Diese Studie wurde unterstützt durch einen Zuschuss (2013R1A1A3005669) von der National Research Foundation Korea und einem Zuschuss (HI13C0016) des koreanischen Health Technology R &amp; D Project, Ministerium für Gesundheit und Wohlfahrt unterstützt.

1. Probe Vorbereitung <ol><li> PCR-Amplifikation der Sonde <ol><li> Für die P. gingivalis-spezifischen Sonde, verstärken eine 343-bp-DNA-Fragment von P. gingivalis 16S rRNA durch PCR unter Verwendung der genomischen DNA von P. gingivalis und der folgenden Primer: 5&#39;TGC AAC TTG CCT TAC AGA GG-3 &#39;und 5&#39;-ACT CGT ATC GCC CGT TAT TC-3&#39; 10. Zuführen Amplifikationen mit den folgenden Zyklusbedingungen: 35 Zyklen bei 95 ° C für 30 sec, 60 ° C für 30 sec, und 72 ° C für 1 min 20 sec, gefolgt von einer 5-minütigen Verlängerung bei 72 ° C 10,11. </li><li> Verstärken die eubakteriellen Sonde mit Hilfe eines 70-bp-DNA-Fragment (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG TCCCGCAACGAGCGCAACCC-3 &#39;) synthetisiert werden, wie einem Oligonukleotid und der folgenden Primer: 5&#39;-CAG CTG GTR CMT GGY-3&#39; und 5&#39;-AGG GTT GCG CTC GTT-3 &#39;11. Führen Amplifikationen mit den folgenden Zyklusbedingungen: 40 Zyklen9 4 ° C für 30 sec, 60 ° C für 30 sec und 72 ° C für 1 min 20 s, gefolgt von einer 5-minütigen Verlängerung bei 72 ° C 11,12. </li><li> Ausfällen der PCR-Produkte (≥500 ul) durch Zugabe von 3 M Natriumacetat (pH 5,2) und 100% Ethanol (in einer 10: 1: 2-Verhältnis) und Inkubation bei -20 ° C für 2 Std. </li><li> Zentrifuge das Gemisch bei 14.000 × g für 15 min, das Pellet in 100 ul TE-Puffer und Messung der DNA-Konzentration durch optische Dichte bei 260 nm. </li></ol></li><li> DIG-Markierung mit einem DIG DNA-Markierung und Nachweis-Kit <ol><li> Mix 3 ug der Sonde mit Wasser auf ein Endvolumen von 15 ul. </li><li> Denaturieren der DNA bei 95ºC für 10 min und schnell auf Eis kühlen. </li><li> Add 2 ul 10fach Hexanukleotid-Mix, 2 &amp; mgr; l dNTP-Markierungsmischung und 1 ul Klenow-Enzym zu 15 &amp; mgr; l des denaturierten DNA. </li><li> Mischen und bei 37 ° C für 24 h bis 48 h und Stop-Reaktion durch Erhitzen auf 65 ° C. </li></ol></li><li> Überprüfen Sie die Empfindlichkeit der DIG-markierten Sonde mit einem DIG DNA-Markierung und Nachweis-Kit <ol><li> Manuell laden 1 ul Verdünnungsreihen der positive Kontrollsonde im Kit enthalten und 1 ng der DIG-markierten Sonde auf der Nylonmembran und trocken für 5 min bei RT. </li><li> Kurz einwirken die Membran in 2 × SSC-Puffer (0,3 M NaCl, 30 mM Natriumcitrat, pH 7,0) und Inkubieren der Membran bei 80 ° C für 1 Stunde, um die DNA zu immobilisieren. </li><li> Kurz einwirken der Membran in Maleinsäurepuffer (MAB, 0,1 M Maleinsäure, 0,15 M NaCl, pH 7,5) und Inkubieren mit Anti-DIG-Alkalische Phosphatase (AP) konjugiertem Antikörper verdünnt (1: 5000) in 6 ml Blockierungslösung bereitgestellt im Kit bei RT für 30 min. </li><li> Waschen der Membran mit MABT (MAB, das 1% Tween 20) und wendet wurden 40 ul der NBT / BCIP-Lösung mit 2 ml Nachweispuffer (0,1 M Tris-HCl, 0,1 M NaCl, 0,05 M MgCl 2, pH 9,5) auf das gemischt- Membran für 1 min. Wenn die Empfindlichkeit der markierten Sonde istnicht zufriedenstellend, wiederholen Sie die Schritte von 1.1.3 bis 1.3.4. </li><li> Messung der DNA-Konzentration der markierten Sonde (OD260) Die Konzentration ist anzupassen, um 100 ng &amp; mgr; l -1. </li></ol></li><li> Überprüfen Sie die Spezifität der DIG-markierten Sonde <ol><li> Denaturieren genomischer DNA-Proben (25 ng 3 ul -1 pro jeder Probe) aus verschiedenen Bakterienspezies, einschließlich des Bakteriums von der spezifischen Sonde ausgerichtet, bei 95 ° C für 10 min und schnell auf Eis kühlen. </li><li> Die denaturierte DNA auf der Nylonmembran und trocken manuell laden für 20 min bei RT. </li><li> Kurz einwirken die Membran in 2 × SSC-Puffer und Inkubation der Membran bei 80 ° C für 2 Stunden, um die DNA zu immobilisieren. </li><li> Blockieren der Membran mit einer Blockierungslösung bei Raumtemperatur für 1 Std. </li><li> Verdünnen Sie die Sonde bei 1 ng ul -1 in Hybridisierungspuffer, Denaturierung der verdünnten Proben, und wenden auf die Membran. </li><li> Inkubieren der Membran bei 45 ° C für 1 Stunde. </li><li> Waschen Sie die Membran dreiMal mit 2x SSC-Puffer. </li><li> Kurz einweichen die Membran in MAB. </li><li> Inkubieren mit Anti-DIG-AP-konjugierten Antikörper, verdünnt (1: 2000) in 6 ml Blockierungslösung bei Raumtemperatur 1 Stunde. </li><li> Waschen der Membran mit MABT und anzuwenden 40 ul der NBT / BCIP-Lösung mit 2 ml Nachweispuffer gemischt. </li><li> Wenn die Sonde nicht die erhoffte Spezifität erhöhen die Hybridisierungstemperatur, bis der Spezifität beobachtet. </li></ol></li></ol> 2. In situ-Hybridisierung Hinweis: Um die Trocknung der Proben und Reagenzien zu vermeiden, führen alle Inkubationen in einer befeuchteten Kammer mit feuchten Papiertüchern ausgekleidet. <ol><li> De-paraffinization und Rehydrierung der Gewebeschnitte <ol><li> Bereiten Sie 4 um dicke Gewebeschnitte von in Paraffin eingebetteten Blöcken. Formalin, Paraformaldehyd und Zinkbasis Fixiermittel sind mit diesem Protokoll kompatibel. </li><li> Bereiten Sie alle Reagenzien mit DEPC-behandeltem Wasser. </li><li> Wärmeträger in einem Trockenofen bei 60 ° C für 30 min inkubieren Folien bei Raumtemperatur 30 min. </li><li> Einzutauchen gleitet in 100% Xylol für 5 min dreimal; frisches Xylol jedes Mal. Hinweis: Führen Sie diese Entparaffinierung Verfahren in einem Chemieabzug benutzen. </li><li> Einzutauchen gleitet in 100% Ethanol für 5 min zweimal mit frischem Ethanol gewaschen und rehydrieren Proben in serielle 90%, 80% und 70% Ethanol-Lösungen für jeweils 5 Minuten. </li><li> Einzutauchen Folien in DEPC-behandeltem Wasser für 1 min und waschen Folien in mit DEPC behandeltem PBS (pH 7,4) für 6 min. </li></ol></li><li> Vorbehandlungen von Gewebeschnitten <ol><li> Einzutauchen Folien in 0,1 N Salzsäure für 20 Minuten und Waschen Folien in DEPC-behandeltem Wasser für 30 sec. </li><li> Zeichnen Sie eine hydrophobe Barriere rund um Proben mit einem Wachsstift. Hinweis: Die Größe der hydrophoben Barriere hängt von der Größe der Proben. Daher variieren die Mengen der Reagenzien in den folgenden Schritten verwendet wird, auf die Größe der Proben abhängig, sondern den hy füllenphobe Barriere (50 ul für kleine Proben und 400 &amp; mgr; l für große Proben). </li><li> Behandlung von Proben mit 50 bis 400 &amp; mgr; l Proteinase K (1-10 ug ml-1 in mit DEPC behandeltem PBS) in einem Trockenofen bei 37 ° C für 30 Minuten und Waschen Folien in DEPC-behandeltem 1x PBS für 1 min. </li><li> Einweichen gleitet in 4% Paraformaldehyd in DEPC behandeltem PBS für 10 min, dann waschen Folien in mit DEPC behandeltem PBS für 1 min. </li><li> Einweichen Folien in 0,1 M Triethanolamin-HCl (pH 8,0), enthaltend 0,5% Essigsäureanhydrid für 20 Minuten und Waschen Folien in DEPC-behandeltem Wasser für 30 sec. </li></ol></li><li> Die Hybridisierung mit Sonde und Waschen <ol><li> Einzutauchen Folien in 2 × SSC-Puffer für 20 min. </li><li> Verdünne die Sonde bei 1 ng &amp; mgr; l -1 in Hybridisierungspuffer (4 × SSC, 50% [Vol / Vol] Formamid, 1x Denhardt-Lösung, 10% [w / v] Dextransulfat, 0,1% [Gew / Vol] Natriumdodecylsulfat, 0,4 mg ml -1 Lachssperma-DNA). Für Negativkontrollen, mischen Sie die markierte Sonde mitein 10-facher Überschuß von nicht-markierten Sonde. </li><li> Denaturierung der verdünnten Proben und gelten 50 bis 400 &amp; mgr; l auf Gewebeschnitten. Legen Sie ein Deckglas auf den Objektträger und Dichtung mit Nagellack. </li><li> Wärmeträger in PCR-Maschine bei 90 ° C für 10 min inkubieren Objektträger in einer Feuchtkammer O / N bei 45 ° C oder optimale Temperatur beim Schritt 1.4.11 bestimmt. </li><li> Kühlen Sie die Objektträger bei 4 ° C für 30 Minuten, entfernen Sie Deckgläser und Objektträger eintauchen in eine serielle SSC-Puffer als Followings: 4x SSC für 10 Minuten, vorgewärmten (45 ° C) 2 × SSC für 20 Minuten, 2x SSC für 10 min und 0,2 × SSC für 10 min. </li></ol></li><li> Detektion mit anti-DIG AP-konjugierten Antikörper <ol><li> Waschen Folien MABT für 5 min. </li><li> Block mit 50 bis 400 &amp; mgr; l Blockierlösung mit 1% Tween 20 für 20 min. </li><li> Hinzuzufügen 50-400 ul anti-DIG-AP-Antikörper in Blockierungslösung (1: 1.000) verdünnt anld bei 37 ° C für 90 min. </li><li> Waschen Folien MABT für 10 min. </li> &lt;li&gt; Tauchen Folien in Detektionspuffer, der 1% Tween 20 für 5 min. </li><li> Behandlung mit 50 bis 400 μ von 1 mM Levamisol (in Nachweispuffer, der 1% Tween 20) für 5 min auf endogene alkalische Phosphatase zu inaktivieren. </li><li> Verteilen von 50 bis 400 ul der vorgemischten NBT / BCIP-Lösung (in Detektionspuffer auf 1: 100 verdünnt) auf jeder Probe und inkubiere Folien in einer befeuchteten Kammer bei Raumtemperatur für 2 bis 3 h, bis das entwickelte Signal zufriedenstellend. </li><li> Spülen Sie Dias mit entionisiertem Wasser bis zur Visualisierung an und ziehen Sie 50 bis 400 &amp; mgr; l von 0,05% [w / v] methyl grün als Gegenfärbung bei 37 ° C für 10 min. </li><li> Spülen Sie Dias mit entionisiertem Wasser, entwässern in 100% Ethanol, und tauchen in Xylol. </li><li> Übernehmen 80 ul Befestigungslösung auf jedem Objektträger geben und mit Deckgläschen. </li></ol></li></ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

Die Autoren haben nichts zu offenbaren.

Hier ein Protokoll, um Bakterien in Paraffin eingebetteten Gewebe unter Verwendung eines DIG-markierte DNA-Sonde wurde beschrieben zu lokalisieren. Die Sonde selektiv DNA oder RNA-Moleküle von bakteriellen 16S-rRNA-Gens und des 16S-rRNA-Targeting-Sonden können entweder als artspezifische oder Universal ausgebildet sein. Die spezifische Hybridisierung des P. gingivalis-spezifischen Sonde an P. gingivalis, aber nicht auf andere orale Bakterien wurde bereits gezeigt worden 10. Im Gegensatz dazu die eubakteriellen Sonde an allen getesteten bakteriellen genomischen DNA (17 verschiedene Arten) hybridisiert, wobei die Hybridisierungseffizienz variierte 12. Die Zahl der T-Nukleotide, die in der Probe ermittelt, die Effizienz der DIG-Markierung. Herstellung einer DIG-markierten Sonde mit hoher Sensitivität ist der kritischste Schritt für die erfolgreiche Durchführung des beschriebenen Protokolls. Behandlung der Proben mit Salzsäure verbessert das Signal-Rausch-Verhältnis durch die Extraktion von Proteinen und partielle hydrolysis von Zielsequenzen. Eine Erhöhung der Konzentration von Proteinase K erhöht Ziel Zugänglichkeit der Sonden reduziert aber Gewebeerhaltung. Daher wird empfohlen, mehrere Konzentrationen von Proteinase K zu testen, abhängig von den Arten von Gewebe. Der Acetylierungsschritt abnimmt Hintergrund Bindung der negativ geladenen Elektrode an die Proteine ​​des Gewebes durch die Acetylierung der positiv geladenen Aminogruppen. Nach einer Reihe von dieser Vorbereitungsschritte, reißen die Gewebeschnitte leicht somit mit Vorsicht behandelt werden. Hintergrund ist minimal im Vergleich mit Fisch. Jedoch sollten die Signale von Geweben mit hoher endogene alkalische Phosphatase-Aktivität, wie Knochen und Schleimdrüsen kritisch interpretiert werden. PCR-amplifizierte DNA-Sonden sind einfach herzustellen und stabil im Vergleich zu RNA-Sonden. Der immunhistochemische Nachweis der hybridisierten Sonden erlaubt die Identifizierung von histologischen Strukturen durch Vergleich mit H &amp; E-gefärbten Schnitten: Epithel,Bindegewebe, entzündlichen Infiltraten und Blutgefäße sind gut unterscheiden. Eine der Beschränkungen der beschriebenen Protokoll ist die Unfähigkeit, mehrere Sonden gleichzeitig anzuwenden. Zusätzlich ist der Ausschluss der Signale von bakteriellen Verunreinigungen auf der Oberfläche der Abschnitte begrenzt. Dieses Protokoll kann angepasst ist, andere bakterielle Transkripte in Gewebeabschnitten 16 zu erkennen. Darüber hinaus kann dieses Protokoll erweitert werden, um eine Doppelfärbung mit immunhistochemischen Nachweis eines Wirtszellmarker.

Bakterien spielen eine Rolle in der Ätiologie der verschiedenen oralen Erkrankungen wie Parodontitis, Pulpitis, Perikoronitis, Cellulitis und Osteomyelitis. Um die Rolle von Bakterien in der Pathogenese der Krankheit zu verstehen und um die Wirkung der Behandlung zu überwachen, ist die Lokalisierung von Bakterien innerhalb des Gewebes wichtig. Die Anwesenheit von Bakterien im Zahnfleischgewebe von Patienten mit Periodontitis wurde mit verschiedenen Methoden dargestellt, mit Elektronenmikroskopie 1,2, Immunhistochemie und Immunfluoreszenz unter Verwendung von Bakterien-spezifischen Antikörpern 3-7 und Fluoreszenz-in-situ-Hybridisierung (FISH) unter Verwendung eines Fluoreszenz-8 markierte Oligonukleotidsonde Targeting 16S-rRNA. Gleichwohl sind diese Verfahren nicht in großem Umfang aufgrund technischer Einschränkungen oder Schwierigkeiten eingesetzt. Verglichen mit den Antikörpern, sind Sonden Targeting 16S rRNA einfach herzustellen und zu erreichen Artspezifität. FISH hat sich als ein hervorragendes Werkzeug zur Visualisierung von bact seineria in ihrer natürlichen Umgebung, wie beispielsweise Plaque-Biofilm. Jedoch ist die Anwendung der FISH zur Gewebeproben aufgrund Autofluoreszenz der verschiedenen Gewebekomponenten beschränkt. Zum Beispiel die starke Autofluoreszenz von roten Blutkörperchen die oft den Einsatz von Fluoreszenz-Technologie entzündeten Geweben, wenn sie beinhalten Blutungen 9. Um Bakterien in den entzündeten Zahnfleischgewebe zu lokalisieren, damit eine in situ-Hybridisierungsverfahren unter Verwendung einer Digoxigenin (DIG) -markierten DNA-Sonde wurde entwickelt und erfolgreich angewendet 10,11. Hier wird ein detailliertes Protokoll für die Lokalisierung von Bakterien in Paraffin eingebettetem Gewebe unter Verwendung von P. gingivalis-spezifischen und universellen eubakteriellen Sonden wurde beschrieben. Es wird besonders auf die Standardisierung des Verfahrens so, dass ähnliche Ergebnisse in anderen Labors reproduziert werden konzentriert. Dieses Protokoll ermöglicht die Lokalisierung von Bakterien in ihrem Kontext und der histologischen results sind hoch reproduzierbar. Das beschriebene Protokoll kann verwendet werden, um Bakterien entweder in einer artspezifischen oder universell in verschiedenen Geweben zu lokalisieren. Die Universalsonde ist besonders nützlich, um Bakterien in polymicrobial Krankheiten zu detektieren und eine mögliche Rolle von Bakterien bei Krankheiten zu studieren, wo die Rolle von spezifischen Bakterien nicht bekannt ist.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Acetic anhydride</td>
			<td>Sigma</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>50% Dextran sulfate solution</td>
			<td>Millipore</td>
			<td>S4030</td>
			<td></td>
		</tr>
		<tr>
			<td>50X Denhardt&#8217;s solution</td>
			<td>Sigma</td>
			<td>D2532</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC</td>
			<td>Sigma</td>
			<td>P159220</td>
			<td></td>
		</tr>
		<tr>
			<td>DIG DNA labeling and detection kit</td>
			<td>Roche</td>
			<td>11 093 657 910</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma</td>
			<td>F9037</td>
			<td></td>
		</tr>
		<tr>
			<td>ImmEdge&#8482; Pen</td>
			<td>Dako</td>
			<td>H-400</td>
			<td></td>
		</tr>
		<tr>
			<td>Levamisole</td>
			<td>Vector</td>
			<td>SP-5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Sigma</td>
			<td>246964</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Sigma</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl green</td>
			<td>Sigma</td>
			<td>M6776</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P1648</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher</td>
			<td>SP15-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Salmon sperm DNA solution</td>
			<td>Invitrogen</td>
			<td>#15632-011</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma</td>
			<td>S9625</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>Duksan</td>
			<td>D1420</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate</td>
			<td>Amresco</td>
			<td>227</td>
			<td></td>
		</tr>
		<tr>
			<td>Triethanolamine-HCl</td>
			<td>Sigma</td>
			<td>90279</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Research organics</td>
			<td>3098T</td>
			<td></td>
		</tr>
	</tbody>
</table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

Figur 1 zeigt Dot-Blotting von DIG-markierten Sonden im Vergleich mit der positiven Kontrollsonde in dem Satz um ihre Empfindlichkeit zu bestimmen. Das 343 bp P. gingivalis -spezifischen Sonde ist 25-mal empfindlicher ist als die 70 bp eubakteriellen Sonde, Fig. 2 zeigt in-situ-Hybridisierung von Patienten mit chronischer Periodontitis zum Nachweis von P. erhalten Gingivagewebe gingivalis und Eubakterien. Die Bakterien Signale, in violett dargestellt, wurden im Rahmen des Epithels, der Lamina propria und Biofilm außerhalb des Gewebes befindet erkannt. Jedoch ist die Verteilung von P. gingivalis und Eubakterien im Zahnfleischgewebe war anders. Bei hoher Vergrößerung (1,000x), verschiedene Formen (coccus, Stange, spindelförmig, und behaart Form) von Bakterien sichtbar waren mit dem eubakteriellen Sonde, während nur stabförmigen Bakterien wurden von der P. erfasst gingivalis-spezifischen Sonde. Die dispergierten Formen bakterieller Signalewurden ebenfalls beobachtet. Hajishengallis et al. zeigten die wesentliche Rolle des kommensalen Bakterien in der Entwicklung von P. gingivalis induzierten experimentellen Parodontitis bei Mäusen 14. Die Anwendung von Dextransulfat-Natrium (DSS), ein tight junction (TJ) Brechender chemischen, auf Gingivaschleimhaut induzierte Parodontitis und Alveolarknochen Verlust bei Mäusen 13. Eubakteriellen Sonde erfolgreich erkannt Bakterien in den Zahnfleischgewebe vom DSS Gruppe, die nicht durch die P. nachgewiesen gingivalis-spezifischen Sonde (Abbildung 3). Eubakteriellen Sonde ist nützlich für die Untersuchung der potenziellen Beteiligung von Bakterien in anderen Krankheiten. Seit der Internationalen Agentur für Krebsforschung Helicobacter pylori als Grad I Karzinogen für Magenkrebs mit 15 bezeichnet, hat mögliche Beteiligung von Bakterien in der Entwicklung von anderen Krebsarten in großem Umfang untersucht. Wenn sections von Lungenbiopsien mit Plattenepithelkarzinomen diagnostiziert wurden in situ mit eubakteriellen Sonde hybridisierten, wurden die Bakterien sowohl innerhalb der Tumorzellen und bei den umliegenden Stromazellen nachgewiesen / Infiltrationszellen (Abbildung 4). In-situ-Hybridisierung unter Verwendung der eubakteriellen Sonde wurde ebenfalls angewendet erkunden Sie das Vorhandensein von Bakterien in den Läsionen der oralen Lichen ruber, einer entzündlichen Immunerkrankung mit unbekannter Ursache. Interessanterweise wurden bakterielle Signale nicht nur innerhalb der Epithelien, sondern auch in der Lamina propria, wo bandförmige Infiltration beobachtet wurde, festgestellt. Unter hoher Vergrßerung wurden die Bakteriensignale in den Zellkernen von vielen Zellen (5) detektiert. <img alt="Abbildung 1" src="/files/ftp_upload/52836/52836fig1.jpg" /> Abbildung 1. Sensitivity Test der DIG-markierten Sonden. Seriell verdünnte custom-markierten Sonden und eine positive control-Sonde mit dem Kit mitgeliefert wurden dot mit Anti-DIG-AP-konjugierten Antikörper geblottet. Nach Zugabe des Substrats, des Blots mit dem P. gingivalis-spezifischen Sonde wurde für 30 s entwickelt, während der Blot mit dem eubakteriellen Sonde wurde für 1 min entwickelt. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52836/52836fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/52836/52836fig2.jpg" /> Figur 2. Nachweis von Bakterien im Zahnfleischgewebe von Patienten mit chronischer Periodontitis erhalten wurde. Abschnitte der Zahnfleischproben von gesunden Stelle (A) und der erkrankten Stelle (B) eines Patienten mit Parodontitis wurden Hämatoxylin-Eosin unterworfen (H &amp; E) Färbung oder in situ-Hybridisierung mit entweder dem P. gingivalis-spezifischen Sonde oder die eubakteriellen Sonde. Negative Kontrollen wurden mit der Sonde mit 10-fachen Überschuß nicht-markierten Sonde gemischt hybridisiert. Der vergrößerte Bereich wird mit einem quadratischen Feld angezeigt. Vertreter positive Signale, in violett dargestellt, sind mit dünnen Pfeilen markiert. Dicken Pfeile zeigen Plaque Biofilm außerhalb des Gewebes. Die Plaque Biofilms an 1,000x Vergrößerung untersucht werden in Einsätzen gezeigt. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52836/52836fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/52836/52836fig3.jpg" /> Figur 3. Nachweis der oralen kommensalen Bakterien im Zahnfleischgewebe von Maus. Experimental Periodontitis wurde in BALB / c-Mäusen durch orale Beimpfung von P. induzierte gingivalis (Pg) oder Anwendung DSS auf Gingivaschleimhaut. Zahnfleischschnitten von Mäusen wurden in H &amp; E-Färbung oder in situ Hybridisierung mit entweder der zogen &lt;<html> em&gt; P. gingivalis-spezifischen Sonde oder die eubakteriellen Sonde. Vertreter positive Signale, in violett dargestellt, sind mit Pfeilen markiert. Original Vergrößerung x400. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52836/52836fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 4" src="/files/ftp_upload/52836/52836fig4.jpg" /> Abbildung 4. Nachweis von Bakterien im Krebs Läsion. Die Abschnitte der Lunge Biopsien von Patienten mit Plattenepithelkarzinom diagnostiziert wurden mit H &amp; E oder in situ entweder mit dem universellen eubakteriellen Sonde oder die Negativkontrolle Sonde hybridisiert gefärbt. Der vergrößerte Bereich wird mit einem quadratischen Feld angezeigt. Vertreter positive Signale, in violett dargestellt, sind mit Pfeilen markiert. Grenze der Tumorzellen werden mit gepunkteten Linien angedeutet.Arget = &quot;_ blank&quot;&gt; Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen. <img alt="Figur 5" src="/files/ftp_upload/52836/52836fig5.jpg" /> Abbildung 5. Nachweis von Bakterien in den Läsionen der oralen Lichen ruber. Die Abschnitte der Biopsie von Wangenschleimhaut als orale Lichen ruber diagnostiziert wurden mit H &amp; E oder in situ entweder mit dem universellen eubakteriellen Sonde oder die Negativkontrolle Sonde hybridisiert gefärbt. Die vergrößerte Bereiche sind mit einem quadratischen Feld angezeigt. Vertreter positive Signale, in violett dargestellt, sind mit Pfeilen markiert. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52836/52836fig5large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

In-situ-Nachweis von Bakterien in Paraffin eingebetteten Geweben Unter Verwendung eines Digoxin-markierte DNA-Sonde Targeting 16S rRNA

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

10.9K Aufrufe.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Serie: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

Kombination von Klebstoff-tape-basierten Sampling und Fluoreszenz In situ Hybridisierung zum schnellen Nachweis von Salmonellen On Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Forschung

Immunologie und Infektion

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Genotypische Inference von HIV-1 Tropismus mit Populations-basierte Sequenzierung von V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective.
The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is &tilde;1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection.
Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one specific application of ampliPHOX detection, any microarray incorporating biotinylated target can be labeled and detected in a similar manner. The microarray design and biotinylation of the target to be captured are the responsibility of the user. Once the biotinylated target has been captured on the array, ampliPHOX detection can be performed by first tagging the array with a streptavidin-label conjugate (ampliTAG). Upon light exposure using the ampliPHOX Reader instrument, polymerization of a monomer solution (ampliPHY) occurs only in regions containing ampliTAG-labeled targets. The polymer formed can be subsequently stained with a non-toxic solution to improve visual contrast, followed by imaging and analysis using a simple software package (ampliVIEW). The entire FluChip assay from un-extracted sample to result can be performed in about 6 hours, and the ampliPHOX detection steps described above can be completed in about 30 min.

ampliPHOX colorimetric detection technology is presented as an inexpensive alternative to fluorescence detection for microarrays. Based on photopolymerization, ampliPHOX produces solid polymer spots visible to the naked eye in just a few minutes. Results are then imaged and automatically interpreted with a simple yet powerful software package.

ampliPHOX kolorimetrischen Nachweis einer DNA Microarray für Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5  For instance, many examples of the ability to type and subtype influenza virus ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Multiplex Nachweis von Bakterien in komplexen Clinical and Environmental Proben mit Oligonukleotid-gekoppelten Fluoreszenz-Mikrosphären

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Nachweis von Bakterien mit fluorogenen DNAzyme

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes

Fluorescent in situ hybridization (FISH) is a technique routinely used by many laboratories to determine the chromosomal position of DNA and RNA probes. One important application of this method is the development of high-quality physical maps useful for improving the genome assemblies for various organisms. The natural banding pattern of polytene and mitotic chromosomes provides guidance for the precise ordering and orientation of the genomic supercontigs. Among the three mosquito genera, namely Anopheles, Aedes, and Culex, a well-established chromosome-based mapping technique has been developed only for Anopheles, whose members possess readable polytene chromosomes 1. As a result of genome mapping efforts, 88% of the An. gambiae genome has been placed to precise chromosome positions 2,3 . Two other mosquito genera, Aedes and Culex, have poorly polytenized chromosomes because of significant overrepresentation of transposable elements in their genomes 4, 5, 6. Only 31 and 9% of the genomic supercontings have been assigned without order or orientation to chromosomes of Ae. aegypti 7 and Cx. quinquefasciatus 8, respectively. Mitotic chromosome preparation for these two species had previously been limited to brain ganglia and cell lines. However, chromosome slides prepared from the brain ganglia of mosquitoes usually contain low numbers of metaphase plates 9. Also, although a FISH technique has been developed for mitotic chromosomes from a cell line of Ae. aegypti 10, the accumulation of multiple chromosomal rearrangements in cell line chromosomes 11 makes them useless for genome mapping. Here we describe a simple, robust technique for obtaining high-quality mitotic chromosome preparations from imaginal discs (IDs) of 4th instar larvae which can be used for all three genera of mosquitoes. A standard FISH protocol 12 is optimized for using BAC clones of genomic DNA as a probe on mitotic chromosomes of Ae. aegypti and Cx. quinquefasciatus, and for utilizing an intergenic spacer (IGS) region of ribosomal DNA (rDNA) as a probe on An. gambiae chromosomes. In addition to physical mapping, the developed technique can be applied to population cytogenetics and chromosome taxonomy/systematics of mosquitoes and other insect groups.

Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes

Among the three mosquito genera, namely Anopheles, Aedes, and Culex, physical genome mapping techniques were established only for Anopheles, whose members possess readable polytene chromosomes. For the genera of Aedes and Culex, however, cytogenetic mapping remains challenging because of the poor quality of polytene chromosomes. Here we present a universal protocol for obtaining high-quality preparations of mitotic chromosomes and an optimized FISH protocol for all three genera of mosquitoes.

Fluoreszierend<em&gt; In situ</em&gt; Hybridisierung auf mitotischen Chromosomen der Moskitos

Fluorescent in situ hybridization (FISH) is a technique routinely used by many laboratories to determine the chromosomal position of DNA and RNA probes. ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluoreszenz<em&gt; In situ</em&gt; Hybridisierungen (FISH) für die Lokalisierung von Viren und Bakterien in Endosymbiotic Pflanzen-und Insekten Gewebe

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

Schnelle Identifizierung von Gram-negativen Bakterien aus Blutkulturbrühe unter Verwendung von MALDI-TOF-Massenspektrometrie

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-&#945; (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler&#8217;s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the &#8216;Z&#8217; serial images.

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

The protocol to detect self-reactive CD4 T cells in brain and heart by direct staining with major histocompatibility complex class II dextramers has been described in this report. For comprehensive analysis, a reliable method to enumerate the frequencies of antigen-specific CD4+ T cells in situ is also devised.

In-situ-Nachweis autoreaktiver CD4-T-Zellen in Gehirn und Herz Mit Haupthistokompatibilitätskomplex Klasse II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

A Novel Microdissection Ansatz zur Wiederherstellung<em&gt; Mycobacterium tuberculosis</em&gt; Spezifische Transkripte aus Formalin fixierten und in Paraffin eingebetteten Lung Granulome

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...