Wir möchten, dass Elizabeth Byrne, David Gootenberg und Christina Gosmann für kritisches Feedback über das Protokoll zu danken; Megan Baldridge, Scott Handley, Cindy Monaco und Jason Norman für die Probenvorbereitung Führung und Demonstrationen; Wendy Garrett, Curtis Huttenhower Skip Virgin und Bruce Walker für die Protokoll-Rat und fruchtbare Diskussionen; und Jessica Hoisington-Lopez für die Sequenzierung Unterstützung. Die Arbeit wurde von der Bill and Melinda Gates Foundation, und die NIAID (1R01AI111918) nicht unterstützt. DSK erhielt zusätzliche Unterstützung vom Burroughs Wellcome Fund. MNA wurde von Verleihungsnummer T32GM007753 vom NIGMS, und der Paul und Daisy Soros Fellowship unterstützt. Der Inhalt ist allein in der Verantwortung der Autoren und stellen nicht notwendigerweise die offizielle Position der NIGMS oder die NIH.

<ol>
	<li>Huttenhower, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure,+function+and+diversity+of+the+healthy+human+microbiome.">Structure, function and diversity of the healthy human microbiome.</a> Nature. 486, 207-214 (2012).</li><li>O'Hanlon, D. E., Moench, T. R., Cone, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+pH+and+microbicidal+lactic+acid+when+lactobacilli+dominate+the+microbiota.">Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota.</a> PloS one. 8, e80074 (2013).</li><li>Aldunate, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+concentrations+of+lactic+acid+potently+inactivate+HIV.">Vaginal concentrations of lactic acid potently inactivate HIV.</a> The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).</li><li>Anahtar, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cervicovaginal+bacteria+are+a+major+modulator+of+host+inflammatory+responses+in+the+female+genital+tract.">Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract.</a> Immunity. 42, 965-976 (2015).</li><li>Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gnotobiotic+mouse+model+of+phage-bacterial+host+dynamics+in+the+human+gut.">Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut.</a> Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).</li><li>Chomczynski, P., Sacchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-step+method+of+RNA+isolation+by+acid+guanidinium+thiocyanate-phenol-chloroform+extraction.">Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.</a> Analytical biochemistry. 162, 156-159 (1987).</li><li>Srinivasan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+variability+of+human+vaginal+bacteria+and+relationship+with+bacterial+vaginosis.">Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis.</a> PloS one. 5, e10197 (2010).</li><li>Dols, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microarray-based+identification+of+clinically+relevant+vaginal+bacteria+in+relation+to+bacterial+vaginosis.">Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis.</a> American journal of obstetrics and gynecology. 204, 301-307 (2011).</li><li>Segata, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+microbial+community+profiling+using+unique+clade-specific+marker+genes.">Metagenomic microbial community profiling using unique clade-specific marker genes.</a> Nature methods. 9, 811-814 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME journal. 6, 1621-1624 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> Proceedings of the National Academy of Sciences of the United States of America. 108, 4516-4522 (2011).</li><li>Ravel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+microbiome+of+reproductive-age+women.">Vaginal microbiome of reproductive-age women.</a> Proceedings of the National Academy of Sciences of the United States of America. 108, 4680-4687 (2011).</li><li>Srinivasan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+communities+in+women+with+bacterial+vaginosis:+high+resolution+phylogenetic+analyses+reveal+relationships+of+microbiota+to+clinical+criteria.">Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria.</a> PloS one. 7, e37818 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature methods. 7, 335-336 (2010).</li><li>Schloss, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+mothur:+open-source,+platform-independent,+community-supported+software+for+describing+and+comparing+microbial+communities.">Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities.</a> Applied and environmental microbiology. 75, 7537-7541 (2009).</li><li>Edgar, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UPARSE:+highly+accurate+OTU+sequences+from+microbial+amplicon+reads.">UPARSE: highly accurate OTU sequences from microbial amplicon reads.</a> Nature. 10, 996-998 (2013).</li><li>AllPrep DNA/RNA Mini Kit. Qiagen Available from: <a target="_blank" href="https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/">https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/</a> (2015)</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> Journal of visualized experiments. , (2012).</li><li>Quant-iT PicoGreen dsDNA Reagent. Invitrogen Available from: <a target="_blank" href="https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf">https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf</a> (2008)</li><li>DeSantis, T. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Greengenes,+a+chimera-checked+16S+rRNA+gene+database+and+workbench+compatible+with+ARB.">Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.</a> Applied and environmental microbiology. 72, 5069-5072 (2006).</li><li>Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMPeror:+a+tool+for+visualizing+high-throughput+microbial+community+data.">EMPeror: a tool for visualizing high-throughput microbial community data.</a> GigaScience. 2, 16 (2013).</li><li>Eren, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+diversity+of+Gardnerella+vaginalis+in+the+genitourinary+tract+microbiota+of+monogamous+couples+through+subtle+nucleotide+variation.">Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation.</a> PloS one. 6, e26732 (2011).</li><li>Langille, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predictive+functional+profiling+of+microbial+communities+using+16S+rRNA+marker+gene+sequences.">Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences.</a> Nature biotechnology. 31, 814-821 (2013).</li></ol>

The authors have nothing to disclose.

Hier beschreiben wir ein Protokoll für die Identifizierung und Charakterisierung der relativen bakteriellen Häufigkeiten innerhalb eines menschlichen vaginaler Abstrich. Dieses Protokoll kann leicht für andere Probentypen, wie Stuhl und Tupfer anderer Körperstellen angepaßt werden, und für Proben aus einer Vielzahl von Quellen gesammelt. Die Extraktion von Nukleinsäure von sicken Schlagen in einer gepufferten Lösung von Phenol und Chloroform ermöglicht die Isolierung von sowohl DNA als auch RNA, die besonders wichtig ist, wenn sie mit wertvollen Proben gesammelt durch klinische Studien zu arbeiten. Die isolierte bakterielle DNA eignet sich hervorragend für bakterielle taxonomische Identifizierung und genomische Montage, während die gleichzeitige Sammlung von RNA die Möglichkeit bietet, funktionelle bakterielle Wirt und Virus-Beiträge durch RNA-seq zu bestimmen. Das beschriebene Protokoll basiert auf einer validierten Ein-Schritt - Primer - Set , das auf einer Vielzahl von Probenarten erfolgreich eingesetzt wurde, einschließlich Mensch, Hund und Umweltproben 10 </sup&gt;. Die Verfügbarkeit von Tausenden von barcodierte Primer ermöglicht Multiplexing von Proben und enorme Einsparungen bei den Sequenzierungskosten. Der komplette Kosten (einschließlich aller Reagenzien, einer einzigen Sequenzierungslauf und Primer aber nicht Ausrüstung) ist etwa 20 $ pro Probe bei 200 Proben gemultiplext werden. Zusätzlich gibt es eine sehr hohe Reproduzierbarkeit wenn mehrere Tupfer aus der gleichen Probenstelle unabhängig durch die gesamte Pipeline verarbeitet werden. Insgesamt ist das Protokoll, kosteneffizient, flexibel, zuverlässig und wiederholbar. Die Nukleinsäureextraktion Teil dieses Protokolls wird durch die erforderlichen Sicherheitsvorkehrungen begrenzt, wenn mit Phenol und Chloroform zu arbeiten, und die Herausforderungen, die Pipeline zu einem hohen Durchsatz zu automatisieren, 96-Well-Plattenformat. Zusätzlich wird die kräftige Wulst Schläge für die mechanische Lyse Schere die bakterielle DNA auf ca. 6 kb Fragmente verwendet; wenn längere DNA-Fragmente werden für Downstream-Anwendungen erforderlich, die Dauer der Wulst Schlagen should verkürzt werden. Die Beschränkungen des Bakterienidentifizierungs Teil dieses Protokolls sind inhärent für jede Methode, die auf 16S-rRNA-Gen-Sequenzierung beruht. 16S-rRNA-Sequenzierung ist für die Identifizierung von Bakterien, die zur Gattung und sogar Artniveau ideal, aber nur selten bietet Verformungspegel Identifikation. Während die V4 variable Region der 16S - rRNA - Gen unter den meisten Bakterienarten 11, zusätzliche Rechenverfahren wie Oligotyping 31 robust Diskriminierungs bietet müssen genau verwendet werden , um bestimmte Arten, wie Lactobacillus crispatus identifizieren. Schließlich Informationen über die genaue bakterielle funktionellen Fähigkeiten in einer bestimmten Probe kann nicht allein durch die 16S-rRNA-Gen-Sequenzierung bestimmt werden, obwohl dieses Protokoll Extraktion von whole genome DNA und RNA ermöglicht, die zu diesem Zweck verwendet werden können. Der kritischste Schritt zur Gewährleistung Erfolg mit diesem Protokoll wird unter großer Sorgfalt Kontamination zu verhindern during Probensammlung, Nukleinsäure-Extraktion und PCR-Amplifikation. Stellen Sie sicher, Sterilität zum Zeitpunkt der Probenentnahme durch saubere Handschuhe tragen und mit sterilen Tupfern, Röhren und Schere. Um eine Kontamination der Sammlung Materialien beurteilen zu können, sammeln negative Kontrolltupfer, indem zusätzliche nicht verwendeten Tupfer direkt in Transportröhren zum Zeitpunkt der Probenahme. Im Labor führen alle Vorverstärkung Schritte in einem sterilisierten Haube nur dekontaminiert liefert und nur mit molekularen, DNA-freie Reagenzien enthält. Während die Nukleinsäureextraktion, verhindern eine Kreuzkontamination durch den Einsatz neuer sterilen Pinzette und frische Handschuhe mit jeder Probe, und halten Sie alle Rohre, es sei denn im Gebrauch geschlossen. Die Verarbeitung nicht verwendeten Tupfer parallel sorgt für Sterilität sowohl der Probensammlung und Nukleinsäure-Extraktion; die nicht verwendeten Tupfer sollte nicht ein Pellet nach Isopropanol-Fällung und Ethanol Waschen erhalten. Wenn ein Pellet angezeigt wird, führen 16S-rRNA-Gen-Amplifikation eine mögliche Quelle zu bestimmen,die Verunreinigung (zB würde das Vorhandensein von Streptococcus oder Staphylococcus Kontamination der Haut zeigen). Zusätzlich führen PCR Amplifikationen ohne Templat Kontrollreaktionen in parallel, um sicherzustellen, dass die PCR-Reagenzien und Reaktionen sind nicht kontaminiert worden ist. Wenn ein Band in einem keine Vorlage Steuerung angezeigt wird, um die Reagenzien zu verwerfen und die Amplifikation mit frischen Reagenzien wiederholen. Diese Vorsichtsmaßnahmen werden erfolgreiche Sequenzierung der Bakterien Interesse sicherzustellen. Die PCR-Amplifikation Schritt neigt dazu, die meisten Problembehandlung erfordern. Amplifizierung in Gruppen von zwölf Proben stellt ein Gleichgewicht zwischen Effizienz und Konsistenz. Das vollständige Fehlen von Banden in allen Proben in einem bestimmten Verstärkung Satz deutet auf eine systematische Versagen, zum Beispiel vergessen , ein Reagens hinzuzufügen oder falsch den Thermocycler Programmierung. Das Fehlen einer Bande von einigen Proben ist in der Regel aufgrund von menschlichem Versagen und die Amplifikationen erneut r sollteun mit der gleichen Paarung von Probe und Reverse-Primer. Im Fall einer fortgesetzten Abwesenheit eines Bandes kann die Probe mit einem anderen Strichcode unter Verwendung eines reversen Primers erneut amplifiziert werden. Wiederholter Ausfall der PCR mit mehreren Reverse-Primer können einen Inhibitor in der Probe vorhanden zeigen. Inhibitoren entfernen, ohne signifikant zu verändern relativen Abundanzen bakteriellen In diesem Fall wird häufig die DNA mit einer Säule gereinigt wird. Wenn mehrere Bänder nach einer Verstärkung führen, wieder verstärken, um die Probe mit einem anderen Reverse-Primer-Barcode. Zusätzlich zu einer Kontamination der Umwelt zu verhindern und sicherzustellen, Amplifikation eines einzelnen spezifischen Produkt, erfolgreiche Sequenzierung beruht auf Pflege, wenn die Bibliothek Pool vorbereitet. Das Ziel ist, äquimolare Mengen von jeder Probe des Amplicons zu kombinieren etwa die gleiche Anzahl von Sequenzierungs sicherzustellen pro Abtastwert liest. Wenn die Nukleinsäure-Konzentrationen vor der Verstärkung vergleichbar sind, das Hinzufügen einfach gleichen Volumina jeder sample des Amplikons ist ausreichend, wenn die Bibliothek Pool zu schaffen. Jedoch, wenn die Nukleinsäurekonzentrationen erheblich unterschiedlich sind und in gleichem Volumen, wobei die Probe mit der geringen Nukleinsäurekonzentration wird schlecht mit einer geringen Anzahl von Lesevorgängen dargestellt zugesetzt. In diesem Fall ist es möglich, ein höheres Volumen der Amplikons von der Niedrigkonzentrationsprobe von der relativen Intensität der Gel-Bande basierend hinzuzufügen. Alternativ ist es möglich, rigoroser Primern aus den einzelnen Amplifikaten entfernen, quantifizieren die einzelnen Proben Amplicon-Konzentration einen fluorimetrischen Quantifizierung dsDNA-Kit und genau äquimolaren Mengen jeder Probe kombinieren. Sobald ein ausgewogenes Amplicon-Pool generiert wird, wird es von entscheidender Bedeutung, um sorgfältig die Konzentration des Pool messen. Im Anschluss vorsichtig Verdünnung und Spike-in mit PhiX erhöhen die Lese Komplexität für das Erreichen optimaler Sequenzierungsergebnisse kritisch ist. Hochdurchsatz-Sequenzern, die Sequen verwendencing durch Synthese sind in den Cluster-Dichte auf der Durchflusszelle sehr empfindlich. Laden einer Bibliothek Pool, der auch konzentriert in overclustering, mit geringerer Qualität Partituren, geringere Datenausgabe und ungenau Demultiplexen 32 führen wird. Laden eines Bibliothek-Pool, der auch bei niedrigen Datenausgang führt zu verdünnt wird. die Bibliothek Pool vor der Sequenzierung sorgfältig Quantifizierung werden optimale Ergebnisse zu gewährleisten. 16S-rRNA-Gen-Sequenzierung bietet eine umfassende Beurteilung der vorhandenen Bakterien innerhalb einer gegebenen Probe und ist ein absolut entscheidender erster Schritt in Hypothesengenerierung. Das Vorhandensein einer umfangreichen Satz von Metadaten ermöglicht weiterhin die Forscher Assoziationen zwischen bestimmten Bakterienarten zu testen und wichtige biologische Faktoren. Darüber hinaus kann die gleiche 16S - Informationen verwendet werden , um die bakterielle Funktionen mit Werkzeugen ableiten wie PICRUSt 33. Oberstes Ziel ist es 16S Charakterisierung verwenden neue Assoziationen zu identifizieren, die sein könnenweiter getestet und in Modellsystemen validiert, zusätzlich zu unserem wachsenden Verständnis der Auswirkungen der bakteriellen microbiome auf die menschliche Gesundheit und Krankheiten.

Der menschliche unteren Reproduktionstrakts, des gastrointestinalen Systems, des Atmungstrakts und der Haut werden durch komplexe Bakteriengemeinschaften besiedelt , die für die Aufrechterhaltung der Homöostase von Gewebe und Unterstützung der Gesundheit des Wirtes 1 entscheidend sind. Zum Beispiel eine unwirtliche Umgebung für Pathogene bestimmte Laktobazillen erstellen , indem Sie das Scheidengewölbe Versauerung, die Herstellung von antimikrobiellen Effektoren und Modulation lokalen Host Immunität 2-4. Die wachsende Wertschätzung für die Bedeutung der bakteriellen microbiome hat auch Interesse erhöht bei der Charakterisierung von Bakteriengemeinschaften in vielen klinischen Kontexten. Hier beschreiben wir eine Methode, um die Zusammensetzung der bakteriellen microbiome aus Genitalabstrichen zu bestimmen. Das Protokoll kann leicht für Hocker und Tupferproben aus anderen anatomischen Stellen und anderen Wirtsarten gesammelt modifiziert werden. Aufgrund der inhärenten Einschränkungen bei der Anzahl der Proben, die von einem gegebenen Bolzen gesammelt und gespeichert werden können,y Teilnehmer wurde dieses Protokoll zu extrahieren , DNA, RNA, entworfen und möglicherweise sogar Protein aus einem einzigen Tupfer eine angepasste Phenol-Chloroform basierend sicken Schlagen Verfahren 5,6. Die Kombination der physikalischen Störung der bakteriellen Zellwände mit sicken Schlagen und chemische Störung mit Detergenzien ermöglicht eine schnelle Lyse von Gram-positive, Gram-negative und säurefeste Bakterien ohne zusätzliche enzymatische Verdauung Schritte. Um eine hohe Qualität RNA zu erhalten, wird empfohlen, trockenen Tupfer zu verwenden, die bei oder unter 4 ° gehalten wurden C unmittelbar nach der Entnahme und beim Transport in das Labor (falls zutreffend) und gespeicherte Langzeit bei -80 ° C. Um die bakterielle microbiome innerhalb einer gegebenen Probe zu bestimmen, ist dieses Verfahren nutzt 16S rRNA-Gen-Amplikon-Sequenzierung, die derzeit die kostengünstigste Mittel zur umfassenden bakteriellen Taxonomie zuordnen und relative Quantifizierung durchzuführen. Alternative Verfahren umfassen qPCR gezielte 7, kundenspezifische microarrays 8 und Vollgenomsequenzierung 9. Das 16S-rRNA-Gen enthält neun hypervariablen Regionen, und es gibt keinen Konsens über die optimale V-Region in Bezug auf die für die vaginale microbiome Studien zu sequenzieren. Hier verwenden wir die 515F / 806R Primer - Set und bauen auf die Pipeline entworfen von Caporaso et al. 10-12. Caporaso et al. &#39;S 515F / 806R Primer - Set ermöglicht Multiplexing von Hunderten von Proben auf einer einzigen Sequenzierungslauf aufgrund der Verfügbarkeit von Tausenden von validierten barcodierte Primer und die Kompatibilität mit Illumina - Sequenzierung Plattformen. Im Gegensatz zu den 27F / 338R Primer Human Microbiome Projekt 13 gesetzt, 515F / 806R verstärkt auch Bifidobacteriaceae effektiv und damit fängt genau Gardnerella vaginalis, ein wichtiges Mitglied der vaginalen mikrobiellen Gemeinschaft in einigen Frauen. Alternativ ist seit Pyrosequenzierung der vaginalen Proben 14 und ein 515F / 926R Primerpaar ein 338F / 806R Primerpaar erfolgreich hat rece verwendetntly verfügbar werden für die nächste Generation - Sequenzierung 12. Schließlich bietet dieses Protokoll grundlegende Anweisungen 16S Amplikon - Analyse durchzuführen , die quantitativen Insights mit in Microbial Ecology (QIIME) Software - Paket 15. Die erfolgreiche Umsetzung der QIIME Befehle beschrieben hier ergibt sich eine Tabelle für jede Probe Bakterien taxonomischen Abundanzen enthält. Viele zusätzliche Qualitätskontrollschritte, taxonomische Klassifizierung Methoden und Analyseschritte können in die Analyse einbezogen werden, wie es im Detail auf der QIIME Website beschrieben (http://qiime.org/index.html). Wenn die Analyse auf einem Apple - Computer ausgeführt werden, 16 das MacQIIME - Paket bietet eine einfache Installation von QIIME und ihre Abhängigkeiten. Alternative Software - Pakete für die 16S rRNA - Gen - Sequenzanalyse umfassen Mothur 17 und UPARSE 18.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Equipment:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Beadbeater-16</td>
			<td>BioSpec</td>
			<td>607</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR workstation</td>
			<td></td>
			<td></td>
			<td>Any PCR hood can be used, e.g., the AirClean 600.</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td>Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.</td>
		</tr>
		<tr>
			<td>Electrophoresis system</td>
			<td></td>
			<td></td>
			<td>Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.</td>
		</tr>
		<tr>
			<td>Nanodrop</td>
			<td>Thermo Scientific</td>
			<td>2000C</td>
			<td>Any other DNA quantification method will be sufficient</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td>An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.</td>
		</tr>
		<tr>
			<td>MiSeq or HiSeq</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Catch-All Sample Collection swab</td>
			<td>Epibio</td>
			<td>QEC89100</td>
			<td>Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project.&#160;</td>
		</tr>
		<tr>
			<td>ELIMINase</td>
			<td>Fisher</td>
			<td>04-355-31</td>
			<td></td>
		</tr>
		<tr>
			<td>SteriFlip 50 mL filtration device (0.22 &#181;m)</td>
			<td>EMD Millipore</td>
			<td>SCGP00525</td>
			<td></td>
		</tr>
		<tr>
			<td>0.1 mm glass beads</td>
			<td>BioSpec</td>
			<td>11079101</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL screw-cap tubes</td>
			<td>Sarstedt</td>
			<td>72.694.006</td>
			<td>For bead beating</td>
		</tr>
		<tr>
			<td>UltraPure 5M NaCl</td>
			<td>Life Technologies</td>
			<td>24740-011</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>1 M Tris-HCl</td>
			<td>Ambion (Invitrogen)</td>
			<td>AM9856</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>Ambion (Invitrogen)</td>
			<td>AM9260G</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Sodium Dodecyl Sulfate, 20% Solution</td>
			<td>Fisher</td>
			<td>BP1311-200</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-free distilled water</td>
			<td>Ambion</td>
			<td>10977-015</td>
			<td>Molecular Biology Grade, for buffer preparation</td>
		</tr>
		<tr>
			<td>2-Propanol BioReagent, for molecular biology, &#8805;99.5%</td>
			<td>Sigma</td>
			<td>I9516-500ML</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:IAA, 25:24:1</td>
			<td>Invitrogen</td>
			<td>AM9730</td>
			<td>Warning: Toxic</td>
		</tr>
		<tr>
			<td>3 M Sodium Acetate, pH 5.5</td>
			<td>Life Technologies</td>
			<td>AM9740</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Disposable sterile polystyrene forceps, PS</td>
			<td>Cole Parmer</td>
			<td>EW-06443-20</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL, clear, PCR clean tubes</td>
			<td>Eppendorf</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>MoBio</td>
			<td>17000-11</td>
			<td>For PCR</td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity DNA Polymerase</td>
			<td>New England Biolabs</td>
			<td>M0530S</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP mix</td>
			<td>Sigma</td>
			<td>D7295-0.5mL</td>
			<td></td>
		</tr>
		<tr>
			<td>0.2 ml PCR 8-tube with attached clear flat caps, natural</td>
			<td>USA Scientific</td>
			<td>1492-3900</td>
			<td>Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>BioExpress</td>
			<td>E-3121-25</td>
			<td></td>
		</tr>
		<tr>
			<td>50X TAE buffer</td>
			<td>Lonza</td>
			<td>51216</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA gel stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>6X DNA Loading Dye</td>
			<td>Thermo (Fisher)</td>
			<td>R0611</td>
			<td></td>
		</tr>
		<tr>
			<td>50bp GeneRuler Ladder</td>
			<td>Thermo (Fisher)</td>
			<td>SM0373</td>
			<td></td>
		</tr>
		<tr>
			<td>AllPrep DNA/RNA kit</td>
			<td>Qiagen</td>
			<td>80284</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraClean PCR Clean-up Kit</td>
			<td>MoBio</td>
			<td>12500-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>P11496</td>
			<td>An alternative is Qubit Fluorometric Quantification (Life Technologies)</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>515F (forward primer) 5&#39;-AATGATACGGCGACCACCGAG 
			ATCTACACTATGGTAATTGT 
			GTGCCAGCMGCCGCGGTAA-3&#39;</td>
			<td></td>
			<td></td>
			<td>Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**</td>
		</tr>
		<tr>
			<td>Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded 
			_primers_515F_806R.txt</td>
			<td>IDT is recommended</td>
			<td></td>
			<td>If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 &#956;M. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and 
			_resuspension.doc.&#160; **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**</td>
		</tr>
		<tr>
			<td>Read 1 Sequencing Primer 5&#39;-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3&#39;</td>
			<td></td>
			<td></td>
			<td>25 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>Read 2 Sequencing Primer 5&#39;-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3&#39;</td>
			<td></td>
			<td></td>
			<td>26 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>Index Sequencing Primer 5&#39;-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3&#39;</td>
			<td></td>
			<td></td>
			<td>27 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td>Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.</td>
		</tr>
	</tbody>
</table>

efficient nucleic acid extraction and 16s rrna gene sequencing for bacterial community characterization

Es gibt eine wachsende Wertschätzung für die Rolle der mikrobiellen Lebensgemeinschaften als kritische Modulatoren der menschlichen Gesundheit und Krankheit. Hochdurchsatz-Sequenzierung Technologien für die schnelle und effiziente Charakterisierung von Bakteriengemeinschaften verwenden 16S rRNA-Gen-Sequenzierung aus einer Vielzahl von Quellen erlaubt. Obwohl leicht verfügbaren Werkzeuge für die 16S rRNA-Analyse-Sequenz standardisierte Rechen Workflows haben, bleibt Probenverarbeitung zur DNA-Extraktion über Studien, die eine Fortsetzung Quelle der Variabilität. Hier beschreiben wir eine effiziente, robuste und kosteneffektive Methode zur Nukleinsäure von Tupfern extrahieren. Wir beschreiben auch Downstream-Methoden für 16S-rRNA-Gen-Sequenzierung, einschließlich der Erzeugung von Sequenzierungsbibliotheken, Datenqualitätskontrolle und Sequenzanalyse. Die Workflow kann mehrere Proben-Typen, einschließlich Stuhl und Tupfer aus einer Vielzahl von anatomischen Stellen und Wirtsarten gesammelt zubringen. Zusätzlich gewonnene DNA und RNA abgetrennt und verwendet werden,für andere Anwendungen, einschließlich vollständige Genomsequenzierung oder RNA-Seq. Das beschriebene Verfahren erlaubt einen gemeinsamen Ansatz bei Verarbeitung für mehrere Probentypen und bietet Platz für Downstream-Analyse genomischer, Metagenom und Transkriptions Informationen.

<html> Die allgemeine Übersicht über das Protokoll, welches die Bestimmung der relativen Abundanzen bakteriellen aus einem Tupfer - Sequenzierung unter Verwendung 16S - rRNA - Gens, dargestellt in Figur 1 .Das Protokoll wurde optimiert für den menschlichen vaginale Abstriche, aber kann leicht angepasst für die meisten Schleimhautmessstellen ermöglicht und anderen Wirten. Abbildung 2 zeigt die hochwertige DNA und RNA, die die sickenschlag Protokoll isoliert werden können. 3 veranschaulicht eine erfolgreiche PCR - Amplifikation von 12 Proben, wobei jede Amplifikation mit einer Probe eine einzige starke Bande der korrekten ergab Größe und jedes Wasserkontrolle hat eine Band nicht ergeben. Abbildung 4 zeigt die Quantifizierung der endgültigen Bibliothek Pool vor der Sequenzierung. 5 zeigt eine typische Abfolge Qualitätsprofil nach einer Single-End 300 bp MiSeq laufen. &quot;Src =&quot; / files / ftp_upload / 53939 / 53939fig1.jpg &quot;/&gt; Abbildung 1. Schematische Übersicht des Protokolls. Zunächst wird Nukleinsäure aus einem Tupfer von Wulst-Schläge in einer gepufferten Lösung extrahiert , das Phenol, Chloroform und Isoamylalkohol. Variable Region 4 des 16S-rRNA-Gen wird dann aus der erhaltenen Nukleinsäure unter Verwendung von PCR amplifiziert. PCR-Produkte von bis zu Hunderten von Proben werden dann kombiniert und auf einem einzigen Lauf sequenziert. Die resultierenden Sequenzen werden mit einer Referenzdatenbank abgeglichen relativen Abundanzen bakterielle zu bestimmen. Das gesamte Protokoll kann in etwa drei Tagen durchgeführt werden. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/53939/53939fig2.jpg" /> Abbildung 2. Hochwertige Nukleinsäure Heraus Verwendung des Phenol: Chloroform Bead Beating Methode. (A) DNA - Qualität, wie ein Spektrophotometer verwendet wird . Ein A260 / A280 Verhältnis zwischen 1,8 und 2,0 zeigt an reine Nukleinsäure , die nicht mit Phenol oder Protein. (B) Nach einer Spalte Bereinigungs kontaminiert ist, kann dieses Protokoll qualitativ hochwertige RNA ergeben, angezeigt durch starke 16S und 23S - rRNA - Gipfel. (C) RNA - Abbau kann auftreten , wenn die Probe nicht kalt nach der Entnahme gehalten wird (während Transport und Lagerung) oder wenn RNasen während der Verarbeitung vorhanden sind. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/53939/53939fig3.jpg" /> Abbildung 3. Bestätigung der erfolgreichen 16S - rRNA - Gene Amplifikation unter Verwendung der 515F und Barcodierte 806R Primer - Set. Top) Gel - Elektrophorese verwendet , um die Anwesenheit eines einzigen Band um 380 Basenpaare zu bestätigen in jede Probe, die mit Schablone amplifiziert. Das Fehlen einer Bande zeigt erfolglosen Verstärkung; dies ist in der Regel aufgrund von menschlichem Versagen und der PCR - Reaktion aus dieser Probe zu wiederholen. Unten) Kein Template (Wasser) Kontrollen in parallel mit dem gleichen Primerpaar laufen sollte kein Band vorhanden sind. Das Vorhandensein einer Bande in der Wasserkontrolle zeigt an kontaminierten Reagenzien; verwerfen die Reagenzien , die kontaminiert sein können und wieder tun , um die PCR - Amplifikationen sowohl der Vorlage und Wassersteuerung für das Primerpaar. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 4" src="/files/ftp_upload/53939/53939fig4.jpg" /> Abbildung 4. Quantifizierung der Schluß Bibliothek Pool Konzentration und Validierung der Bibliothek Größe. Nachdem die einzelnen Probe Amplikons Bündelung the Konzentration der fertigen Bibliothek Pool muss bestimmt werden. Die Bibliothek Pool muss dann weiterhin eine 2 nM Konzentration zu erreichen , verdünnt werden. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 5" src="/files/ftp_upload/53939/53939fig5.jpg" /> Abbildung 5. Repräsentative Bar Plot der Sequenz Qualitätsfaktor bei jeder Position des Read. Es ist normal , dass die Sequenz Qualität nach 200 Basenpaare fallen zu lassen, aber die durchschnittliche Qualität der Gäste sollte über 30 bleiben <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig5large.jpg" target="_blank">Bitte klicken Sie hier</a> um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/53939fig5large.jpg" target="_blank">eine größere Version zu sehen dieser Figur.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> #SampleID </td><td colspan="2"> Strichcode <br/&gt; Sequence </td><td colspan="3"> LinkerPrimer Sequenz </td><td> rcbcPrimer </td><td> SampleType </td><td> Extraktion Stapel </td><td> Verstärkung Teller </td><td> Beschreibung </td></tr><tr><td> #an Beispiel Mapping-Datei finden Sie unter: http://qiime.org/_static/Examples/File_ Formate / Beispiel_ Kartierung_ file.txt </td><td colspan="2"></td><td colspan="3"></td><td></td><td></td><td></td><td></td><td></td></tr><tr><td> AG2350 </td><td colspan="2"> TCCCTTGTCTCC </td><td colspan="3"> CCGGACTACHVGGGTWTCTAAT </td><td> rcbc000 </td><td> zervikal Tupfer </td><td> 1 </td><td> EIN </td><td></td></tr></tbody></table> Tabelle 1. Mapping Dateivorlage. Creating eine genaue und gründliche Mapping-Datei für die erfolgreiche kritisch das Protokoll ausführt. Die Mapping - Datei ist nicht nur für die Ausführung von QIIME erforderlich, aber es ermöglicht auch die Forscher den Zusammenhang zwischen der Probe Barcode und Metadaten zu halten, um die Daten für alle systematischer Fehler (zB Batch-to-Batch - Variation) zu analysieren und zu bestimmen , interessante Korrelationen zwischen den Metadaten und Bakterienpopulationen. Eine nackte Knochen-Mapping-Datei zur Verfügung gestellt, aber die Benutzer werden ermutigt, so viele Spalten wie möglich mit Metadaten hinzuzufügen. Beispiele für zusätzliche Metadaten für ein vaginaler Abstrich umfasst das Alter der Teilnehmer, Datum / Uhrzeit der Abstrichentnahme, Art hormonalen Kontrazeptivums (falls zutreffend), sexuell übertragene Infektion Testergebnisse, usw. <img alt="suppliment 1" src="/files/ftp_upload/53939/53939suppliment.jpg" /> Supplemental - Datei 1. Liste der Barcodierte Reverse Primer Sequenzen 10 </sup&gt;. Die ersten drei Spalten können verwendet werden , um die Mapping - Datei abgeschlossen ist , und die letzte Spalte stellt die gesamte Primer - Sequenz Zwecken für die Bestellung. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/Supplemental_Code_File.xlsx" target="_blank">Bitte hier klicken</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53939/Supplemental_Code_File.xlsx" target="_blank">diese Datei herunterzuladen.</a>

Watch this Scientific Journal Video about Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization at JoVE.com

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

Wir beschreiben eine effiziente, robuste und kosteneffektive Methode zur Nukleinsäure von Tupfern zur Charakterisierung von Bakteriengemeinschaften Extraktion unter Verwendung von 16S rRNA-Gen-Amplikons Sequenzierung. Das Verfahren ermöglicht eine gemeinsame Verarbeitungsansatz für mehrere Probenarten und beherbergt eine Reihe von nachgelagerten analytischen Prozessen.

Effiziente Nukleinsäure-Extraktion und 16S rRNA Gen-Sequenzierung für bakterielle Gemeinschaft Charakterisierung

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

efficient-nucleic-acid-extraction-16s-rrna-gene-sequencing-for

Research

JoVE Journal

Biology

38.2K Aufrufe.  Massachusetts General Hospital.  Wir beschreiben eine effiziente, robuste und kosteneffektive Methode zur Nukleinsäure von Tupfern zur Charakterisierung von Bakteriengemeinschaften Extraktion unter Verwendung von 16S rRNA-Gen-Amplikons Sequenzierung. Das Verfahren ermöglicht eine gemeinsame Verarbeitungsansatz für mehrere Probenarten und beherbergt eine Reihe von nachgelagerten analytischen Prozessen. 

Serie: Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

Bacterial Gene Expression Analysis Using Microarrays

Bakterielle Gene Expression Analysis Using Microarrays

Forschung

Biologie

Electricity-Free, Sequential Nucleic Acid and Protein Isolation

Traditional and emerging pathogens such as Enterohemorrhagic Escherichia coli (EHEC), Yersinia pestis, or prion-based diseases are of significant concern for governments, industries and medical professionals worldwide. For example, EHECs, combined with Shigella, are responsible for the deaths of approximately 325,000 children each year and are particularly prevalent in the developing world where laboratory-based identification, common in the United States, is unavailable 1. The development and distribution of low cost, field-based, point-of-care tools to aid in the rapid identification and/or diagnosis of pathogens or disease markers could dramatically alter disease progression and patient prognosis. We have developed a tool to isolate nucleic acids and proteins from a sample by solid-phase extraction (SPE) without electricity or associated laboratory equipment 2. The isolated macromolecules can be used for diagnosis either in a forward lab or using field-based point-of-care platforms. Importantly, this method provides for the direct comparison of nucleic acid and protein data from an un-split sample, offering a confidence through corroboration of genomic and proteomic analysis.
Our isolation tool utilizes the industry standard for solid-phase nucleic acid isolation, the BOOM technology, which isolates nucleic acids from a chaotropic salt solution, usually guanidine isothiocyanate, through binding to silica-based particles or filters 3. CUBRC's proprietary solid-phase extraction chemistry is used to purify protein from chaotropic salt solutions, in this case, from the waste or flow-thru following nucleic acid isolation4.
By packaging well-characterized chemistries into a small, inexpensive and simple platform, we have generated a portable system for nucleic acid and protein extraction that can be performed under a variety of conditions. The isolated nucleic acids are stable and can be transported to a position where power is available for PCR amplification while the protein content can immediately be analyzed by hand held or other immunological-based assays. The rapid identification of disease markers in the field could significantly alter the patient's outcome by directing the proper course of treatment at an earlier stage of disease progression. The tool and method described are suitable for use with virtually any infectious agent and offer the user the redundancy of multi-macromolecule type analyses while simultaneously reducing their logistical burden.

A tool and chemistries are described to sequentially isolate nucleic acids followed by proteins from a sample without the need for electricity. The tool consists of a sorbent held within a transfer pipette while the isolation chemistries are based on solid-phase extraction principles. The isolated macromolecules can be analyzed by immuno-based and PCR-based assays.

Strom-Free, Sequential Nukleinsäure-und Protein Isolation

Traditional and emerging pathogens such as Enterohemorrhagic Escherichia coli (EHEC), Yersinia pestis, or prion-based diseases are of significant concern ...

Analyzing and Building Nucleic Acid Structures with 3DNA

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures. Protocol 1 lists the set of instructions needed to download and install the software. This is followed, in Protocol 2, by the analysis of a nucleic acid structure, including the assignment of base pairs and the determination of rigid-body parameters that describe the structure and, in Protocol 3, by a description of the reconstruction of an atomic model of a structure from its rigid-body parameters. The most recent version of 3DNA, version 2.1, has new features for the analysis and manipulation of ensembles of structures, such as those deduced from nuclear magnetic resonance (NMR) measurements and molecular dynamic (MD) simulations; these features are presented in Protocols 4 and 5. In addition to the 3DNA stand-alone software package, the w3DNA web server, located at <a href="http://w3dna.rutgers.edu" target="_blank">http://w3dna.rutgers.edu</a>, provides a user-friendly interface to selected features of the software. Protocol 6 demonstrates a novel feature of the site for building models of long DNA molecules decorated with bound proteins at user-specified locations.

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures.

Analysieren und Bauen Nukleinsäurestrukturen mit 3DNA

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

Next-Generation-Sequenzierung der ribosomalen 16S-RNA Gene Amplikons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

Hoch effiziente Ligation kleine RNA-Moleküle für MicroRNA Quantifizierung von Hochdurchsatz-Sequenzierung

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays.
We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method&#160;applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout.
Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

Einfache Massen Auslesen des digitalen Nukleinsäure Quantifizierung Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are ...

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations.

We describe a targeted RNA sequencing-based method that includes preparation of indexed cDNA libraries, hybridization and capture with custom probes and data analysis to interrogate selected transcripts for gene expression, mutations, and gene fusions. Targeted RNAseq permits cost-effective, rapid evaluation of selected transcripts on a desktop sequencer.

RNA-Sequenzierung Assay Gezieltes Genexpression und Genomic Änderungen an Charakterisieren

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Filtration Isolierung von Nukleinsäuren: Eine einfache und schnelle DNA-Extraktionsmethode

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

Geführte Protokoll für fäkale mikrobielle Charakterisierung von 16 s rRNA-Amplifikate Sequenzierung

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Tick Microbiome Charakterisierung von Next-Generation-16 s rRNA Amplikons Sequenzierung

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...