Die Autoren danken Kristen Bullard-Feibelman, Milena Veselinovic und Claudia Rückert für ihre Unterstützung bei der Charakterisierung des vom Klon abgeleiteten Virus. Diese Arbeit wurde teilweise durch Zuschüsse des Nationalen Instituts für Allergie und Infektionskrankheiten, NIH unter den Stipendien AI114675 (BJG) und AI067380 (GDE) unterstützt.

1. Transformation und Wiederherstellung von infektiösen Klonplasmiden <ol><li> Transformieren Sie beide Plasmide (getrennt) unter Verwendung eines kommerziellen Transformationsprotokolls ( z. B. NEB 5 Minute Transformation Protocol) mit einigen Modifikationen. Beide Plasmide enthalten ein für die Ampicillinresistenz kodierendes Gen, daher verwenden sie Ampicillin oder Carbenicillin zur Selektion. Carbenicillin wird bevorzugt, da es stabiler ist. <ol><li> Entfernen Sie die Zellen (siehe Materialtabelle) von -80 ° C Gefrierschrank und tauen Sie auf Eis für 5-10 min. Prewarm Lysogeny Brühe (LB) (mit 10 g / l NaCl und 25 μg / ml Carbenicillin, genannt LB-Carb) Platten und die Brühe mit Catabolit Repression (SOC (ohne Antibiotika) - kommen mit den Zellen) bei 37 ° C. </li><li> Füge zwischen 100 pg-10 ng in 1 μl Plasmid-DNA zu einem Röhrchen hinzu, das 50 μl kompetente Zellen enthält; Mischen Sie vorsichtig, indem Sie die Tube schlagen. </li><li> Röhrchen auf Eis für 5 min inkubieren. </li><li> Hitzeschockrohre bei 42 ° C für 30 sIn einem wasserbad Rückkehr zum Eis für 2 min unmittelbar nach Hitzeschock. </li><li> 950 μl Raumtemperatur SOC in jedes Röhrchen pipettieren und durch Pipettieren mischen. 100 μl des Bakteriengemisches auf eine LB-Carb-Platte auftragen und über Nacht bei 37 ° C inkubieren (ca. 12-14 h). </li></ol></li><li> Entfernen von Platten aus 37 ° C Inkubator nach 12-14 h Inkubation. Legen Sie die Platten in eine dunkle Schublade bei Raumtemperatur, damit Kolonien weiter wachsen (ca. 8-9 h). </li><li> Unter Verwendung von 5 ml Terrific Brühe (TB, enthaltend 25 &amp; mgr; g / ml Carbenicillin, genannt TB-Carb), wachsen 5-10 kleine Kolonien für jedes Plasmid über Nacht bei 30 ° C in einem Bakterienschüttler (etwa 14-16 h). HINWEIS: Kleine Kolonien sind ein Indikator dafür, dass das Plasmid intakt ist; Kolonien mit Plasmiden, die Deletionen, Umlagerungen oder Mutationen enthalten (hierin Instabilitätsereignisse genannt), werden schneller wachsen und sind daher größer. Deshalb sollte man versuchen, die kleinsten Kolonien auf dem Teller zu holen, namentlichT Auswahl der größten Kolonien vorhanden. Einige mittelgroße Kolonien können auch für Vollständigkeit ausgewählt werden. Die niedrigere Temperatur reduziert die Wahrscheinlichkeit, dass die Zellen überwachsen (OD 600 von größer als 0,6-0,8). Da die meisten Forscher über Nacht Wachstum durchführen, ermöglicht es mehr Kontrolle und reduzierte Chance der Überwucherung. </li><li> Prüfen Sie flüssige Kulturen auf Trübungen (ca. OD 600 von 0,6-0,8). Legen Sie alle trüben Rohre auf 4 ° C und lassen Sie andere Röhrchen trüben, indem Sie länger wachsen. HINWEIS: Bakterien nicht auf OD 600- Werte wachsen, die größer als empfohlen sind, da Plasmid-Instabilitätsereignisse auftreten können. </li><li> Extrahieren Sie Plasmid-DNA aus Bakterien mit einem handelsüblichen Plasmid-Miniprep-Kit (siehe Materialtabelle). Eluieren in 15 &amp; mgr; l vorgewärmtem (bis 70 ° C in einem Heizblock) Elutionspuffer. Lassen Sie den Elutionspuffer 5 Minuten lang vor der Zentrifugation auf die Säule inkubieren. HINWEIS: Bewahren Sie mindestens 1 ml dieser Starterkultur bei 4 ° C fürWeiter im nächsten Schritt. </li><li> Digg 10 &amp; mgr; l der gewonnenen Plasmide, um zu beurteilen, ob Plasmid-Instabilitätsereignisse während der Kultur auftraten. HINWEIS: Digit p1 mit SalI / NheI und p2 mit BamHI / HindIII bei 37 ° C für 1 h. Bestätigen Sie die Anwesenheit der korrekten Banden nach der Verdauung (Abbildung 2a ) durch Gelelektrophorese und fahren Sie mit Schritt 2 fort. Wenn Sie Plasmid-DNA durch Walzkreisverstärkung (RCA) vorbereiten, reservieren Sie ein Teil des Miniprep-Eluats, um als Vorlage zu dienen. </li></ol> 2. Herstellung von ausreichend Plasmid-DNA zur Ligation HINWEIS: Die Ligation und die anschließende Elektroporation erfordert eine ausreichende Menge an Plasmid-DNA, die entweder über Maxiprep oder RCA erzeugt werden muss. Während maxiprep der traditionell verwendete Ansatz ist, bietet RCA den Vorteil, dass keine Bakterien erforderlich sind, wodurch das Potential für die Plasmid-induzierte Toxizität in Bakterien, die zu Instabilitätsereignissen führen können, entfernt wird. <ol><li><stRong&gt; Führen Sie das folgende maxiprep-Verfahren durch. <ol><li> Für jedes Plasmid, das im vorigen Abschnitt das korrekte Restriktionsenzym-Verdauungsmuster nachgewiesen hat, fügen Sie 500 &amp; mgr; l Starterkultur zu 1 l TB-Carb (25 &amp; mgr; g / ml Carbenicillin) -brühe hinzu und schütteln über Nacht bei 30 ° C (ungefähr 14-16 h , Etwa OD 600 von 0,6-0,8). HINWEIS: Lassen Sie die Kultur nicht über diesen OD 600- Wert wachsen. Dies führt möglicherweise zu Instabilitätsereignissen innerhalb der Plasmide. </li><li> Ernten Sie die Bakterien und führen Sie maxipreps pro Hersteller-Protokoll (siehe Material-Tabelle). </li></ol></li><li> Verwenden Sie die gespeicherten Miniprep ab Schritt 1.6, führen Sie die folgenden für die RCA-Prozedur durch. <ol><li> Übertragen Sie 1 &amp; mgr; l Plasmid-DNA in ein Röhrchen, das 50 &amp; mgr; l Probenpuffer enthält. </li><li> Die Probe bei 95 ° C für 3 min erhitzen und dann bei 4 ° C inkubieren, bis sie gebrauchsfertig sind. </li><li> Bereitet die kommerzielle Verstärkung vorVormischung (siehe Werkstofftabelle ). Kombinieren Sie 50 μl Reaktionspuffer mit 2 μl Enzymmischung in einem auf Eis eingesetzten Röhrchen. HINWEIS: Die Amplifikationsvormischung sollte bis zum Gebrauch auf Eis gehalten werden. Es ist zweckmäßig, eine Mastermischung durch Kombination von ausreichenden Reagenzien für die erforderliche Anzahl von Amplifikationsreaktionen herzustellen. Eine nicht genutzte Vormischung muss verworfen werden. </li><li> Übertragen Sie 50 &amp; mgr; l der vorbereiteten Amplifikationsvormischung auf die denaturierte Probe. </li><li> Inkubieren Sie die Reaktionsröhrchen bei 30 ° C für 18 h. </li><li> Inkubieren Sie die Röhrchen bei 65 ° C für 10 min, um die ø29-DNA-Polymerase zu inaktivieren. </li><li> Die Reaktionsrohre bei 4 ° C oder -20 ° C bis zum Gebrauch aufbewahren. HINWEIS: Zu diesem Zeitpunkt sollte die Plasmid-DNA, die über beide Methoden hergestellt wurde, quantifiziert werden (unter Verwendung von Absorption bei 260 nm), und das ZIKV-Genom sollte Sanger sequenziert werden, um zu bestätigen, dass keine Instabilitätsereignisse (Deletionen und Umlagerungen) während der Präparation auftraten. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primer Name </td><td> Sequenz (5 &#39;- 3&#39;) </td></tr><tr><td> ZIKV PRVABC59 1Für. </td><td> AGTTGTTGATCTGTGTGAATCAGAC </td></tr><tr><td> ZIKV konserviert 632Für. </td><td> GCCCTATGCTGGATGAGG </td></tr><tr><td> ZIKV konserviert 692Rev. </td><td> GGTTCCGTACACAACCCAAGTTG </td></tr><tr><td> ZIKV konserviert 1313Rev. </td><td> CTCCCTTTGCCAAAAAGTCCACA </td></tr><tr><td> ZIKV konserviert 1201Für. </td><td> CCAACACAAGGTGAAGCCTAC </td></tr><tr><td> ZIKV konserviert 1663Für. </td><td> GCAGACACCGGAACTCCACACT </td></tr><tr><td> ZIKV konserviert 2008Für. </td><td> CAGATGGCGGTGGACATGC </td></tr><tr><td> ZIKV konserviert 2350Rev. </td><td> GTGAGAACCAGGACATTCCTCC </td></tr><tr><td> ZIKV konserviert 2605Für. </td><td> TACAAGTACCATCCTGACTCCC </td></tr><tr><td> ZIKV konserviert 3499Rev. </td><td>GCCTTATCTCCATTCCATACCA </td></tr><tr><td> ZIKV Konserviert 3961Rev. </td><td> TTGCCAACCAGGCCAAAG </td></tr><tr><td> ZIKV konserviert 4132Für. </td><td> CATTTGTCATGGCCCTGG </td></tr><tr><td> ZIKV konserviert 4561Rev. </td><td> CTATTGGGTTCATGCCACAGAT </td></tr><tr><td> ZIKV konserviert 4665Für. </td><td> GACCACAGATGGAGTGTACAGAGT </td></tr><tr><td> ZIKV konserviert 5189Rev. </td><td> AAGACAGTTAGCTGCTTCTTCTTCAG </td></tr><tr><td> ZIKV konserviert 5219Für. </td><td> GAGAGTTCTTCCTGAAATAGTCCGTGA </td></tr><tr><td> ZIKV konserviert 6086Rev. </td><td> CTTGCTTCAAGCCAGTGTGC </td></tr><tr><td> ZIKV konserviert 6119Für. </td><td> GCCTCATAGCCTCGCTCTATCG </td></tr><tr><td> ZIKV konserviert 6721Rev. </td><td> CCATTCCAAAGCCCATCTTCCC </td></tr><tr><td> ZIKV konserviert 6769Für. </td><td> CCAGCCAGAATTGCATGTGTCC </td></tr><tr><td> ZIKV Konserviert 7209Rev. </td><td> ATCATTAGCAGCGGGACTCCAA </td></tr><tr><td> ZIKV Konserviert 7343Für. </td><td> GTTGTGGATGGAATAGTGGT </td></tr><tr><td> ZIKV Konserviert 8243Für. </td><td> TGCCCATACACCAGCACTATGA </td></tr><tr><td> ZIKV PRVABC59 8893Rev. </td><td> TGCATTGCTACGAACCTTGTTG </td></tr><tr><td> ZIKV konserviert 9133Für. </td><td> AGCCCTTGGATTCTTGAACGAGGA </td></tr><tr><td> ZIKV PRVABC59 9673Rev. </td><td> AACGCAATCATCTCCACTGACT </td></tr><tr><td> ZIKV konserviert 9686Für. </td><td> GATGATAGGTTTGCACATGCC </td></tr><tr><td> ZIKV Konserviert 10321Rev. </td><td> GTCCATGTACTTTTCTTCATCACCTAT </td></tr><tr><td> ZIKV konserviert 10455Für. </td><td> CAGGAGAAGCTGGGAAACC </td></tr><tr><td> ZIKV konserviert 10621Rev. </td><td> CAGATTGAAGGGTGGGGAAGGTC </td></tr></tbody></table> Tabelle 1: Primer zur Sequenzierung von cDNA-Klonen. Plasmide können vollständig mit den aufgeführten Primern sequenziert werden. Primer markiert als &quot;konserviert&quot; indiDass sie wahrscheinlich alle Genotypen von ZIKV sequenzieren / verstärken können. Primer, die als &quot;PRVABC59&quot; markiert sind, sind spezifisch für diesen Stamm, können aber auch für andere asiatische Genotypstämme und möglicherweise auch andere Genotypen funktionieren. 3. Herstellung von in vitro transkribierter RNA <ol><li> Richten Sie die Verdauungsreaktion von entweder maxiprep oder RCA vorbereitete DNA ein. <ol><li> Zur p1-Verdauung werden 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl BamHI-HF, 3 μl rSAP oder CIP und 3,3 μg p1 DNA vermischt. Füge ddH 2 O zu 100 μl hinzu. </li><li> Zur p2-Verdauung 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl EcoRI-HF und 13,3 μg p2 DNA mischen. Füge ddH 2 O zu 100 μl hinzu. </li><li> Inkubieren bei 37 ° C für 1-2 h. </li><li> Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 30 &amp; mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt ist (inkubieren derSpalte für 5 min vor dem Spinnen). HINWEIS: Halten Sie 1 μL auf einem Gel später. </li></ol></li><li> Ligationsreaktion vorbereiten. <ol><li> Kombinieren Sie 10 μl 10x T4-DNA-Ligationsreaktionspuffer, 3 μl T4-DNA-Ligase (400 U / μL), 29 μl gereinigtes p1 und 29 μl gereinigtes p2. Füge ddH 2 O zu 100 μl hinzu. </li><li> Inkubieren bei Raumtemperatur für 2 h oder 16 ° C über Nacht. </li><li> Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 10 &amp; mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt wurde (5 Minuten vor dem Spinnen inkubieren). HINWEIS: Halten Sie 1 μL auf einem Gel später. </li></ol></li><li> Führen Sie unverdaute Plasmide, verdaute Plasmide und Ligation auf einem Agarosegel. Das Ligationsprodukt sollte eine höhere Molekulargewichtsbande (etwa 11 kb) als nur verdautes Plasmid allein aufweisen, was anzeigt, dass die Ligation erfolgreich war ( 2b ).</li><li> Richten Sie T7 in vitro Transkriptionsreaktion ein. <ol><li> Kombinieren Sie 10 &amp; mgr; l 2 × ARCA / NTP-Mischung, 2 &amp; mgr; l T7-RNA-Polymerase-Mischung und 8 &amp; mgr; l gereinigte Ligationsreaktion für ein Endvolumen von 20 &amp; mgr; l. HINWEIS: Die im Mix enthaltene ARCA ist ein Cap-Analog, das exklusiv in die richtige Orientierung integriert ist. Standard-Cap-Analoga können nur ~ 50% der Transkripte mit einer Kappe in der richtigen Orientierung führen. </li><li> 5 h bei 37 ° C inkubieren. </li><li> Messung der RNA-Konzentration über ein UV-Spektrophotometer. Gegebenenfalls ein denaturierendes Agarosegel ausführen, um die Länge des RNA-Transkripts zu bestätigen. </li></ol></li></ol> 4. Rettung des Infektionsvirus durch Elektroporation <ol><li> Tage vor der Elektroporation, 1 T182-Kolben von Vero-Zellen herstellen (zwischen T150 und T182 ist akzeptabel, in DMEM + 10% fötalem Rinderserum (FBS) gezüchtet) pro zu ersetzendes Konstrukt. Füge 1 T182 als Mock-Transfektionskontrolle ein. CeSollte bei 70-80% Konfluenz verwendet werden. </li><li> Wenn die Zellen fertig sind, legen Sie 12 ml / Reaktion von DMEM + 15% FBS + 10 mM HEPES in ein auf 37 ° C erwärmtes Wasserbad. </li><li> Lösen Sie Zellen durch Trypsinisierung mit einem Standardprotokoll und gewinnen Sie Zellen in Medien mit 10% FBS, um Trypsin zu inaktivieren; Zentrifugen von Zellen bei 150 xg für 5 min bei 4 ° C. </li><li> Waschen von Zellen in 1x phosphatgepufferter Kochsalzlösung (PBS), Pelletieren von Zellen bei 150 xg für 5 min bei 4 ° C. Wiederholen Sie diesen Schritt zweimal für insgesamt drei Wäschen. </li><li> Resuspendieren von Zellen in 200 &amp; mgr; l RPMI 1640 + 10 mM HEPES (steril) pro Anzahl der Proben. 200 μl Zellsuspension in ein steriles Röhrchen überführen. Zellen sollten ~ 0,5 x 10 7 Zellen / ml sein. </li><li> Füge 20 μl Wasser (Mock Neg. Kontrolle) oder 20 μl RNA (vorzugsweise 5-10 μg) in Schritt 3.4 zu jedem Satz von Zellen zu. Mischen Sie vorsichtig, indem Sie das Röhrchen schlagen und den Inhalt des Röhrchens in eine 2 mm Spalt-Elektroporationsküvette übertragen. </li><li> Elektrisch einstellenOporator auf 170 V LV, Omega (Widerstand) bei 0 und 950 μF (ca. 625 V / cm und 20 ms Zeitkonstante für andere Maschinen). Stellen Sie den Widerstand auf die niedrigste verfügbare Einstellung ein, entweder 0 oder ∞ falls vorhanden. </li><li> Pulse einmal und fügt sofort 600 μl DMEM +15% FBS +10 mM HEPES hinzu, das in Schritt 4.2 erwärmt wurde. Innerhalb der Küvette gründlich ausspülen, um alle Zellen zu entfernen. Füge Zellen zu einem T75-Gewebekulturkolben hinzu, der 10 ml vorgewärmtes Medium enthält. Entfernen Sie zusätzliche Medien aus der Küvette, indem Sie die mit der Küvette enthaltene Tropfmaschine verwenden. Sei vorsichtig, um die Sterilität aufrechtzuerhalten. </li><li> Wirbelkolben zum Mischen von Medien und Zellen und Platzieren in 37 ° C Inkubator. </li><li> Überprüfen Sie den nächsten Tag auf die Lebensfähigkeit der Zellen und tun Sie es jeden Tag bis 50-75% Zelltod beobachtet wird. Der Zelltod wird durch Vergleich mit der mockelektroporierten Kontrolle beobachtet. HINWEIS: Der ZIKV-Zytopathie-Effekt (CPE) ist in Vero-Zellen sehr ausgeprägt, was zu aufgerundeten Zellen führt, die sich im Kulturmedium ablösen und schwimmen. Wir habenBeobachtete eine Reichweite von 8-10 Tagen als ideal für die Ernte. </li><li> Ernteüberstand in einem konischen Rohr und zentrifugieren, um Zellschutt bei&gt; 3.000 xg für 10 min bei 4 ° C zu entfernen. </li><li> Den geklärten Überstand auf ein neues Röhrchen auftragen und mit einer Endkonzentration von 20% FBS (ab 100% Lager) ergänzen. Zusätzlich fügen Sie sterile HEPES in einer Endkonzentration von 10 mM als Puffermittel hinzu, um die Virusinfektiosität zu bewahren, während sie gefroren sind (aus einem 1 M sterilen Bestand). </li><li> Mischen Sie das Virus durch Vortexen und Aliquot in Schraubverschluss-Durchstechflaschen. Bei -80 ° C für zukünftige Verwendung lagern. </li></ol> 5. Titration des wiederhergestellten Virus <ol><li> Saat die passende Anzahl von 6- oder 12-Well-Platten von Vero-Zellen am Tag vor der Titration. </li><li> Virus aus dem Gefrierschrank entfernen und serielle 10-fache Verdünnungen in DMEM + 2% FBS in Röhrchen oder 96-Well-Platten herstellen. HINWEIS: Der erwartete Titer aus wiederhergestellten Klonen liegt zwischen 1 x 10 6 und 5 x 10 7 PFU / mL. </li><li> Hinzufügen 200 oR 400 &amp; mgr; l jeder Verdünnung in Duplikat zu einer Vertiefung einer 12- bzw. 6-Well-Platte. </li><li> Legen Sie Platten in 37 ° C Inkubator und Felsen alle 15 min, für insgesamt 1-1,5 h Adsorption Zeitraum. </li><li> Entfernen Sie das Virus-Inokulum und fügen Sie 1 ml (12-Well) oder 2 ml (6-Well) DMEM-Tragacanth-Overlay zu jeder Vertiefung hinzu. HINWEIS: Hierbei können Agarose, Agar, Methylcellulose oder andere Überlagerungsmedien verwendet werden. </li><li> Inkubieren von Zellen in 37 ° C Inkubator für 5 Tage. Die Zeit für die richtige Plaque-Bildung hängt von der verwendeten Überlagerung ab. </li><li> Um die Zellen zu fixieren, entfernen Sie die Platten aus dem Inkubator und dekantieren Sie die Überlagerung sanft in das Desinfektionsmittel. </li><li> Füge ausreichend 20% Ethanol / 0,1% Kristallviolett (CV) zu jeder Vertiefung hinzu, um zu bedecken und zu mischen zu mischen. HINWEIS: Viele andere Fixiermittel existieren und können hier verwendet werden. Zusätzlich kann bei Verwendung eines Agarose- oder Agar-Overlays eine zweite Overlay in Verbindung mit neutralem Rot verwendet werden, um Plaques ohne Fixierung zu visualisieren. 20% Ethanol hat sich gezeigtWirksam bei der Inaktivierung von umhüllten Viren in früheren Studien; Verwenden Sie diesen Betrag nicht für nicht umhüllte Viren, da sie nicht inaktiviert werden. 19 . </li><li> Inkubieren von Platten für 30-60 min bei Raumtemperatur (in einem Klasse II Biosicherheitsschrank); CV (nach örtlichen Vorschriften) verwerfen und Platten mit Leitungswasser waschen. </li><li> Lassen Sie die Platten trocknen und legen Sie Plaques manuell ein. HINWEIS: Referenz 20 kann als zusätzliche Referenz für die Durchführung von Plaque-Assays verwendet werden. </li></ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

Die Autoren haben nichts zu offenbaren.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse mode...

Zika-Virus (ZIKV, Familie Flaviviridae : Gattung Flavivirus ) ist ein Moskito-getragenes Flavivirus, das in Brasilien in den Jahren 2013-14 angekommen ist und anschließend mit einem massiven Ausbruch der fiebrigen Krankheit verbunden war, die sich in ganz Amerika verbreitete 1 . Darüber hinaus wurde ZIKV mit schwerwiegenden Erkrankungen wie dem Guillain-Barré-Syndrom bei Erwachsenen und Mikrozephalie bei Föten und Neugeborenen verknüpft 2 . Wenig war über ZIKV vor seiner schnellen Verbreitung in der westlichen Hemisphäre bekannt. Dazu gehört ein Mangel an molekularen Werkzeugen, was die mechanistische Forschung behindert. Molekulare Werkzeuge für Viren, wie infektiöse cDNA-Klone, erleichtern die Impfung und die antivirale therapeutische Entwicklung und ermöglichen die Bewertung von viralen genetischen Faktoren, die mit der differentiellen viralen Pathogenese, der Immunantwort und der viralen Evolution zusammenhängen. Flavivirus-infektiöse Klone sind bekannt, dass sie in Bakterien aufgrund von cr stark instabil sindYptische prokaryotische Promotoren, die in ihren Genomen vorhanden sind 3 . Es wurden mehrere Ansätze verwendet, um dieses Problem zu lindern; Einschließlich der Insertion von Tandemwiederholungen stromaufwärts von viralen Sequenzen 4 , Mutation von mutmaßlichen prokaryotischen Promotorsequenzen 5 , Aufteilen des Genoms in mehrere Plasmide 6 , Vektoren mit niedriger Kopienzahl (einschließlich bakterieller künstlicher Chromosomen) 7 , 8 und Insertion von Introns im viralen Genom 9 . Ein einseitiges System ohne Modifikationen wurde für ZIKV beschrieben; Dieser Klon schien jedoch in der Zellkultur und bei den Mäusen 10 zu dämpfen. Andere Gruppen haben Introns in das ZIKV-Genom konstruiert, was eine Störung von instabilen Sequenzen in Bakterien ermöglicht, die in Säugetierzellen in vitro zur Herstellung von infektiösem Virus 11 gespleißt werden können, 12 Zusätzlich wurde ein PCR-basiertes System mit dem Titel Infectious-Subgenomic-Amplicons erfolgreich eingesetzt, um den Prototyp MR766-Stamm von ZIKV 13 zu retten. Der hier beschriebene Ansatz erfordert keine Fremdsequenzen, sondern stört das Genom im Bereich hoher Instabilität durch die Verwendung mehrerer Plasmide, die bisher erfolgreich mit Gelbfieber 6 , Dengue 14 , 15 und West-Nil-Viren 16 verwendet wurden. Darüber hinaus erleichtert die Zugabe der Hepatitis-D-Ribozym-Sequenz an den viralen genomischen Termini die Schaffung eines authentischen 3&#39;-Endes ohne die Notwendigkeit der Addition einer Linearisierungsstelle. Zusätzlich werden beide Plasmide in einem Vektor mit niedriger Kopienzahl (pACYC177, ~ 15 Kopien pro Zelle) konstruiert, um jegliche Resttoxizität 17 zu mildern. Das gewonnene Virus zeigt ein vergleichbares Wachstumsprofil anElterliches Virus in in vitro Wachstumskurven in 8 Zelllinien, die eine Vielzahl von Zelltypen umfassen, die von Säugetieren und Insekten abgeleitet sind, und hat identische pathogene Profile bei Mäusen und Infektions-, Verbreitungs- und Übertragungsraten in den Mücken 18 gezeigt . Hierin beschreiben wir ein Protokoll, in dem beschrieben wird, wie man die infektiösen Klonplasmide wächst, in vitro eine Volllängen-Virus-RNA (das virale Genom) erzeugt und in der Zellkultur ein infektiöses Virus wiederherstellt. Zuerst beschreiben wir die Ausbreitung von Plasmiden in Bakterien oder bakterienfreien Verstärkung mittels Rollkreisverstärkung (RCA). Als nächstes zeigen wir, wie die beiden Plasmide verdaut werden und dann anschließend miteinander ligiert werden, um ein Volllängenvirus zu erzeugen. Schließlich beschreiben wir die Produktion von transkribierter RNA und deren anschließende Elektroporation in Vero-Zellen, gefolgt von Titration des gewonnenen Virus (Abbildung 1 ). Der beschriebene Ansatz ist schnell, so dass foR Erholung von infektiösen Virusbeständen in 1-2 Wochen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Infektiöse cDNA-Klone erlauben die genetische Manipulation eines Virus und erleichtern so die Arbeit an Impfstoffen, Pathogenese, Replikation, Übertragung und Virusentwicklung. Hier beschreiben wir den Aufbau eines infektiösen Klons für Zika Virus (ZIKV), der derzeit einen explosiven Ausbruch in Nord- und Südamerika verursacht. Um Toxizität gegenüber Bakterien zu verhindern, die häufig mit Flavivirus-abgeleiteten Plasmiden beobachtet wird, erzeugten wir ein Zwei-Plasmid-System, das das Genom am NS1-Gen trennt und stabiler ist als Volllängen-Konstrukte, die ohne Mutationen nicht erfolgreich gewonnen werden konnten. Nach der Verdauung und Ligation, um die beiden Fragmente zu verbinden, kann eine Volllängen-Virus-RNA durch in vitro- Transkription mit T7-RNA-Polymerase erzeugt werden. Nach der Elektroporation von transkribierter RNA in Zellen wurde das Virus gewonnen, das ähnliche In-vitro- Wachstumskinetiken und In-vivo- Virulenz- und Infektions-Phänotypen in Mäusen und Mücken zeigte.

Das hier beschriebene Protokoll ermöglicht die Wiederherstellung von infektiösem Klon-abgeleiteten Zika-Virus. Das Manipulieren des Zwei-Plasmid-Infektios-Klonsystems ist einfach, wenn es mit Sorgfalt durchgeführt wird, im Vergleich zu Volllängen-Versionen, die sehr instabil sind (Daten nicht gezeigt). Nach der Verdauung und Ligation der beiden verschiedenen Stücke wird eine Capped-RNA unter Verwendung einer in vitro- Transkription mit T7-Polymerase hergestellt, die dann in...

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Dieses Protokoll beschreibt die Wiederherstellung des infektiösen Zika-Virus aus einem zwei-Plasmid-infektiösen cDNA-Klon.

Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Research

JoVE Journal

Immunology and Infection

9.6K Aufrufe.  Colorado State University.  Dieses Protokoll beschreibt die Wiederherstellung des infektiösen Zika-Virus aus einem zwei-Plasmid-infektiösen cDNA-Klon. 

Serie: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Erzeugung von rekombinanten Influenza Virus von Plasmid-DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Forschung

Immunologie und Infektion

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

Nachweis von infektiösen Viren aus Field-gesammelt Moskitos von Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

Visualizing Dengue Virus durch Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

Propagierung und Erkennen einer ansteckenden Molecular Clone von Maedi-Visna Virus, das Green Fluorescent Protein exprimiert

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Rettung von rekombinanten Newcastle Disease Virus aus cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophilen-Isolierung und Analyse zur Bestimmung ihrer Rolle in der Lymphom-Zellempfindlichkeit therapeutische Mittel

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus Infectious Zellkultursystem und die<em&gt; In Vitro</em&gt; Prophylaktische Wirkung von Interferonen

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

Zika-Virus spezifische diagnostische Epitop Entdeckung

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Schnelle, sichere und einfache manuelle am Krankenbett Nukleinsäure-Extraktion für den Nachweis des Virus in Vollblut-Proben

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Quantifizierung der Antikörper-abhängige Verstärkung der Zika-Virus in primären humanen Zellen

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...