, tapa con un 30 G aguja estéril, y cargar con la mezcla de transfección de ADN. </li><li> Anestesiar a un ratón C57BL / 6 usando 1-2% de isoflurano. Confirme la anestesia por la pérdida de movimiento y el ritmo respiratorio constante y por la prueba de reflejo del pellizco si es necesario. Monitorear los ojos de los animales durante la anestesia y usar ungüento según sea necesario para evitar la sequedad excesiva. </li><li> Utilizando una técnica estéril, inyectar con cuidado en el pabellón de la oreja 10 l de la mezcla de transfección de manera que se forma una única &quot;burbuja&quot; de líquido entre las capas dérmicas de la oreja. Nota: Use un dedal de goma en el pulgar o el dedo índice, estire el oído sobre ella, e inyectar en un ángulo agudo para asegurar la aguja penetra sólo la primera capa de la piel del pabellón de la oreja. </li><li> Reintroducir ratón en la jaula y regularmente monitorear la recuperación post-anestésica. Utilice una lámpara de calentamiento para evitar el enfriamiento excesivo de los ratones anestesiados. No deje sin vigilancia los ratones hasta que hayan recuperado el conocimiento suficiente para mantener decúbito esternal. </li><li> Flash congelar todo el pabellón de la oreja en un tubo de microcentrífuga por inmersión en nitrógeno líquido durante 2 min. </li></ol> 5. Procesamiento de Muestras de ADN estimulada y análisis por PCR cuantitativa (qPCR) <ol><li> Desde el cultivo de células: medio aspirado con una pipeta y desechar los residuos. </li><li> Añadir 1 ml de PBS estéril. Repita 5.1 y 5.2 dos veces y vaya al paso 5.3 </li><li> De tejido de la oreja: moler el tejido en nitrógeno líquido usando una maja de cerámica estériles y mortero, transferir tejido tierra a un tubo de microcentrífuga con una espátula estéril, y vaya al paso 5.4 </li><li> Añadir 350 l de tampón de lisis y proceder con el protocolo de kit de extracción de ARN comercial. Eluir el ARN de purificación kit de extraccióncolumna de 40 l ddH 2 O. Nota: El kit de extracción de RNA comercial (ver materiales / equipos de mesa) funciona muy bien; otras técnicas han sido probadas con resultados mediocres. </li><li> Cuantificar ARN mediante espectroscopia UV como se describe para ADN anterior (sección 2.13). Nota: el coeficiente de extinción para el ARN es de 0,025 (g / ml) -1 cm -1. </li><li> Añadir a una estéril PCR tubo de 1 l de oligo (dT), 1 l de 10 mM dNTP mix, y 250 mg de ARN. Completar el volumen a 11 l con ddH estéril 2 O. </li><li> Incubar durante 5 min a 65 ° C. A continuación, añadir 4 l First Strand Buffer, 1 l 0,1 M ditiotreitol, 0,25 l de transcriptasa inversa y 1,75 l de ddH2O al tubo. Incubar a 50 ° C durante 1 hora seguido de 72 ° C durante 15 min. Opcionalmente, diluir cDNA producto 1: 5 usando ddH 2 O. </li><li> Por PCR cuantitativa cDNA uso 2 l, 2 l ddH 2 O, 5 l mezcla maestra qPCR, y 1l cada una de 10 uM de avance y retroceso poblaciones de cebadores para amplificar el gen (s) de elección. Mezclar en una placa de 96 pocillos y analizar usando una máquina de PCR cuantitativa (Figuras 1B y 1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

Los protocolos descritos aquí se utilizan para generar ADN de doble cadena para estimular la respuesta inmune innata citosólica con resultados reproducibles en una amplia gama de tipos de células e in vivo. Dado que el principal reactivo sustrato utilizado es un oligonucleótido sintético, hay flexibilidad en este sistema para el uso de secuencias de ADN alternativas o modificaciones químicas. Es posible, por ejemplo, para reemplazar el oligonucleótido cadena directa descrito en este protocolo con uno que contiene un marcador fluorescente o un resto de biotina para rastrear la localización o evaluar las interacciones con otras biomoléculas. Una de las principales ventajas de concatemerization ADN es la producción de largas hebras de ADN de doble cadena de manera que la secuencia puede ser controlada. Hay una limitación aquí, que es que la longitud del ADN no se puede controlar precisamente lo que el producto de esta reacción es siempre una mezcla de ADN de diferentes longitudes (similar a la poli análogo de ARN comercial (I: C)). Otra ventaja de esta técnica es que permite la producción de grandes cantidades masivas de ADN inmuno-estimuladoras (hasta cantidades mg). El paso concatemerization se puede escalar fácilmente según se requiera, aunque debe tenerse en cuenta que las etapas de purificación posteriores a continuación, deben llevarse a cabo en alícuotas de la escala se describe en el protocolo. En comparación con otros métodos de concatemerizing ADN, la adición principal es el uso de PEG8000 a la mezcla de ligadura para mejorar la eficiencia de ligación. Tenga en cuenta que PEG8000 puede ser difícil de disolver para hacer un 60% (w / v) stock pero puede ser vórtex y se calienta suavemente para ayudar a la solubilización. La ligación se puede dejar incubar durante períodos más largos que se indica, pero esto no parece afectar a la longitud del ADN que se genera. Algunas necesidades de atención también se observan al manipular fenol y cloroformo, ya que pueden ser cancerígenos y corrosivo. En nuestras manos los genes regulados por incremento por otros ADN sintéticos (tales como poli comercial (dA: DT)) son diferentes de los upregulated por ISD concatemerized. Sin embargo, otros no han encontrado tales diferencias de 10, lo que puede reflejar la variación entre los tipos de células que se analiza. A pesar de tales conflictos, la DSI concatemerized es significativamente más barato generar cuando se compara con la compra de poli (dA: dT) a partir de una fuente comercial y permite mayor flexibilidad a través de elección de la secuencia y modificaciones. Un aspecto de detección de ADN que es bajo-estudiado es la respuesta a la estimulación in vivo. Hemos demostrado que este protocolo se puede utilizar para generar ADN adecuado para experimentos in vivo 7. El producto dsDNA es puro y de alta concentración suficiente para permitir la inyección en ratones y posterior medición de procesos de señalización inmune innata. En el protocolo descrito aquí, se debe tener cuidado para asegurar el agua utilizada para disolver el sedimento de ADN final es la endotoxina, RNasa, DNasa y libre. La inyección de ADN o ADN libreLos complejos lipídicos resultados en una respuesta de interferón como se esperaba de los procesos de detección de ADN y, como tal, el ADN concatemerized se pueden utilizar para sondear múltiples aspectos de la detección de ADN in vivo.

El ADN es un componente vital de todos los organismos y las células eucariotas, que mantienen en compartimentos específicos. Una función del sistema inmune innato es identificar cuando tal compartimentación se rompe o cuando el material extraño se introduce en el organismo a través de un incumplimiento de las barreras físicas, externos. En el cuerpo humano hay una serie de proteínas que existen para ayudar a degradar pequeñas cantidades de ADN que puede escapar de la compartimentación correcta; DNAsa I, II, y III quiebro de ADN en el plasma, endosoma, y ​​el citosol, respectivamente. Sin embargo, se ha demostrado que los ratones que carecen de ADNasa II mueren a causa de la anemia grave causada por una producción excesiva de los interferones 1 que sugieren que el sistema inmune innato responde a ADN extra-nuclear. Esta respuesta se produce incluso en ratones que son completamente deficientes en la capacidad de señalización de los receptores Toll-like. Numerosos estudios han demostrado que la estimulación de genes de interferón (STING) 2 y vinculante TANK-quinasa 1 (TBK1) 3 están involucrados en la detección de ADN en el citoplasma y que esta vía de señalización activa el factor regulador de interferón (IRF) -3 4. La transcripción dependiente de IRF3 subsiguiente de citoquinas, quimioquinas, y los genes de interferón es característica de una respuesta inmune innata a ya sea un patógeno o peligro asociado patrón molecular (PAMP o DAMP) 5. El deseo de estudiar las vías de detección de ácidos nucleicos intracelulares ha llevado a la necesidad de desarrollar métodos robustos y reproducibles para estimular las células mediante la introducción de ADN o ARN en las células sin activar otras respuestas inmunes innatas. Un método por el cual la picadura / TBK1 / vía IRF3 pueden ser estimulados es mediante el uso de lípidos catiónicos reactivos de transfección para entregar ácido nucleico en el citoplasma, donde se puede acceder por los sensores de ADN tales como ADN-PK, IFI16, y cgas 6-8. Las características de ADN que se entienden actualmente para permitir effciente activación de la respuesta inmune innata citoplasmática sin estimulación de otras vías son de su longitud, la masa, la pureza, y la falta de motivos CpG 4,7,9. Los oligonucleótidos sintéticos son muy adecuados para el propósito de generar una respuesta inmune innata, ya que permiten la secuencia de ADN para ser optimizado y se preparó como una especie química pura. Un ADN (ISD) secuencia de inmuno-estimuladoras 45 pares de bases fue identificado por Stetson et al. 4 como una secuencia adecuada, CpG-libre para este propósito. Esta secuencia de ADN de doble cadena es de otra manera aleatoria y no tiene características específicas más allá de su falta de motivos CpG. Hemos encontrado que por concatemerizing el oligonucleótido ISD en hebras significativamente más largos aumenta la magnitud de la estimulación 7. Generación de ISD concatemerized tanto, es útil para estimular una respuesta inmune innata citoplasmática. Aquí presentamos los protocolos para la preparación de este reactivo y cómo se puede utilizar para activar la vía de detección de ADN envitro, así como in vivo. NOTA: Todos los estudios con animales se realizan bajo protocolos institucionales aprobados y las directrices de cuidado de animales.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Con el fin de estimular eficazmente una respuesta inmune innata, el ADN debe ser de longitud suficiente y pureza. Se presenta un método donde el ADN de doble cadena (dsDNA), que tiene las características necesarias para estimular el ADN citoplásmico vías sensoriales pueden generarse de forma barata y con facilidad. Por el concatemerization de oligonucleótidos cortos, sintéticos (que carecen de motivos CpG), dsDNA se puede generar a ser de longitud suficiente para activar el citosólica vía de detección de ADN. Este protocolo implica ligación de extremos romos de los oligonucleótidos en presencia de polietilenglicol (PEG), que proporciona un entorno eficaz para la ligadura que se produzca. Los concatemers dsDNA se pueden utilizar, después de la purificación por extracción con fenol / cloroformo, para simular la respuesta inmune innata in vitro por los protocolos de transfección estándar. Este ADN se puede utilizar también para estimular la inmunidad innata en vivo por inyección intradérmica en el pabellón de la oreja de un ratón, por ejemplo. Porestandarizar el proceso de concatemerization y los protocolos de estimulación posteriores, una activación fiable y reproducible del sistema inmune innato puede ser producido.

<html> Los resultados a continuación indican que el ADN concatemerized se puede generar con relativa facilidad y es capaz de estimular una respuesta inmune innata robusta en las células y en ratones. Con el uso de PEG8000, se puede ver claramente que la longitud del ADN que se genera es significativamente más larga e igualmente capaz de inducir la transcripción de CXCL10. Como se observa mediante análisis en gel de agarosa, la concatemerization estándar tiene longitudes de ADN de hasta 800 pares de bases (pb), mientras que para la muestra con PEG8000, la longitud del ADN incluye hebras en exceso de 10.000 pb (Figura 1A). La transfección de estos ADN en fibroblastos murinos embrionarios (MEFs) o ratones induce una transcripción robusta de citocinas y quimiocinas que puede ser medido por qPCR indicando la estimulación del ADN inmune innata maquinaria de detección (Figuras 1B y 1C). ad / 51593 / 51593fig1highres.jpg &quot;/&gt; Figura 1. Los datos representativos que indican la producción de ADN ISD concatemerized (conDNA) y la estimulación de los fibroblastos y ratones. (A) una muestra de ADN concatemerized producidos ya sea con o sin PEG8000 se analizaron por electroforesis en gel de agarosa. (B) MEFs fueron estimuladas con diferentes ADNs a 10 mg / ml y los niveles de CXCL10 y la IL-6 mRNAs medidos por qPCR 6 horas más tarde. (C) los ratones fueron inyectados en el pabellón auricular con conDNA y los niveles de CXCL10 y la IL-6 mRNAs medido por qPCR 12 horas más tarde. Los datos se muestran como pliegue aumento relativo al nivel de HPRT (RQ) y las barras de error son +/- SEM (n = 3).

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

El objetivo del protocolo es utilizar métodos óptimos para estimular las vías de detección de ADN citoplasmáticos en células e in vivo. Esto se logra mediante la mejora de la generación de ADN de largo, de doble cadena durante la ligadura de extremos romos. Las células o ratones se transfectaron a continuación usando un reactivo de transfección de lípidos.

La estimulación de citoplasmáticos de ADN Sensing Pathways<em&gt; In Vitro</em&gt; Y<em&gt; En Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Nanyang Technological University

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K vistas.  University of Cambridge.  El objetivo del protocolo es utilizar métodos óptimos para estimular las vías de detección de ADN citoplasmáticos en células e in vivo. Esto se logra mediante la mejora de la generación de ADN de largo, de doble cadena durante la ligadura de extremos romos. Las células o ratones se transfectaron a continuación usando un reactivo de transfección de lípidos. 

Video: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in vivo de imágenes de bioluminiscencia gen reportero de células estaminales embrionarias humanas

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Investigación

Biología

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo e in vitro de adaptador de clatrina-Interacción

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

Visualización de MG53 mediada por reparación de la membrana celular mediante In vivo Y In vitro Sistemas de

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

La activación de la apoptosis mediante microinyección citoplasmática del citocromo C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

El aislamiento de los ribosomas polipéptidos nacientes Bound<em&gt; In vitro</em&gt; Para la identificación de sitios de traslación pausa a lo largo del ARNm

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

La proteína c-Fos detección inmunohistoquímico: una herramienta útil como marcador de vías centrales implicados en las respuestas fisiológicas específicas<em&gt; En Vivo</em&gt; y<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

El aislamiento de filtración de ácidos nucleicos: A Extracción de ADN método sencillo y rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

Medición de la Absorción de Glucosa y Respuesta a la Estimulación de la Insulina en<em&gt; In Vitro</em&gt; Myotubes primario humano cultivado

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.

In Vitro e In Vivo métodos para determinar la permeabilidad de la célula epitelial Intestinal

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

Modified Methods for Loading of High-Throughput DNA Extraction Plates Reduce Potential for Contamination

High-throughput DNA sequencing techniques have contributed substantially to advances in our understanding of relationships among microbial communities, host characteristics, and broader ecosystem functions. With this rapid increase in breadth and depth of sequencing capabilities have come methods to extract, amplify, analyze, and interpret environmental DNA successfully with maximum efficiency. Unfortunately, performing DNA extractions quickly can come at the cost of increasing the risk of contamination among samples. In particular, high-throughput extractions that are based on samples contained in a 96-well plate offer a relatively quick method, compared to single-tube extractions, but also increase opportunities for well-to-well cross-contamination. To minimize the risk of cross-contamination among samples, while retaining the benefits of high-throughput extraction techniques, we developed a new method for loading environmental samples into 96-well plates. We used pierceable PCR sealing films to cover each plate while loading samples and added samples first to PCR tubes before moving them into wells; together, these practices reduce the risk of sample drift and unintended double loading of wells. The method outlined in this paper provides researchers with an approach to maximize available high-throughput extraction techniques while reducing the risk of cross-contamination inherent to 96-well plates. We provide a detailed step by step outline of how to move from sample collection to DNA extraction while minimizing the risk of unwanted cross-contamination.

Current methods for loading 96-well plates for DNA extractions can be prone to contamination. We detail a new method for loading 96-well plates that reduces risk of cross-contamination among wells. Our method will help other researchers capitalize on the efficiency of high-throughput DNA extraction techniques and minimize risk of contamination.

Los métodos modificados para la carga de placas de extracción de ADN de alto rendimiento reducen el potencial de contaminación

High-throughput DNA sequencing techniques have contributed substantially to advances in our understanding of relationships among microbial communities, ...