We thank Erin Zoller, Jessica Bene, and Lindsey Hays for input and direction in protocol development. MTW was supported in part by NIH R21 HG008186 and a Trustee Award grant from the Cincinnati Children's Hospital Research Foundation. ZHP was supported in part by T32 GM063483-13.

1. Herstellung von Lösungen und Reagenzien <ol><li> Bestellen Sie kundenspezifische DNA-Oligonukleotid-Sonden zur Verwendung in EMSA und DAPA. <ol><li> Zur Reduzierung der unspezifischen Proteinbindung, entwerfen kurze Oligos (zwischen 35-45 Basenpaare (bp) in der Länge) 30, und legen Sie die Variante von Interesse direkt in der Mitte , flankiert von seinen 17 bp endogene genomische Sequenz. Für EMSA Oligos, eine 5&#39;-Fluorophor hinzuzufügen. Für DAPA Oligos, eine 5&#39;-Biotin-Tag hinzufügen. </li><li> Um sowohl die Sense-Strang und seine Umkehrkomplement Strang. Alternativ bestellen Duplex (vorgeglüht) Oligos. Wenn die Oligos zu benennen, stellen Sie die Nomenklatur, die auf einem festgelegten Referenzgenom. Hinweis: &quot;Risiko&quot; und &quot;Nicht-Risiko&quot; -Bezeichnung können Krankheit und projektspezifische, während &quot;Referenz&quot; und &quot;non-reference&quot; sind universell relevant sein. </li><li> Bei der Ankunft der Oligos, drehen kurz den Inhalt nach unten und resuspendieren in Nuklease-freies Wasser bis zu einer endgültigen Konzentration von 100 μ; M. Shop suspendiert Lager bei -20 ° C. Schützen Oligos mit einem Fluorophor aus Licht markiert, indem sie mit Alufolie wickeln. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Name </td><td> Sequenz </td></tr><tr><td> rs76562819_REF_FOR </td><td> GTAATGCCTTAATGAGAGAG A GTTAGTCATCTTCTCACTTC </td></tr><tr><td> rs76562819_REF_REV </td><td> GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC </td></tr><tr><td> rs76562819_NONREF_FOR </td><td> GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC </td></tr><tr><td> rs76562819_NONREF_REV </td><td> GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC </td></tr></tbody></table> Tabelle 1: Beispiel EMSA / DAPA Oligonukleotid - Entwurf , der eine SNP für Differential bin zu testending. &quot;REF&quot; steht für die Referenz - Allels, während &quot;NONREF&quot; für die Nicht-Referenz - Allels steht. &quot;FOR&quot; steht für den vorderen Strang, während &quot;REV&quot; sein Komplement an. Die SNP wird in rot gesehen. <ol start="2"><li> Vorbereitung zytoplasmatischen Extraktion (CE) Puffer mit einer Endkonzentration von 10 mM HEPES (pH 7,9), 10 mM KCl und 0,1 mM EDTA in deionisiertem Wasser. </li><li> Vorbereitung Kernextraktion (NE) Puffer mit einer Endkonzentration von 20 mM HEPES (pH 7,9), 0,4 M NaCl und 1 mM EDTA in deionisiertem Wasser. </li><li> Vorbereitung Anelierungspuffer mit einer Endkonzentration von 10 mM Tris (pH 7,5-8,0), 50 mM NaCl und 1 mM EDTA in deionisiertem Wasser. </li></ol> 2. Herstellung von Kern Lysate aus kultivierten Zellen Hinweis: Dieses experimentelle Protokoll wurde optimiert B-lymphoblastoiden Zelllinien, hat aber in mehreren anderen unabhängigen adhärenten / Suspensions-Zelllinien und arbeitet universell getestet. <ol><li> Culture B-lymphoblastoiden Zellen in Roswell Park Memorial Institute (RPMI) 1640 mit 2 mM L-Glutamin, 10% fötalem Rinderserum und 1x Antibiotikum-Antimykotikum, enthaltend 100 Einheiten / ml Penicillin, 100 ug / ml Streptomycin und 250 ng / ml Amphotericin B. <ol><li> Seed in einem Bereich von 200.000-500.000 lebenden Zellen / ml und Inkubation Kolben bei 37 ° C mit 5% Kohlendioxid in einer aufrechten Position mit belüfteten oder lose Kappen. Hinweis: Das Wachstum der B-lymphoblastoiden Zellen verlangsamt, wenn sie über 1.000.000 Zellen / ml erreichen. Break up-Zell-Blasten durch Auf- und Abpipettieren mehrmals und das Rück Zellen zu 200.000-500.000 Zellen / ml eine schnelle Wachstumsrate aufrecht zu erhalten. </li></ol></li><li> Zweimal waschen kultivierten Zellen mit 10 ml eiskaltem Phosphat-gepufferte Salzlösung (PBS), Spin-down bei 4 ° C, 300 g für 5 min und entfernen PBS durch Absaugen. </li><li> Zählen von Zellen mit einem Hämozytometer und Pellet als 1 ml eiskaltem PBS pro 10 7 Zellen. Hinweis: Wenn beispielsweise Lysieren von 2 x 10 7 &lt;/ Sup&gt; Zellen, Resuspendieren in 2 ml PBS. </li><li> Aliquot 1 ml bis 1,5 ml Mikrozentrifugenröhrchen so daß jedes Rohr 10 7 Zellen in PBS enthält. Zentrifuge bei 3.300 × g für 2 min 4 ° C und absaugen PBS. </li><li> Vor der Verwendung hinzufügen 1 mM Dithiothreitol (DTT), 1x Phosphatase-Inhibitor und 1x Protease-Inhibitor zu einem Arbeits Lager von CE-Puffer. Resuspendieren Zellpellet mit 400 ul CE-Puffer und Inkubation für 15 Minuten auf Eis. </li><li> In 25 ul 10% Nonidet P-40 und mischen durch Pipettieren. Zentrifuge bei 4 ° C, max Geschwindigkeit für 3 min. Dekantieren und den Überstand verwerfen. </li><li> Vor der Verwendung hinzufügen 1 mM DTT, 1x Phosphatase-Inhibitor und 1x Protease-Inhibitor zu einem Arbeits Lager von NE-Puffer. Resuspendieren Zellpellet mit 30 ul Puffer NE und durch Vortexen mischen. </li><li> Inkubieren bei 4 ° C in einem Rohr Rotator oder auf Eis für 10 min. Zentrifuge 3.300 xg für 2 min 4 ° C. </li><li> Sammeln Sie die klare Überstand (nuclear Lysat) und aliquoten vor der Lagerung bei -806; C mehrere Gefrier-Auftau-Zyklen zu vermeiden, die das Protein abbauen kann. Lassen Sie eine 10 - ul - Aliquot Proteinkonzentration unter Verwendung des bichoninic Säure - Assay (BCA) 31 zu messen. </li></ol> 3. elektrophoretische Mobilität Shift Assay (EMSA) <ol><li> Bereiten Sie Oligo-Funktion Stock und EMSA Gel. <ol><li> Wenn Oligos im Duplex bestellt wurden, tauen die 100 uM Lager und verdünnt 1: 2000 in Anelierungspuffer 50 nM Arbeits Lager zu erreichen. </li><li> Wenn Oligos wurden einsträngige bestellt, tauen die 100 uM Aktien und verdünnen 1:10 in Anelierungspuffer 100 nM Arbeitsvorräte zu erreichen. Kombinieren von 100 ul der 100 nM Komplement Strang Lösung miteinander in einem Mikrozentrifugenröhrchen. <ol><li> In einem Heizblock bei 95 ° C für 5 min. Schalten Sie die Hitze Block aus und lassen Sie die Oligos langsam für mindestens eine Stunde auf Raumtemperatur abkühlen vor der Verwendung. </li></ol></li><li> die EMSA Gel Pre-run. <ol><li> Entfernen Sie die Folie aus einem vorgegossenen 6% TBE Gel und spülen Sie unter entsalztes Wasser mehrmals jeden Puffer aus den Vertiefungen zu entfernen. Vorbereitung 1 l TBE-Puffer 0,5x durch Zugabe von 50 ml 10x TBE zu 950 ml deionisiertem Wasser hergestellt. </li><li> Montieren Sie das Gel Elektrophorese-Vorrichtung und auf Dichtigkeit prüfen durch die innere Kammer füllt mit 0,5x TBE-Puffer. Wenn kein Puffer in die äußere Kammer austritt, füllen die äußere Kammer etwa zwei Drittel des Weges. </li><li> Pre-run für 60 Minuten das Gel bei 100 V. </li><li> Spülen Sie jede Vertiefung mit 200 ul 0,5x TBE-Puffer. </li></ol></li></ol></li><li> Bereiten Sie Buffer Master Mix Bindung. <ol><li> Bereiten 10x Puffer mit einer Endkonzentration von 100 mM Tris-Bindungs, 500 mM KCl, 10 mM DTT; pH-Wert 7,5 in entmineralisiertem Wasser. </li><li> In einem Mikrozentrifugenröhrchen, schaffen eine Mastermix der Reagenzien bestehend gemeinsam für alle Reaktionen (10 ul 10fach Bindungspuffer, 10 ul DTT / Polysorbat, 5 &amp; mgr; l Poly d (IC), und 2,5 ul Lachssperma - DNA; Tabelle 2). Bereiten Sie eine zusätzliche 10%zur Volumenverlust durch Pipettieren zu berücksichtigen. </li></ol></li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Reagens </td><td> Endkonz. </td><td> Rxn 1 # </td><td> Rxn 2 # </td><td> Rxn 3 # </td><td> Rxn 4 # </td></tr><tr><td> Reinstwassersysteme </td><td> bis 20 &amp; mgr; l Vol. </td><td> 13,5 ul </td><td> 11.98 ul </td><td> 13.5μl </td><td> 11.98 ul </td></tr><tr><td> 10x Binding Buffer </td><td> 1x </td><td> 2 ul </td><td> 2 ul </td><td> 2 ul </td><td> 2 ul </td></tr><tr><td> DVB - T / TW-20 </td><td> 1x </td><td> 2 ul </td><td> 2 ul </td><td> 2 ul </td><td> 2 ul </td></tr><tr><td> Lachssperma - DNA </td><td> 500 ng / ul </td&gt; <td> 0,5 ul </td><td> 0,5 ul </td><td> 0,5 ul </td><td> 0,5 ul </td></tr><tr><td> 1 ug / ul Poly d (IC) </td><td> 1 &amp; mgr; g </td><td> 1 ul </td><td> 1 ul </td><td> 1 ul </td><td> 1 ul </td></tr><tr><td> Kernextrakt (5,26 ug / ul) </td><td> 8 &amp; mgr; g </td><td> - </td><td> 1,52 ul </td><td> - </td><td> 1,52 ul </td></tr><tr><td> NE - Puffer </td><td></td><td> 1,52 ul </td><td> - </td><td> 1,52 ul </td><td> - </td></tr><tr><td> Referenz - Allels Oligo </td><td> 50 fmol </td><td> 1 ul </td><td> 1 ul </td><td> - </td><td> - </td></tr><tr><td> Nicht-Referenz - Allels Oligo </td><td> 50 fmol </td><td> - </td><td> - </td><td> 1 ul </td><td> 1 ul </td></tr></tbody></table> Tabelle 2: Beispiel EMSA Reaktion setup. Die Tabelle zeigt ein Beispiel EMSA die Hypothese zu testen , dass Genotyp-abhängig ist , die Bindung von TFs zu einem spezifischen SNP. <ol start="3"><li> In Nuklease-freies Wasser in jedes Mikrozentrifugenröhrchen, so dass das endgültige Volumen nach Zugabe aller Reagenzien 20 ul sein wird. </li><li> Fügen Sie den entsprechenden Betrag (5,5 ul) Master-Mix zu jedem Reaktionsgefäß. </li><li> In 8 ug Kern Lysat zu den entsprechenden Mikrozentrifugenröhrchen. Fügen Sie Röhren die Oligo ohne Kernextrakt als Negativkontrollen (zB Tabelle 2, Rxn # 1 und Rxn # 3) enthält. Anmerkung: Die optimale Menge an Lysat pro Reaktion experimentell durch Titration bestimmt werden. Im Allgemeinen wird ein Bereich von 2-10 &amp; mgr; g Lysat Titrieren ausreichend. </li><li> In 50 fmol Oligo an die entsprechenden Mikrozentrifugenröhrchen. Flick zu mischen und kurz den Inhalt auf den Boden der Röhre drehen. Inkubieren für 20 min bei Raumtemperatur. Hinweis: Wenn attemptieinen Supershift ng, inkubiere für 20 min mit Antikörper bei Raumtemperatur vor der Zugabe von Oligos des Lysats Mischung. Es wird empfohlen, für die besten Ergebnisse 1 ug eines ChIP-Grade-Antikörper zu verwenden. </li><li> In 2 ul 10x orange Loading Dye zu jedem Reaktionsgefäß. Pipette nach oben und unten zu mischen. </li><li> Legen Sie die Proben in den Vorlauf 6% TBE-Gel durch Pipettieren nach oben und unten zu mischen und dann jede Probe in einem separaten gut vertreiben. Führen Sie das Gel bei 80 V bis die orange Farbstoff 2/3 bis 3/4 des Weges durch das Gel gewandert ist. Dies sollte etwa 60 bis 75 Minuten dauern. </li><li> Entfernen Sie das Gel aus dem Plastikkassette durch sie offen mit einem Gel Messer neugierigen und legen Sie das Gel in einen Behälter mit 0,5% TBE-Puffer, damit er nicht austrocknet. </li><li> Legen Sie das Gel auf der Oberfläche eines Infrarot und Chemilumineszenz-Bildgebungssystem, wobei Sie alle Blasen oder Verunreinigungen zu beseitigen, die das Bild stören wird. </li><li> Mit dem Scan-System-Software, klicken Sie auf den &quot;Acquire&quot; Registerkarteund dann wählen Sie &quot;Neu Zeichnen&quot;, um ein Feld ziehen rund um den Bereich entsprechend, wo das Gel befindet sich auf der Oberfläche des Scanners. </li><li> In der &quot;Kanäle&quot; des &quot;Acquire&quot;, wählen Sie den Kanal auf der Wellenlänge des Fluorophor-Markierung auf dem Oligo entspricht. In der &quot;Scanner&quot; Abschnitt, klicken Sie auf &quot;Vorschau&quot;, um eine minderwertige Scan-Vorschau erhalten. Stellen Sie den Scanbereich durch das blaue Feld ziehen, das erworbene Vorschaubild bis auf den Teil des Gels umgebenden abgebildet werden. Hinweis: Wenn zum Beispiel Oligos, markiert mit einem 700 nm Fluorophore verwenden, stellen Sie sicher, dass die &quot;700 nm&quot; Kanal vor dem Scannen ausgewählt wird. </li><li> In der &quot;Scan-Steuerungen&quot; Abschnitt, wählen Sie die &quot;84 &amp; mgr; M&quot; Auflösungsoption und das &quot;Medium&quot; Qualität Option. Setzen Sie den Fokus auf die Hälfte der Dicke des Gels zu kompensieren. Hinweis: Zum Beispiel kann ein 1 mm Gel mit einer 0,5 mm Fokusversatz verwenden würde. </li><li> In der &quot;Scanner&quot; Abschnitt, klicken Sie auf &quot;Start&quot; zu bEGIN den Scanvorgang. Hinweis: Während des Scans die Helligkeit, Kontrast und Farbschema oft manuell angepasst werden je nach Hersteller des Abtastsystems werden kann. </li><li> Nachdem die Prüfung abgeschlossen ist, wählen Sie die Registerkarte &quot;Bild&quot; und klicken Sie auf &quot;Drehen oder Kippen&quot; im Abschnitt &quot;Create&quot;, um die Ausrichtung zu korrigieren. Speichern Sie die Bilddatei von &quot;Export&quot; im Hauptmenü klicken und dann auf &quot;Einzelbildansicht.&quot; </li></ol> 4. DNA-Affinitätsreinigung Assay (DAPA) <ol><li> Herstellung von 5 &amp; mgr; M Oligo-Funktion Stock. <ol><li> Wenn Oligos im Duplex bestellt wurden, tauen die 100 uM Lager und verdünnen 01.20 in Anelierungspuffer 5 uM Arbeits Lager zu erreichen. </li><li> Wenn Oligos wurden einsträngige bestellt, tauen die 100 uM Aktien und verdünnen 1:10 in Anelierungspuffer 10 uM Arbeitsvorräte zu erreichen. Mähdrescher 10 &amp; mgr; l der 10 &amp; mgr; M komplementäre Stränge miteinander. In einem Heizblock bei 95 ° C für5 Minuten. Schalten Sie die Hitze Block aus und lassen Sie die Oligos langsam auf Raumtemperatur abkühlen vor der Verwendung. </li></ol></li><li> Vor dem Start aufzuwärmen Bindungspuffer, niedriger Stringenz-Waschpuffer, hochstringenten Waschpuffer und Elutionspuffer auf Raumtemperatur. Hinweis: eine Endkonzentration von 50 ng / ml Poly d (IC) mit dem Bindungspuffer, niedriger Stringenz-Waschpuffer hinzugefügt und hoher Stringenz-Waschpuffer potentielle nicht-spezifische Bindung von Proteinen an die Oligos zu reduzieren. </li><li> Bereiten Sie die Bindung Mischungen für jede Variante. <ol><li> 1 Volumenteil der Kern Lysat mit 2 Volumina Bindungspuffer. Anmerkung: Die erforderliche Menge an Lysat muss experimentell bestimmt werden aufgrund unterschiedlicher Fülle von TFs. zwischen 100-250 ug Kern Lysat pro Spalte ist in den meisten Fällen ausreichend. </li><li> In 1x Phosphatase-Inhibitor, 1x Proteaseinhibitor und 1x Bindungsverstärker (optional) und mischen durch das Rohr mehrmals schnippen. Hinweis: 100x BindungEnhancer besteht aus 750 mM MgCl 2 und 300 mM ZnCl 2. Hinzufügen Bindungsverstärker, wenn die Bindung des TF an DNA auf Cofaktoren oder Reduktionsmittel abhängig ist. Wenn diese Informationen nicht bekannt ist, fügen Sie den Bindungsverstärker. </li><li> In 10 ul 5 uM biotinylierten Fänger-DNA (50 pmol) zu jeder jeweiligen Bindungsmischung. Inkubieren für 20 min bei Raumtemperatur. Hinweis: Die Inkubationszeit und Temperatur variieren in Abhängigkeit von der TF. Die optimalen Werte müssen experimentell bestimmt werden. </li></ol></li><li> 100 l Streptavidin-Mikrokügelchen. Inkubieren für 10 min bei Raumtemperatur. </li><li> Für jede Oligo-Sonde getestet, legen Sie eine verbindliche Spalte in der Magnetscheider. Legen Sie ein Mikrozentrifugenröhrchen direkt unter jeder Bindungssäule und anwenden 100 ul Bindungspuffer der Säule zu spülen. </li><li> Pipettieren den Inhalt der einzelnen Bindungsmischung in separaten Spalten und die Flüssigkeit vollständig durch die Säule in die Mikro fließenRohr, bevor Sie fortfahren. Achten Sie darauf, die Spalten mit der Variante Oligo zu kennzeichnen, die in der Bindungsmischung verwendet wurde. Beschriften Sie die Flow-Through-Proben und ersetzen sie durch neue Mikrozentrifugenröhrchen, die mit geringer Stringenz Waschungen zu sammeln. </li><li> Bewerben 100 ul niedrig stringenten Waschpuffer auf die Säule; warten, bis die Säule Behälter leer ist. Wiederholen Sie waschen 4x. Beschriften Sie die niedrigen Stringenz Waschproben und ersetzen sie durch neue Mikrozentrifugenröhrchen, die mit hoher Stringenz Waschungen zu sammeln. </li><li> Anwenden 100 ul hoher Stringenz-Waschpuffer auf die Säule; warten, bis die Säule Behälter leer ist. Wiederholen Sie waschen 4x. Beschriften Sie die mit hoher Stringenz Waschproben und ersetzen sie durch neue Mikrozentrifugenröhrchen die Vorelution zu sammeln. </li><li> In 30 ul nativen Elutionspuffer auf die Säule und lassen Sie sich für 5 Minuten stehen. Beschriften Sie die Vorelution Proben und ersetzen sie durch neue Mikrozentrifugenröhrchen die Elution zu sammeln. Hinweis: Das ist nicht das gebundene Protein nicht eluieren; es wäscht die verbleibende hoher Stringenzaus dem Säulenpuffer und ersetzt sie durch Elutionspuffer die Effizienz der Elution zu maximieren. </li><li> Fügen Sie einen zusätzlichen 50 ul nativen Elutionspuffer die gebundenen TFs zu eluieren. Für eine höhere Ausbeute, aber weniger konzentrierte Eluat, fügen Sie eine zusätzliche 50 ul nativen Elutionspuffer und die Durchfluss sammeln. Hinweis: Analysieren Elution Proben durch Massenspektrometrie 32 die Identität des gebunden TFs zu bestimmen. Anschließend überprüfen Sie die Proteom - Ergebnisse durch Natriumdodecyl- Sulfit - Polyacrylamid - Gelelektrophorese (SDS-PAGE) , gefolgt von einem Western - Blot - 33. Wenn Massenspektrometrie nicht verfügbar ist, führen Sie eine Silberfärbung unter Verwendung von Standard-Technik anstelle eines Western-Blot, der die Größe des Proteins (e) zeigt Genotyp-abhängige Bindung zu bestimmen. Verwenden Sie diese Informationen zu verengen die Liste der vorhergesagten TFs von den Rechenansätze in der Einleitung beschrieben. </li></ol>

<ol>
	<li>Hindorff, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+etiologic+and+functional+implications+of+genome-wide+association+loci+for+human+diseases+and+traits.">Potential etiologic and functional implications of genome-wide association loci for human diseases and traits.</a> Proc Natl Acad Sci U S A. 106 (23), 9362-9367 (2009).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li><li>Ward, L. D., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interpreting+noncoding+genetic+variation+in+complex+traits+and+human+disease.">Interpreting noncoding genetic variation in complex traits and human disease.</a> Nat Biotechnol. 30 (11), 1095-1106 (2012).</li><li>Paul, D. S., Soranzo, N., Beck, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+interpretation+of+non-coding+sequence+variation:+concepts+and+challenges.">Functional interpretation of non-coding sequence variation: concepts and challenges.</a> Bioessays. 36 (2), 191-199 (2014).</li><li>Zhang, F., Lupski, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-coding+genetic+variants+in+human+disease.">Non-coding genetic variants in human disease.</a> Hum Mol Genet. , (2015).</li><li>Lee, T. I., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+its+misregulation+in+disease.">Transcriptional regulation and its misregulation in disease.</a> Cell. 152 (6), 1237-1251 (2013).</li><li>Slatkin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linkage+disequilibrium--understanding+the+evolutionary+past+and+mapping+the+medical+future.">Linkage disequilibrium--understanding the evolutionary past and mapping the medical future.</a> Nat Rev Genet. 9 (6), 477-485 (2008).</li><li>Bush, W. S., Moore, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+11:+Genome-wide+association+studies.">Chapter 11: Genome-wide association studies.</a> PLoS Comput Biol. 8 (12), e1002822 (2012).</li><li>1000 Genomes Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+map+of+genetic+variation+from+1,092+human+genomes.">An integrated map of genetic variation from 1,092 human genomes.</a> Nature. 491 (7422), 56-65 (2012).</li><li>Chang, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+PLINK:+rising+to+the+challenge+of+larger+and+richer+datasets.">Second-generation PLINK: rising to the challenge of larger and richer datasets.</a> Gigascience. 4, 7 (2015).</li><li>Purcell, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PLINK:+a+tool+set+for+whole-genome+association+and+population-based+linkage+analyses.">PLINK: a tool set for whole-genome association and population-based linkage analyses.</a> Am J Hum Genet. 81 (3), 559-575 (2007).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Crawford, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+DNase+hypersensitive+sites+using+massively+parallel+signature+sequencing+(MPSS).">Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS).</a> Genome Res. 16 (1), 123-131 (2006).</li><li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FAIRE+Formaldehyde-Assisted+Isolation+of+Regulatory+Elements)+isolates+active+regulatory+elements+from+human+chromatin.">FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin.</a> Genome Res. 17 (6), 877-885 (2007).</li><li>Kent, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+genome+browser+at+UCSC.">The human genome browser at UCSC.</a> Genome Res. 12 (6), 996-1006 (2002).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Martens, J. H., Stunnenberg, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLUEPRINT:+mapping+human+blood+cell+epigenomes.">BLUEPRINT: mapping human blood cell epigenomes.</a> Haematologica. 98 (10), 1487-1489 (2013).</li><li>Liu, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cistrome:+an+integrative+platform+for+transcriptional+regulation+studies.">Cistrome: an integrative platform for transcriptional regulation studies.</a> Genome Biol. 12 (8), R83 (2011).</li><li>Griffon, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+public+ChIP-seq+experiments+reveals+a+complex+multi-cell+regulatory+landscape.">Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape.</a> Nucleic Acids Res. 43 (4), e27 (2015).</li><li>Staudt, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lymphoid-specific+protein+binding+to+the+octamer+motif+of+immunoglobulin+genes.">A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes.</a> Nature. 323 (6089), 640-643 (1986).</li><li>Singh, H., Sen, R., Baltimore, D., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+factor+that+binds+to+a+conserved+sequence+motif+in+transcriptional+control+elements+of+immunoglobulin+genes.">A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes.</a> Nature. 319 (6049), 154-158 (1986).</li><li>Weirauch, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+and+inference+of+eukaryotic+transcription+factor+sequence+specificity.">Determination and inference of eukaryotic transcription factor sequence specificity.</a> Cell. 158 (6), 1431-1443 (2014).</li><li>Ward, L. D., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HaploReg:+a+resource+for+exploring+chromatin+states,+conservation,+and+regulatory+motif+alterations+within+sets+of+genetically+linked+variants.">HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants.</a> Nucleic Acids Res. 40 (Database issue), D930-D934 (2012).</li><li>Boyle, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+of+functional+variation+in+personal+genomes+using+RegulomeDB.">Annotation of functional variation in personal genomes using RegulomeDB.</a> Genome Res. 22 (9), 1790-1797 (2012).</li><li>Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniPROBE,+update+2015:+new+tools+and+content+for+the+online+database+of+protein-binding+microarray+data+on+protein-DNA+interactions.">UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.</a> Nucleic Acids Res. 43 (Database issue), D117-D122 (2015).</li><li>Mathelier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JASPAR+2014:+an+extensively+expanded+and+updated+open-access+database+of+transcription+factor+binding+profiles.">JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles.</a> Nucleic Acids Res. 42 (Database issue), 142-147 (2014).</li><li>Smith, M. F., Delbary-Gossart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+(EMSA).">Electrophoretic Mobility Shift Assay (EMSA).</a> Methods Mol Med. 50, 249-257 (2001).</li><li>Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+cellular+proteins+recognizing+the+HIV+enhancer+using+a+microscale+DNA-affinity+precipitation+assay.">Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay.</a> Nature. 330 (6146), 391-395 (1987).</li><li>. BCA Protein Assay Kit: User Guide Available from: <a target="_blank" href="https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf">https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf</a> (2014)</li><li>Wijeratne, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphopeptide+separation+using+radially+aligned+titania+nanotubes+on+titanium+wire.">Phosphopeptide separation using radially aligned titania nanotubes on titanium wire.</a> ACS Appl Mater Interfaces. 7 (21), 11155-11164 (2015).</li><li>Silva, J. M., McMahon, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Fastest+Western+in+Town:+A+Contemporary+Twist+on+the+Classic+Western+Blot+Analysis.">The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis.</a> J. Vis. Exp. (84), (2014).</li><li>Lu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lupus+Risk+Variant+Increases+pSTAT1+Binding+and+Decreases+ETS1+Expression.">Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression.</a> Am J Hum Genet. 96 (5), 731-739 (2015).</li><li>Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+roles+of+Stat1+in+regulating+gene+expression.">Complex roles of Stat1 in regulating gene expression.</a> Oncogene. 19 (21), 2619-2627 (2000).</li><li>Fillebeen, C., Wilkinson, N., Pantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+(EMSA)+for+the+Study+of+RNA-Protein+Interactions:+The+IRE/IRP+Example.">Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example.</a> J. Vis. Exp. (94), e52230 (2014).</li><li>Heng, T. S., Painter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunological+Genome+Project,+C.+The+Immunological+Genome+Project:+networks+of+gene+expression+in+immune+cells.">Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells.</a> Nat Immunol. 9 (10), 1091-1094 (2008).</li><li>Wu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioGPS:+an+extensible+and+customizable+portal+for+querying+and+organizing+gene+annotation+resources.">BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources.</a> Genome Biol. 10 (11), R130 (2009).</li><li>Wu, C., Macleod, I., Su, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioGPS+and+MyGene.info:+organizing+online,+gene-centric+information.">BioGPS and MyGene.info: organizing online, gene-centric information.</a> Nucleic Acids Res. 41 (Database issue), D561-D565 (2013).</li><li>Wang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+features+and+chromatin+structure+around+the+genomic+regions+bound+by+119+human+transcription+factors.">Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors.</a> Genome Res. 22 (9), 1798-1812 (2012).</li><li>Holden, N. S., Tacon, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+and+problems+of+the+electrophoretic+mobility+shift+assay.">Principles and problems of the electrophoretic mobility shift assay.</a> J Pharmacol Toxicol Methods. 63 (1), 7-14 (2011).</li><li>Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osr1+acts+downstream+of+and+interacts+synergistically+with+Six2+to+maintain+nephron+progenitor+cells+during+kidney+organogenesis.">Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis.</a> Development. 141 (7), 1442-1452 (2014).</li><li>Yang, T. -. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genevar:+a+database+and+Java+application+for+the+analysis+and+visualization+of+SNP-gene+associations+in+eQTL+studies.">Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies.</a> Bioinformatics. 26 (19), 2474-2476 (2010).</li><li>Fort, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+liver+enhancer+in+the+fibrinogen+gene+cluster.">A liver enhancer in the fibrinogen gene cluster.</a> Blood. 117 (1), 276-282 (2011).</li><li>Solberg, N., Krauss, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Luciferase+assay+to+study+the+activity+of+a+cloned+promoter+DNA+fragment.">Luciferase assay to study the activity of a cloned promoter DNA fragment.</a> Methods Mol Biol. 977, 65-78 (2013).</li><li>Rahman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+repressor+element+in+the+5'-untranslated+region+of+human+Pax5+exon+1A.">A repressor element in the 5'-untranslated region of human Pax5 exon 1A.</a> Gene. 263 (1-2), 59-66 (2001).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Human+Genome+Engineering+via+Cas9.">RNA-Guided Human Genome Engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li></ol>

Die Autoren haben nichts zu offenbaren.

<html> Obwohl Fortschritte in der Sequenzierung und Genotypisierung Technologien stark unsere Fähigkeit, mit der Krankheit genetische Varianten assoziiert zu identifizieren verbessert haben, unsere Fähigkeit, die Funktionsmechanismen von diesen Varianten betroffen zu verstehen, hinkt. Eine wichtige Ursache des Problems ist, dass viele krankheitsassoziierten Varianten in n angeordnet sind on-kodierenden Regionen des Genoms, die wahrscheinlich Einfluss auf schwieriger zu sagen voraus Mechanismen Genexpression steuern. Hier stellen wir ein Protokoll auf der Grundlage der EMSA und DAPA Techniken wertvolle molekulare Werkzeuge zur Identifizierung von Genotyp-abhängig TF Bindungsereignisse, die auf die Funktion von vielen nicht-kodierenden Varianten wahrscheinlich bei. Obwohl diese beiden Techniken wurden in der Vergangenheit ausgiebig verwendet haben, haben sie erst seit kurzem für die genetische Variante Analyse der TF-Bindungs ​​angepasst. Jenseits TFs, EMSA können auch 36 die Wirkung der genetischen Varianten auf RNA - Bindungsproteine ​​mit nur geringfügigen Anpassungen des Protokolls zu analysieren. ove_content &quot;&gt; Das Protokoll hier vorgestellten einfach und leicht durchzuführen;. Gleichwohl müssen bestimmte Teile erfordern zusätzliche Überlegungen vor dem Experiment Zunächst ist es wichtig, eine erste Liste von Varianten zur Prüfung durch die Durchführung strengen statistischen Analysen wurde ein Fehler bei diesem Schritt zu erzeugen. können alle Downstream-Analysen entgleisen, wie viele Varianten unterschiedlich nuklearen Lysat binden, können zu Krankheitsrisiko ohne beitragen. Darüber hinaus kann die Verwendung von funktionellen Genomik Daten in relevante Zelltypen ausgeführt ist von entscheidender Bedeutung, als irrelevant Zelltypen auf die Erzeugung von falsch positiven TF führen Bindung Prognosen. Derzeit sind die am häufigsten verwendeten funktionelle Genom Ressourcen 17 ENCODE 12 und Roadmap Epigenomics enthalten. weitere Informationen zur Genexpression in Zelltypen relevant für eine Krankheit von Interesse kann von anderen Ressourcen wie ImmGen 37, 38 BioGPS erhalten werden, 39 und SNPsea 20 , z. B. solche Resources können diese TFs enthalten TF Bindung Vorhersagen zu filtern, um nur verwendet werden, die in den relevanten Zelltypen exprimiert werden. Es ist auch wichtig , um die Einschränkungen von in vitro - Experimenten, wie EMSA und DAPA zu betrachten. Insbesondere ist es notwendig, Experimente mit getrennten Kern Lysat Vorbereitungen zu wiederholen falsch negative Ergebnisse zu reduzieren. Darüber hinaus wird ein erfolgreicher EMSA-Supershift kann im EMSA Band als weitere Verschiebung darstellen, in denen Antikörper gegen den TF bindet, oder einem Verlust von Band, in dem Antikörper blockiert die DNA der TF-Bindungsdomäne. In beiden Szenarien einschließlich eines Isotyp-Kontrollantikörper und / oder einen Antikörper gegen einen anderen TF ist nützlich in der Spezifität der Supershift bestätigt. Eine weitere Überlegung in einen Supershift ausgeführt wird, ob DTT / Polysorbat in der Reaktion enthalten. DVB-T / Polysorbat stabilisiert den Laden Farbstoff für eine genauere Quantifizierung der ungebundenen DNA zu ermöglichen; sie kann jedoch auch Disulfidbindungen von Antikörpern zu reduzieren führening in Ausfall von EMSA-Supershift. Es wird empfohlen, Reaktionen mit und ohne DTT / Polysorbat zu versuchen, wenn man versucht, einen Komplex zu Supershift. Die optimale Menge an Poly d (IC) und Lachssperma-DNA pro Reaktion muss experimentell durch Titration bestimmt werden. Im Allgemeinen wird ein Bereich von 1-6 ug Poly d (IC) und 50-500 ng Lachssperma Titrieren ausreichend. Eine nützliche positive Kontrolle für DAPA umfasst eine Konsensussequenz für eine TF mit einem gut charakterisierten Bindungsmotiv verwendet (erhalten von Datenbanken wie CIS-BP 23 oder Factorbook 40) und einen westlichen mit einem Antikörper spezifisch für diese TF läuft. Für beide Assays kann eine verwürfelte Oligo verwendet werden, um zu zeigen, daß jede beobachtete Bindung ist spezifisch für die Oligos von Interesse. Sowohl die EMSA und DAPA Techniken haben experimentellen Einschränkungen. Beispielsweise die Bindungsaffinität zwischen einer TF und DNA wird zum großen Teil durch den Pufferbedingungen beeinflusst. Im Idealfall sollten Pufferbedingungen, die endogene conditio nachahmenns des Kerns für eine optimale Bindung zu ermöglichen. Für EMSA, ganz in einem schwachen Band oder den Verlust eines Bandes führen kann falsche Pufferbedingungen. Für DAPA, kann es zu nicht idealen Bedingungen die TF (n) während der Waschschritte eluiert werden. Daher ist jeder Test nur wirksam bei der Identifizierung von TF-Oligo unter bestimmten Pufferbedingungen verbindlich. Die am meisten allgemein nützlichen Pufferbedingungen sind im Protokoll oben dargestellt. Eine zweite Einschränkung ist, dass die experimentellen Ergebnisse von EMSA und DAPA Methoden wenig Informationen über die Mechanismen, durch die TFs binden an die Oligos bereitzustellen. TFs konnte direkt an Oligos binden oder durch andere Faktoren eingestellt werden. Dementsprechend ist es wichtig, die Oligo-Sequenzen rechnerisch zu analysieren, um vorherzusagen, wie TFS Oligos binden könnten und diese Voraussagen experimentell überprüfen. Beispielsweise kann eine spezifische Bindungssequenz mutiert werden oder ein Bindungspartner experimentell abgereichert werden kann. Schließlich muss die Menge an Extrakt verwendet für jedes Experiment t titriert werdeno erwerben optimale Ergebnisse. Zu viel Lysat kann die TF-Oligo-Bindung und verschleiern jede differentielle Bindung zwischen Risiko und nicht-Risiko-Allele zu sättigen. Zur weiteren Fehlersuche kann der Leser auf mehrere ausgezeichnete Bewertung und Methode Manuskripten 30,41,42 beziehen. Zusätzlich zu den hier beschriebenen Assays, gibt es eine Vielzahl von in vivo - Tests zur Verfügung , um die Rolle von Varianten innerhalb von lebenden Zellen untersucht (Figur 1 unten). Chromatinimmunpräzipitation gefolgt von Allel-spezifische quantitative Polymerase - Kettenreaktionen (ChIP-qPCR) Untersuchungen durchgeführt werden können , um festzustellen , ob die Differential innerhalb der in - vitro - Assays beobachtet Bindung wird in lebenden Zellen 34 repliziert. Wenn beispielsweise Zellen heterozygot für eine Variante von Interesse verwendet werden, können qPCR-Experimente, den Unterschied in Anreicherung zwischen den beiden Allelen in TF immunpräzipitiert Chromatin zu erkennen. ChIP erfordert spezifische ChIP-Grade-Antikörper; however, wenn ChIP-grade TF Antikörper nicht verfügbar sind, ist es, Zellen mit einem Flag-markierten TF Transfizieren eine wirksame Alternative 43. Zusätzlich kann die Wirkung der differentiellen Bindung an Zielgenexpression durch Expression quantitative trait loci (eQTL) -Analyse in entsprechenden Zelltypen unter Verwendung von lokal gesammelten Expressionsdaten aus genotypisiert Zellen oder öffentlich verfügbaren Ressourcen wie die von Genevar 44 zusammengestellt sucht werden. Luciferase-Reporter-Assays können auch den Grad, zu erforschen verwendet werden, auf die Bindung des Proteins differentiellen Genexpression auswirkt. Solche Tests können unabhängig davon zu arbeiten , modifiziert werden , ob die Varianten in einem Promotor, Enhancer oder Repressor - Region 45-47 befinden. Schließlich genomBearbeitungsTechnologien wie CRISPR / Cas9 48 kann verwendet werden , um Zelllinien zu erzeugen , die nur an einer einzigen Variante unterscheiden, die zur Bestätigung der Verursachung von entscheidender Bedeutung ist. Solche Technologien können die experimentelle Varianz beobachtet betw wesentlich reduziereneen Zelllinien aus genetisch diversen Fächer abgeleitet, da funktionelle Auslesungen Analysieren Genexpression oder einen anderen Krankheitszwischen Phänotyp kann auf der bearbeiteten Zelle-line durchgeführt werden, und im Vergleich zu nicht-bearbeiteten Zelllinien. Der Hauptvorteil der Strategie präsentiert ist, dass es eine einfache und schnelle Erkennung von Genotyp-abhängige TF ermöglicht Bindung. Durch Priorisierung können die wichtigsten genetischen Varianten, weitere Experimente entwickelt werden, um ihre biologische Wirkung zu identifizieren und deren Kausalität demonstrieren. Bemerkenswert ist, kann dieses Protokoll angewendet werden, um jede Krankheit oder Phänotyp assoziiert Variante von GWAS oder Feinkartierung identifiziert zu untersuchen. Eine große, wachsende Fundus an genetischen Daten und Listen von statistisch assoziierten genetischen Varianten ist bereits verfügbar. In den meisten Fällen ist die biologischen Mechanismen statistische Assoziation dieser Varianten der Fahrt nicht klar. Die Strategie in diesem Vorschlag skizzierten ermöglicht eine genaue funktionelle Interpretation der vielen nicht-kodierenden disease-assoziierten Varianten. Dieses Wissen ist für die vollständige Aufklärung der molekularen Mechanismen von entscheidender Bedeutung jedes genetische-basierte Krankheit zu fahren.

Sequenzierung und Genotypisierung basierte Studien, einschließlich der genomweiten Assoziationsstudien (GWAS), Kandidaten-Locus Studien und tiefSequenzierungsUntersuchungen haben viele genetische Varianten identifiziert, die statistisch im Zusammenhang mit einer Krankheit, Zug oder Phänotyp. Im Gegensatz zu dem frühen Vorhersagen, die meisten dieser Varianten (85-93%) werden in nicht-codierenden Regionen und die Aminosäuresequenz von Proteinen nicht 1,2 ändern. Interpretieren der Funktion dieser nicht-kodierenden Varianten und Bestimmung der biologischen Mechanismen , um sie zu dem zugeordneten Krankheit verbindet, trait oder Phänotyp hat Herausforderung erwiesen 3-6. Wir haben eine allgemeine Strategie entwickelt, um die molekularen Mechanismen zu identifizieren, die Varianten zu einem wichtigen Zwischen Phänotyp verknüpfen - Genexpression. Diese Pipeline wird speziell zu identifizieren, die Modulation der TF-Bindung durch genetische Varianten entwickelt. Diese Strategie kombiniert Rechenansätze und Techniken der Molekularbiologie Ziel vorherzusagenbiologische Wirkungen von Kandidatenvarianten in silico, und überprüfen diese Prognosen empirisch (Abbildung 1). <img alt="Abbildung 1" src="/files/ftp_upload/54093/54093fig1.jpg" /> Abbildung 1:.. Strategischer Ansatz für die Analyse von nicht-kodierenden genetischen Varianten Schritte, die in der detaillierten Protokoll sind nicht mit diesem Manuskript assoziiert enthalten sind grau schattiert <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig1large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> In vielen Fällen ist es wichtig, durch eine Erweiterung der Liste der Varianten zu beginnen alle, die in hohen Gestänge-Ungleichgewichts (LD) mit jeder statistisch assoziiert Variante enthalten. LD ist ein Maß der nicht-zufällige Assoziation von Allelen an zwei verschiedenen chromosomalen Stellen, die durch die r 2 -Statistik 7 gemessen werden kann. r 2 ist ein Maß für die linKage Ungleichgewichts zwischen zwei Varianten, mit einem r 2 = 1 bezeichnet perfekte Verbindung zwischen zwei Varianten. Allelen in hohen LD gefunden auf dem Chromosom über Vorfahren Populationen zusammen entmischen. Aktuelle Genotypisierung Arrays enthalten nicht alle bekannten Varianten im menschlichen Genom. Stattdessen verwerten sie die LD innerhalb des menschlichen Genoms und sind eine Teilmenge der bekannten Varianten , die 8 für andere Varianten innerhalb einer bestimmten Region des LD als Stellvertreter fungieren. Somit kann mit einer bestimmten Krankheit assoziiert sein eine Variante ohne biologische Folge kann, da es in LD mit dem kausalen varianten der Variante mit einer sinnvollen biologischen Wirkung. Prozedural, wird empfohlen , die neueste Version der 1000 Genome Projekt 9 Variante Call - Dateien (VCF) in binäre Dateien zu konvertieren kompatibel mit PLINK 10,11, einem Open-Source - Tool für Genom - Assoziations - Analyse. Anschließend werden alle anderen genetischen Varianten mit LD r 2&gt; 0,8 mit jedem Eingang genetischen variant als Kandidaten identifiziert werden. Es ist wichtig , die entsprechende Referenzpopulation für diese Schritt- zB zu verwenden, wenn eine Variante , bei Themen von europäischer Abstammung identifiziert wurde, Daten von Patienten mit ähnlicher Herkunft sollte für LD Expansion verwendet werden. LD Expansion resultiert oft in Dutzenden von Kandidatenvarianten, und es ist wahrscheinlich, dass nur ein kleiner Bruchteil von diesen zu Krankheitsmechanismus beizutragen. Oft ist es nicht durchführbar, experimentell jede dieser Varianten einzeln untersuchen. Es ist daher sinnvoll, die Tausende von öffentlich verfügbaren funktionellen genomischen Datensätze als Filter zu nutzen, um die Varianten zu priorisieren. Zum Beispiel 12 das ENCODE - Konsortium hat Tausende von ChIP-seq Experimente beschreiben die Bindung von Transkriptionsfaktoren und Co-Faktoren, und Histonmarkierungen in einem breiten Spektrum von Kontexten, zusammen mit Chromatin Zugänglichkeit von Daten von Technologien wie DNase-seq 13, ATAC ausgeführt -SEQ 14 und FAIRE-seq 15. DatabAses und Web - Servern wie dem UCSC Genome Browser 16, Roadmap Epigenomics 17, Epigenome Blueprint 18, Cistrome 19 und ReMap 20 bieten freien Zugang zu Daten , die durch diese und andere experimentelle Techniken in einer Vielzahl von Zelltypen und Bedingungen hergestellt. Wenn es zu viele Varianten sind experimentell zu untersuchen, können diese Daten verwendet werden, die innerhalb wahrscheinlich regulatorischen Regionen in entsprechenden Zell- und Gewebetypen angeordnet zu priorisieren. Ferner wird in Fällen, in denen eine Variante für ein spezifisches Protein in einer ChIP-seq peak ist, können diese Daten Potential führt als der spezifischen TF (s) oder Cofaktoren schaffen, deren Bindung könnte beeinflussen. Als nächstes werden die resultierenden priorisiert Varianten gescreent experimentell vorhergesagt Genotyp-abhängige Protein zu validieren Bindungs ​​21,22 mittels EMSA. EMSA misst die Veränderung in der Migration des oligo auf einem nicht-reduzierenden TBE-Gel. Fluoreszierend markiertes Oligo mit der inkubiertenKern Lysat, und die Bindung von Kernfaktoren wird verzögern die Bewegung des Oligo auf dem Gel. Auf diese Weise Oligo, die mehr Kernfaktoren gebunden hat, als ein stärkeres Fluoreszenzsignal beim Abtasten präsentieren wird. Bemerkenswert ist, erfordert keine EMSA Prognosen über die spezifischen Proteine, deren Bindung betroffen. Sobald Varianten identifiziert werden, die innerhalb der erwarteten regulatorischen Regionen befinden und in der Lage sind unterschiedlich Bindung Kernfaktoren sind Berechnungsverfahren die spezifische TF (s), dessen vorherzusagen verwendet Bindung sie beeinflussen könnten. Wir bevorzugen CIS-BP 23,24, RegulomeDB 25, UNIProbe 26 zu verwenden, und JASPAR 27. Sobald Kandidaten TFs identifiziert werden, können diese Prognosen ausdrücklich Antikörper gegen diese TFs (EMSA-supershifts und DAPA-Westerns) getestet werden. Eine EMSA-Supershift beinhaltet die Zugabe eines TF-spezifischen Antikörpers an das Kern Lysat und Oligo. Ein positives Ergebnis in einem EMSA-Supershift ist represented als eine weitere Verschiebung der EMSA Band oder einem Verlust des Bandes (in Bezug 28 überprüft). In der komplementären DAPA, eine 5&#39;-biotinylierten Oligokomplexes die Variante und das 20 Basenpaar-flankierenden Nukleotide enthalten, werden mit nuklearen Lysat von relevanten Zelltyp (en) inkubiert alle Kernfaktoren speziell zur Erfassung der Oligos binden. Die Oligokomplexes-nuclear factor-Komplex wird durch Streptavidin-Mikrokügelchen in einer magnetischen Säule immobilisiert. Die gebundenen Kernfaktoren werden direkt durch Elution 29,48 gesammelt. Bindungsvorhersagen können dann durch Western-Blot untersucht werden, um Antikörper, spezifisch für das Protein verwendet wird. In Fällen, in denen es keine offensichtlichen Prognosen oder zu viele Vorhersagen, die Elutionen von Variante Pull-downs der DAPA Experimente können zu einem Proteomik Kern gesendet werden, um Kandidaten TFs mit Massenspektrometrie identifizieren, die anschließend validiert werden können mit diesen zuvor beschriebenen Methoden. In dem Rest des article wird das detaillierte Protokoll für EMSA und DAPA Analyse genetischer Varianten vorgesehen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Custom DNA Oligonucleotides</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>http://www.idtdna.com/site/order/oligoentry</td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Fisher Scientific</td>
			<td>BP366-500</td>
			<td>KCl, for CE buffer</td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Fisher Scientific</td>
			<td>15630-080</td>
			<td>For CE and NE buffer</td>
		</tr>
		<tr>
			<td>EDTA (0.5M), pH 8.0</td>
			<td>Life Technologies</td>
			<td>R1021</td>
			<td>For CE, NE, and annealing buffer</td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Fisher Scientific</td>
			<td>BP358-1</td>
			<td>NaCl, for NE buffer</td>
		</tr>
		<tr>
			<td>Tris-HCl (1M), pH 8.0</td>
			<td>Invitrogen</td>
			<td>BP1756-100</td>
			<td>For annealing buffer</td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (1X)</td>
			<td>Fisher Scientific</td>
			<td>MT21040CM</td>
			<td>PBS, for cell wash</td>
		</tr>
		<tr>
			<td>DL-Dithiothreitol solution (1M)</td>
			<td>Sigma</td>
			<td>646563</td>
			<td>Reducing agent</td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Thermo Scientific</td>
			<td>36978</td>
			<td>Protease Inhibitor</td>
		</tr>
		<tr>
			<td>Phosphatase Inhibitor Cocktail&#160;</td>
			<td>Thermo Scientific</td>
			<td>78420</td>
			<td>Prevents dephosphorylation of TFs</td>
		</tr>
		<tr>
			<td>Nonidet P-40 Substitute</td>
			<td>IBI Scientific</td>
			<td>IB01140</td>
			<td>NP-40, for nuclear extraction</td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Thermo Scientific</td>
			<td>23225</td>
			<td>For measuring protein concentration</td>
		</tr>
		<tr>
			<td>Odyssey EMSA Buffer Kit</td>
			<td>Licor</td>
			<td>829-07910</td>
			<td>Contains all necessary EMSA buffers</td>
		</tr>
		<tr>
			<td>TBE Gels, 6%, 12 Wells</td>
			<td>Invitrogen</td>
			<td>EC6265BOX</td>
			<td>For EMSA</td>
		</tr>
		<tr>
			<td>TBE Buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B52</td>
			<td>For EMSA</td>
		</tr>
		<tr>
			<td>FactorFinder Starting Kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-092-318</td>
			<td>Contains all necessary DAPA buffers</td>
		</tr>
		<tr>
			<td>Licor Odyssey CLx</td>
			<td>Licor</td>
			<td></td>
			<td>Recommended scanner for DAPA/EMSA</td>
		</tr>
		<tr>
			<td>Antibiotic-Antimycotic</td>
			<td>Gibco</td>
			<td>15240-062</td>
			<td>Contains 10,000 units/mL of penicillin, 10,000 &#181;g/mL of streptomycin, and 25 &#181;g/mL of Fungizone&#174; Antimycotic</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>26140-079</td>
			<td>FBS, for culture media</td>
		</tr>
		<tr>
			<td>RPMI 1640 Medium</td>
			<td>Gibco</td>
			<td>22400-071</td>
			<td>Contains L-glutamine and 25mM HEPES</td>
		</tr>
	</tbody>
</table>

screening for functional non-coding genetic variants using electrophoretic mobility shift assay (emsa) and dna-affinity precipitation assay (dapa)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype.

In diesem Abschnitt repräsentative Ergebnisse von dem, was zu erwarten, zur Verfügung gestellt, wenn ein EMSA oder DAPA Durchführung und die Variabilität in Bezug auf die Qualität des Lysats gekennzeichnet ist. Beispielsweise wurde vorgeschlagen, dass mehrere Male Einfrieren und Auftauen Proteinproben in Denaturierung führen kann. Um die Reproduzierbarkeit der EMSA-Analyse im Rahmen dieser &quot;Frost-Tau&quot; Zyklen, zwei 35 bp Oligos unterschiedlichen an einer genetischen Variante wurden mit einer einzigen Charge von Kern Lysat zu erforschen inkubiert, die aufgetaut und wieder eingefroren wurde für die angegebene Menge . Male Abbildung 2 zeigt , dass Einfrieren und Auftauen dieser besonderen B-Lymphozyten - Zellkernextrakt bis zu 5 mal hat anscheinend keine Wirkung auf die Integrität der Proteine; jedoch Stabilität von Kernprotein variiert von Proben und sollte daher auf jeder einzelnen Zelllinie verwendet, getestet werden. Es ist auch möglich Variation von verschiedenen batch prepar habentionen der Kern Lysaten. Ob diese Variante aufgrund der Phase des Zellzyklus wird vor der Lyse, Zellpassage Nummer oder anderen Faktoren ist es wichtig, EMSA Ergebnisse mit verschiedenen Chargen von Lysat zu replizieren realen Ergebnisse sicherzustellen. Zusätzlich ist es wichtig, das Signal-Rausch-Verhältnis für die EMSA zu optimieren. Eine wichtige Größe hierbei ist die Oligo-Konzentration. Die Menge an Oligo (5-300 fmol) wurde zu beurteilen titriert , wie verschiedene Mengen von Oligos beeinflussen das Signal (Abbildung 3). Eine Erhöhung der Intensität der Bande wurde bis zu 100 fmol von Oligo beobachtet. Nach diesem Punkt ist das Signal, was darauf hindeutet, Plateaus 100 fmol der optimale Oligo Menge für diesen EMSA Reaktion. Schließlich eine repräsentative Figur von einem unserer veröffentlichten Studien Teil der Strategie in diesem Manuskript beschrieben unter Verwendung vorgesehen ist (Abbildung 4). in thStudie 34 wird haben wir gezeigt , dass der Lupus-assoziierter Risiko Allel von rs6590330 Erhöhungen von STAT1, einem Transkriptionsfaktor - Bindungs ​​, die stromabwärts von dem Typ - 1 - IFN - Rezeptors in sowohl synergistische Aktivierung und Hemmung der Genexpression komplex 35 teilnimmt. In diesem Beispiel wurde zuerst von STAT1 DAPA gefolgt von Proteom-Analyse unter Verwendung von Hochleistungsflüssigkeitschromatographie gekoppelt Tandem-Massenspektroskopie (DAPA-MS) identifiziert. Ein DAPA-Western-Blot wurde verwendet, um die TF von Proteomanalyse (STAT1) identifiziert, um zu bestätigen und bestätigen, dass die phosphorylierte Form von STAT1 an den Nicht-Referenz wurde Bindung (Lupus-Risiko) Oligo. Diese Figur zeigt, wie die verschiedenen Assays, die in dieser Strategie verwendet werden können Differenzfaktor Bindung von Transkriptions zu einer nicht-kodierenden Variante zu identifizieren. <img alt="Figur 2" src="/files/ftp_upload/54093/54093fig2.jpg" /> Abbildung 2: Analyse der Reproduzierbarkeitund die Folgen der Gefrier-Auftau - Zyklen auf EMSA Ergebnisse. Oligos die Referenz (R) oder nicht-reference (NR) Allel eines genetischen Variante enthielten , wurden verwendet , um die gleichen Herstellungs Lysat nach mehreren Zyklen von Einfrieren und Auftauen zu sondieren. (Lys: Lysate). Jede Spur enthält die freie Sonde am unteren Rand des Gels (blauer Pfeil). Bindung der TFs an das Oligo kann als Band in der oberen Hälfte des Gels (roter Pfeil) gesehen werden. Bands in der unteren Hälfte des Gels enthalten (siehe Klammer) sind unspezifisch. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/54093/54093fig3.jpg" /> Fig . 3: Die Bewertung der Wirkung verschiedener Konzentrationen oligo Verschiedene Konzentrationen von Oligos wurden eine einzelne Zubereitung von Kern Lysat Sonde verwendet. Fluorescent Signal steigt mit erhöhten Mengen Oligo, was darauf hinweist, dass das Oligo das begrenzende Reagenz ist. Die Signal Plateaus an den 100-300 fmol Gassen, wo die Menge an Protein der limitierende Reagenz wird. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 4" src="/files/ftp_upload/54093/54093fig4.jpg" /> Abbildung 4: Der Lupus-Risiko - Allel von rs6590330 erhöht STAT1 Bindung, wie beurteilt durch DAPA-MS STAT1 und Pstat1 zeigen eine höhere Bindung an Oligos das rs6590330 Risiko - Allel im Vergleich zu den nicht-Risiko - Allel enthält.. Biotin-markierten Oligos wurden mit Epstein-Barr-Virus-transformierten B-Zellkernextrakt inkubiert. Proteine, gebunden an die Oligo wurden mit DAPA erfasst. Proteine ​​wurden dann durch SDS-Polyacrylamid-Gelelektrophorese aufgetrennt und detektiert unter Verwendung von anti-Pstat1(A) oder anti-STAT1 (B). M: Marker. NR: Oligo die Nicht-Risiko-Allel von rs6590330 enthält; R: Oligo das Risiko-Allel von rs6590330 enthält; Mutant: Oligo ein unterbrochenes mutmaßliche STAT1-Bindungsstelle stromabwärts von rs6590330 enthält; Zelllysat: Kernextrakt aus B-Zellen. Die relativen Intensitäten der Banden sind unter jeder Band angezeigt. Ergebnisse sind repräsentativ für vier Versuchen; während alle Versuche zeigen in 2/4 Experimenten keine STAT1 oder Pstat1 wurde im Immunpräzipitat aus dem nicht-Risiko oligo detektiert STAT1 Bindung an die Sonden mit dem Risiko-Allel, erhöht, während beide in dem Immunpräzipitat aus der Risiko oligo nachgewiesen wurden. Diese Zahl hat sich von der Referenz 34 geändert. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54093/54093fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA at JoVE.com

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Screening für Funktionelle nichtkodierenden genetischen Varianten Mit elektrophoretische Mobilitäts-Shift-Assay (EMSA) und DNA-Affinitätspräzipitation Assay (DAPA)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical ...

screening-for-functional-non-coding-genetic-variants-using

Nanyang Technological University

Research

JoVE Journal

Biology

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)

12.9K Aufrufe.  Cincinnati Children's Hospital. We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Serie: Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

Light/dark Transition Test for Mice

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, however, can be used to delete or manipulate a specific gene in mice. The influence of a given gene on a specific behavior can then be determined by conducting behavioral analyses of the mutant mice. As a test for behavioral phenotyping of mutant mice, the light/dark transition test is one of the most widely used tests to measure anxiety-like behavior in mice. The test is based on the natural aversion of mice to brightly illuminated areas and on their spontaneous exploratory behavior in novel environments. The test is sensitive to anxiolytic drug treatment. The apparatus consists of a dark chamber and a brightly illuminated chamber. Mice are allowed to move freely between the two chambers. The number of entries into the bright chamber and the duration of time spent there are indices of bright-space anxiety in mice. To obtain phenotyping results of a strain of mutant mice that can be readily reproduced and compared with those of other mutants, the behavioral test methods should be as identical as possible between laboratories. The procedural differences that exist between laboratories, however, make it difficult to replicate or compare the results among laboratories. Here, we present our protocol for the light/dark transition test as a movie so that the details of the protocol can be demonstrated. In our laboratory, we have assessed more than 60 strains of mutant mice using the protocol shown in the movie. Those data will be disclosed as a part of a public database that we are now constructing.

Visualization of the protocol will facilitate understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used across laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test.

The light/dark transition test is one of the most widely used tests to measure anxiety-like behavior in mice. Here, we present a movie that shows detailed procedures on how we conduct the test.

Hell / Dunkel Transition Test für Mäuse

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

Forschung

Biologie

Assay for Neural Induction in the Chick Embryo

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying the formation and initial patterning of the nervous system. This video demonstrates how to graft organizer tissue into a host, a method by which Hensen s node (the organizer in the chick embryo) is grafted to a host competent ectoderm. The organizer graft instructs overlying na ve tissue to adopt a neural fate via neural inducing signals. This mechanism is referred to as neural induction, and constitutes the initial step in the formation of brain and spinal cord in amniotes. This method is essentially used for the characterization of putative neural inducing molecules in chick. This video demonstrates the different steps in the assay for neural induction; First, the donnor embryo is explanted and pinned on a dish. Then, the host embryo is prepared for New culture. The graft is excised and transplanted to the host area pellucida margin. The host is cultured for 18-22 hrs. The assembly is fixed and processed for further applications (e.g. in situ hybridization). This method was originally devised by Waddington 1,2 and Gallera 3,4.

Neural induction is the first step in the formation of the brain. It is a mechanism by which Hensen's node (organizer), instructs adjacent tissue to adopt a neural fate, i.e. to give rise to the nervous system. This video demonstrates an assay for neural induction in chick embryo.

Assay für Neural Induction im Hühnerembryo

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Elevated Plus Maze for Mice

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given gene on a specific behavior can be determined by behavioral analysis of mutant mice. If a target gene is expressed in the brain, behavioral phenotype of the mutant mice could elucidate the genetic mechanism of normal behaviors. The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior. The test is based on the natural aversion of mice for open and elevated areas, as well as on their natural spontaneous exploratory behavior in novel environments. The apparatus consists of open arms and closed arms, crossed in the middle perpendicularly to each other, and a center area. Mice are given access to all of the arms and are allowed to move freely between them. The number of entries into the open arms and the time spent in the open arms are used as indices of open space-induced anxiety in mice. Unfortunately, the procedural differences that exist between laboratories make it difficult to duplicate and compare results among laboratories. Here, we present a detailed movie demonstrating our protocol for the elevated plus maze test. In our laboratory, we have assessed more than 90 strains of mutant mice using the protocol shown in the movie. These data will be disclosed as a part of a public database that we are now constructing.
Visualization of the protocol will promote better understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used in different laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test. 


The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior in mice. Here, we present a movie showing the detailed procedures for conducting the test.

Elevated Plus Maze für Mäuse

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its remarkable neuronal cell plasticity, and its involvement in epilepsy, neurodegenerative diseases, and psychiatric disorders. The hippocampus is composed of distinct regions; the dentate gyrus, which comprises mainly granule neurons, and Ammon's horn, which comprises mainly pyramidal neurons, and the two regions are connected by both anatomic and functional circuits. Many different mRNAs and proteins are selectively expressed in the dentate gyrus, and the dentate gyrus is a site of adult neurogenesis; that is, new neurons are continually generated in the adult dentate gyrus. To investigate mRNA and protein expression specific to the dentate gyrus, laser capture microdissection is often used. This method has some limitations, however, such as the need for special apparatuses and complicated handling procedures. In this video-recorded protocol, we demonstrate a dissection technique for removing the dentate gyrus from adult mouse under a stereomicroscope. Dentate gyrus samples prepared using this technique are suitable for any assay, including transcriptomic, proteomic, and cell biology analyses. We confirmed that the dissected tissue is dentate gyrus by conducting real-time PCR of dentate gyrus-specific genes, tryptophan 2,3-dioxygenase (TDO2) and desmoplakin (Dsp), and Ammon's horn enriched genes, Meis-related gene 1b (Mrg1b) and TYRO3 protein tyrosine kinase 3 (Tyro3). The mRNA expressions of TDO2 and Dsp in the dentate gyrus samples were detected at obviously higher levels, whereas Mrg1b and Tyro3 were lower levels, than those in the Ammon's horn samples. To demonstrate the advantage of this method, we performed DNA microarray analysis using samples of whole hippocampus and dentate gyrus. The mRNA expression of TDO2 and Dsp, which are expressed selectively in the dentate gyrus, in the whole hippocampus of alpha-CaMKII+/- mice, exhibited 0.037 and 0.10-fold changes compared to that of wild-type mice, respectively. In the isolated dentate gyrus, however, these expressions exhibited 0.011 and 0.021-fold changes compared to that of wild-type mice, demonstrating that gene expression changes in dentate gyrus can be detected with greater sensitivity. Taken together, this convenient and accurate dissection technique can be reliably used for studies focused on the dentate gyrus.

A dissection technique for removal of the dentate gyrus from adult mouse under a stereomicroscope was demonstrated in this video-recorded protocol.

Dissection der hippocampalen von erwachsenen Maus

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

Crystallizing Membrane Proteins for Structure Determination using Lipidic Mesophases

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the lipidic cubic phase or in meso method. The method has been shown to be quite versatile in that it has been used to solve X-ray crystallographic structures of prokaryotic and eukaryotic proteins, proteins that are monomeric, homo- and hetero-multimeric, chromophore-containing and chromophore-free, and alpha-helical and beta-barrel proteins. Recent successes using in meso crystallization are the human engineered beta2-adrenergic and adenosine A2a G protein-coupled receptors. Protocols are presented for reconstituting the membrane protein into the monoolein-based mesophase, and for setting up crystallizations in the manual mode. Additional steps in the overall process, such as crystal harvesting, are to be addressed in future video articles. The time required to prepare the protein-loaded mesophase and to set up a crystallization plate manually is about one hour.

Herein is described the procedure implemented in the Caffrey Membrane Structural and Functional Biology Group to set up manually crystallization trials of membrane proteins in lipidic mesophases.

Crystallizing Membranproteinen zur Strukturaufklärung mittels Lipidische Mesophasen

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the ...

An Allele-specific Gene Expression Assay to Test the Functional Basis of Genetic Associations

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been understood at molecular level. One of the mechanisms mediating the effect of DNA variants on phenotypes is gene expression, which has been shown to be particularly relevant for complex traits1.
This method tests in a cellular context the effect of specific DNA sequences on gene expression. The principle is to measure the relative abundance of transcripts arising from the two alleles of a gene, analysing cells which carry one copy of the DNA sequences associated with disease (the risk variants)2,3. Therefore, the cells used for this method should meet two fundamental genotypic requirements: they have to be heterozygous both for DNA risk variants and for DNA markers, typically coding polymorphisms, which can distinguish transcripts based on their chromosomal origin (Figure 1). DNA risk variants and DNA markers do not need to have the same allele frequency but the phase (haplotypic) relationship of the genetic markers needs to be understood. It is also important to choose cell types which express the gene of interest. This protocol refers specifically to the procedure adopted to extract nucleic acids from fibroblasts but the method is equally applicable to other cells types including primary cells.
DNA and RNA are extracted from the selected cell lines and cDNA is generated. DNA and cDNA are analysed with a primer extension assay, designed to target the coding DNA markers4. The primer extension assay is carried out using the MassARRAY (Sequenom)5 platform according to the manufacturer's specifications. Primer extension products are then analysed by matrix-assisted laser desorption/ionization time of-flight mass spectrometry (MALDI-TOF/MS). Because the selected markers are heterozygous they will generate two peaks on the MS profiles. The area of each peak is proportional to the transcript abundance and can be measured with a function of the MassARRAY Typer software to generate an allelic ratio (allele 1: allele 2) calculation. The allelic ratio obtained for cDNA is normalized using that measured from genomic DNA, where the allelic ratio is expected to be 1:1 to correct for technical artifacts. Markers with a normalised allelic ratio significantly different to 1 indicate that the amount of transcript generated from the two chromosomes in the same cell is different, suggesting that the DNA variants associated with the phenotype have an effect on gene expression. Experimental controls should be used to confirm the results.

Genetic associations often remain unexplained at a functional level. This method aims to assess the effect of phenotype-associated genetic markers on gene expression by analyzing cells heterozygous for transcribed SNPs. The technology allows accurate measurement by MALDI-TOF mass spectrometry to quantify allele-specific primer extension products.

Ein Allel-spezifische Gene Expression Assay zur Funktionsanalyse Grundlage genetischer Verbände testen

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been ...

A Fluorescent Screening Assay for Identifying Modulators of GIRK Channels

G protein-gated inward rectifier K+ (GIRK) channels function as cellular mediators of a wide range of hormones and neurotransmitters and are expressed in the brain, heart, skeletal muscle and endocrine tissue1,2. GIRK channels become activated following the binding of ligands (neurotransmitters, hormones, drugs, etc.) to their plasma membrane-bound, G protein-coupled receptors (GPCRs). This binding causes the stimulation of G proteins (Gi and Go) which subsequently bind to and activate the GIRK channel. Once opened the GIRK channel allows the movement of K+ out of the cell causing the resting membrane potential to become more negative. As a consequence, GIRK channel activation in neurons decreases spontaneous action potential formation and inhibits the release of excitatory neurotransmitters. In the heart, activation of the GIRK channel inhibits pacemaker activity thereby slowing the heart rate.
GIRK channels represent novel targets for the development of new therapeutic agents for the treatment neuropathic pain, drug addiction, cardiac arrhythmias and other disorders3. However, the pharmacology of these channels remains largely unexplored. Although a number of drugs including anti-arrhythmic agents, antipsychotic drugs and antidepressants block the GIRK channel, this inhibition is not selective and occurs at relatively high drug concentrations3.
Here, we describe a real-time screening assay for identifying new modulators of GIRK channels. In this assay, neuronal AtT20 cells, expressing GIRK channels, are loaded with membrane potential-sensitive fluorescent dyes such as bis-(1,3-dibutylbarbituric acid) trimethine oxonol [DiBAC4(3)] or HLB 021-152 (Figure 1). The dye molecules become strongly fluorescent following uptake into the cells (Figure 1). Treatment of the cells with GPCR ligands stimulates the GIRK channels to open. The resulting K+ efflux out of the cell causes the membrane potential to become more negative and the fluorescent signal to decrease (Figure 1). Thus, drugs that modulate K+ efflux through the GIRK channel can be assayed using a fluorescent plate reader. Unlike other ion channel screening assays, such atomic absorption spectrometry4 or radiotracer analysis5, the GIRK channel fluorescent assay provides a fast, real-time and inexpensive screening procedure.

A real-time screening procedure for identifying drugs that interact with G protein-gated inward rectifier K+ (GIRK) channels is described. The assay utilizes membrane potential-sensitive fluorescent dyes to measure GIRK channel activity. This technique is adaptable for use on a number of cell lines.

Ein fluoreszierendes Screening Assay zur Identifizierung von Modulatoren der GIRK Kanäle

G protein-gated inward rectifier K+ (GIRK) channels function as cellular mediators of a wide range of hormones and neurotransmitters and are expressed in ...

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Mapping Bakterielle Functional Netzwerke und Pathways in<em&gt; Escherichia Coli</em&gt; Verwendung von Synthetic Genetic Arrays

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with Parkinson&#39;s disease. 293T cells are transiently transfected with plasmids from an arrayed ORF expression library, together with luciferase reporter plasmids, in a one-gene-per-well microplate format. Firefly luciferase activity is assayed after 48 hr to determine the effects of each library gene upon alpha-synuclein transcription, normalized to expression from an internal control construct (a hCMV promoter directing Renilla luciferase). This protocol is facilitated by a bench-top robot enclosed in a biosafety cabinet, which performs aseptic liquid handling in 96-well format. Our automated transfection protocol is readily adaptable to high-throughput lentiviral library production or other functional screening protocols requiring triple-transfections of large numbers of unique library plasmids in conjunction with a common set of helper plasmids. We also present an inexpensive and validated alternative to commercially-available, dual luciferase reagents which employs PTC124, EDTA, and pyrophosphate to suppress firefly luciferase activity prior to measurement of Renilla luciferase. Using these methods, we screened 7,670 human genes and identified 68 regulators of alpha-synuclein. This protocol is easily modifiable to target other genes of interest.

We present a rapid and inexpensive screening method for identifying transcriptional regulators using high-throughput robotic transfections and a homemade dual-glow luciferase assay. This protocol rapidly generates direct side-by-side functional data for thousands of genes and is easily modifiable to target any gene of interest.

Hochdurchsatz-Screening mit einem Funktionshomemade Dual-Luciferase Assay-Schein

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example

RNA/protein interactions are critical for post-transcriptional regulatory pathways. Among the best-characterized cytosolic RNA-binding proteins are iron regulatory proteins, IRP1 and IRP2. They bind to iron responsive elements (IREs) within the untranslated regions (UTRs) of several target mRNAs, thereby controlling the mRNAs translation or stability. IRE/IRP interactions have been widely studied by EMSA. Here, we describe the EMSA protocol for analyzing the IRE-binding activity of IRP1 and IRP2, which can be generalized to assess the activity of other RNA-binding proteins as well. A crude protein lysate containing an RNA-binding protein, or a purified preparation of this protein, is incubated with an excess of32 P-labeled RNA probe, allowing for complex formation. Heparin is added to preclude non-specific protein to probe binding. Subsequently, the mixture is analyzed by non-denaturing electrophoresis on a polyacrylamide gel. The free probe migrates fast, while the RNA/protein complex exhibits retarded mobility; hence, the procedure is also called &#8220;gel retardation&#8221; or &#8220;bandshift&#8221; assay. After completion of the electrophoresis, the gel is dried and RNA/protein complexes, as well as free probe, are detected by autoradiography. The overall goal of the protocol is to detect and quantify IRE/IRP and other RNA/protein interactions. Moreover, EMSA can also be used to determine specificity, binding affinity, and stoichiometry of the RNA/protein interaction under investigation.

Electrophoretic Mobility Shift Assay EMSA for the Study of RNA-Protein Interactions: The IRE/IRP Example

Here we present a protocol to analyze RNA/protein interactions. The electrophoretic mobility shift assay (EMSA) is based on the differential migration of RNA/protein complexes and free RNA during native gel electrophoresis. By using a radiolabeled RNA probe, RNA/protein complexes can be visualized by autoradiography.

Electrophoretic Mobility Shift Assay (EMSA) für das Studium von RNA-Protein-Wechselwirkungen: Die IRE / IRP Beispiel

RNA/protein interactions are critical for post-transcriptional regulatory pathways. Among the best-characterized cytosolic RNA-binding proteins are iron ...