ونود أن تكريم الراحل الدكتور بول ه باترسون لإسهاماته في تقدم نموذج MIA، والتوحد، والبحوث الفصام. ونحن نعترف سركيس ك Mazmanian على دعمه الكبير على هذا البروتوكول. روبن م بايون، وإيفيت غارسيا فلوريس، كارين جيم Lencioni، وليزلي نيومان A. للحصول على المساعدة الإدارية؛ علي Khoshnan ويان جيم كو للمساعدة على تصوير. إلين Y. هسياو وناتاليا Malkova للحصول على المشورة على MIA الاستقراء. جيفري كوكرين، خواكين جوتيريز، كوان واو لي، خايمي رودريجيز، لورينا جيم ساندوفال، وناتالي A. فيردوزكو لتربية الحيوانات الخبراء الخاصة بهم. وأيد هذا العمل من قبل جائزة المعاهد الوطنية للصحة كونتي مركز (NIH 5P50MH086383-04، إلى بول ه باترسون)؛ التوحد يتحدث (# 7670، إلى بول ه باترسون)؛ مؤسسة سيمونز (# 322839، سركيس ك Mazmanian)؛ المعاهد الوطنية للصحة تدريب جرانت (NIH / NRSA T32GM07616 لك-HC)؛ معهد كاليفورنيا للتكنولوجيا الصيفية الجامعية زمالة أبحاث (SURF) (لZY)؛ أمجين برنامج المنح الدراسية في معهد كاليفورنيا للتكنولوجيا (لZY)؛ والاب زمالة بعد الدكتوراةمجلس أوم الوطنية للعلوم، تايوان (NSC 101-2917-I-564-039، إلى دبليو-LW).

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA الحث على نوافذ زمنية مختلفة، يشوش الأحداث نمو المخ المختلفة في القوارض، وبالتالي يؤدي إلى تشوهات وneuropathologies سلوكية مختلفة في النسل. هنا، وصفنا بروتوكول للحث وزارة الداخلية في الفئران مع بولي (I: C) الحقن في E12.5. هذا الأسلوب من MIA تحريض يؤدي إلى السلوكية والعصبية، المناعية، وتشوهات في الجهاز الهضمي المرتبطة التوحد والفصام في النسل 8،10،11،16. من المهم أن نلاحظ أن، لأن وزارة الداخلية هو عامل المخاطر البيئية، ومن المتوقع أن يكون الاختلاف أعلى من الفئران من النماذج الوراثية من الاضطرابات العصبية النمائية النمط الظاهري من النسل. وهكذا، لتوليد بدقة وباستمرار التوحد والظواهر ذات الصلة انفصام الشخصية من خلال وزارة الداخلية، من المهم بصفة خاصة للحد من المتغيرات الإضافية التي قد يتغلب على النتائج. ينبغي اتباع جدول زمني موضح في البروتوكول قريبالاي. أن الصحيح نافذة الوقت حقن ضمان MIA يشوش تطوير ذرية الدماغ في المرحلة المطلوبة. تحريض MIA في E12.5 في الماوس يتوافق مع اضطرابات قرب نهاية الثلث الأول من الحمل البشري 21 - وهي الفترة التي يحدث تطور كبير في الدماغ، بما في ذلك تطوير الخلايا العصبية وputamen المذنبة، وتكوين الخلايا العصبية في طبقة قشرية. وستكون هناك حاجة مزيد من التحقيق لإثبات العلاقة بين فقدان الخلايا العصبية في المخيخ MIA واضطراب في وقت مبكر من نمو الدماغ. بينما العلاج متسقة، والفحص، وحتى تربية السدود شأنه أن يقلص من تأثير الإجهاد الأمهات على النمط الظاهري ذرية، بروتوكول لدينا لا يزال يحتوي على المحاذير أن الباحثين أن تكون على علم. على سبيل المثال، نحن أخص منزل السدود قبل يوم من حقن بولي (I: C) وخلال الفترة المتبقية من الحمل. استراتيجيتنا هي أن ترك الفئران الحوامل في undisturbeالبيئة د. ومع ذلك، يمكن لهذا العمل لحث على الاستجابة للضغط النفسي في البيئة الأمهات. على الرغم من أننا لا نعرف ما إذا كان هذا استجابة الإجهاد الناجم عن العزلة يتداخل مع تطوير النسل، وتأثير MIA يمكن ملاحظتها من خلال اتباع إجراءات لدينا. وبالإضافة إلى ذلك، يجب على سلالة وراثية خلفية الفئران التي سيتم اختيارها واختبارها بعناية لMIA الاستقراء. وحتى الآن، يتم نسخ تأثير MIA معظمها في البرية من نوع C57BL / 6N الفئران 8،10،13،16. وقد لاحظ آخرون أيضا تأثير MIA في BTBR الماوس سلالة 19. وقد تبين أن بولي (I: C) يمكن أن تثير استجابة مناعية مختلفة في فئران معدلة وراثيا 13،22-24، الذي قد يعرض آثار الخلط إضافية للذرية. من حيث عدد مكررات البيولوجية، ونحن نستخدم لا يقل عن 6 ليترات لكل مجموعة لفحوصات السلوكية أو الفسيولوجية و 3 ليترات لكل مجموعة للتعبير الجينات والبروتينات، أو المناعيةمناهج الكيمياء النسيجية. نحن اختبار جميع ذرية داخل القمامة بدلا من استخدام واحد أو اثنين من نسل داخل القمامة لتجنب التحيز التجريبية. نحن أيضا متوسط ​​البيانات لجميع ذرية في القمامة، واستخدام هذا المتوسط ​​كنقطة بيانات واحدة (مثل التي ن = عدد من الفضلات) لتجنب إحصاءات غير لائقة 13. يتم تجميع البيانات من كل جنس أيضا لأنه لا يوجد فرق واضح بين الجنسين وقد لوحظ في نموذج MIA 13. الأساس المنطقي وراء قياس MIA ذرية من حجم القمامة هو تقليل التفاوت الناجم عن التمريض الأمومة ورعاية. وقد تبين أن حجم القمامة لربط مع السلوكيات النمطية في C57BL / 6 الفئران 25. نحن نفترض أن هذا قد يكون راجعا إلى تخصيص الموارد أثناء تمريض الأمومة ورعاية. لتجنب هذا التأثير التباس، لدينا معيار المطلوب حجم القمامة هو 6-10 لC57BL / 6 الفئران. حتى عند اتباع البروتوكول بشكل وثيق، قد المجرب أونمواجهة استجابة مناعية ضعيفة بشكل مفرط أو قوية بشكل مفرط في الفئران الحوامل بعد بولي (I: C) الحقن. لتجنب هذا، فمن الضروري للتحقق من صحة النشاط بالبيروجينات وcytokinogenic من دفعات مختلفة من بولي (I: C). دفعات مختلفة والكثير من بولي (I: C) من نفس الشركة قد يؤدي إلى مستويات مختلفة من الاستجابة الالتهابية في الفئران. لافت للنظر، حقن جرعات مماثلة من بولي (I: C) من دفعات مختلفة يمكن أن يؤدي إلى ما يصل إلى 10 أضعاف الاختلافات في البلازما IL-6 مستويات 26. تحديد الجرعة ودفعة من بولي: يمكن (أنا C) لمزيد من تجربة وزارة الداخلية من قبل قراءات من النساء غير الحوامل IL-6 قياس يساعد على التقليل من الاختلاف اعتبارا من MIA الاستقراء. إذا كان من الضروري تعديل الجرعة لدفعات محددة من بولي (I: C)، فمن المهم أيضا لتعديل تركيز بولي (I: C) حل للحقن مثل أن حجم حقن يبقى ما يقرب من 5 ميكرولتر في كل غرام من وزن الماوس. على سبيل المثال، وفقا لمصنعونالإجراء acturer، وبولي (I: C) من المفترض تشكيلها في ~ 10 ملغ / مل من الماء لتسفر عن عديد النوكليوتيد في الفسيولوجي الفوسفات حل. مقارنة لدينا 40 ملغ حل / مل، سيكون التركيز أقل زيادة حجم الحقن بنسبة 4 أضعاف. بالنسبة للفئران الحوامل، كمية كبيرة من حقن عازلة من الممكن ان تزيد الضغط على الأجنة وإدخال غير مرغوب فيه وهو يفند تأثيرات على النسل. ولذلك، فإننا اختيار حل بولي (I: C) مسحوق في 0.09٪ كلوريد الصوديوم بتركيز نهائي العالي من أجل تقليص حجم الحقن. يتم اختيار IL-6 ليكون علامة من الاستجابة الالتهابية الحادة لبحث سابق قد حددت IL-6 إشارات باعتباره عاملا حاسما في التوسط آثار MIA على نمو الدماغ والسلوك. بعد بولي (I: C) معاملة، IL-6 هو خلوى الأكثر upregulated في دم الأم والمشيمة 10،12. الأهم من ذلك، سميث وآخرون. أظهرت أن العديدالسيتوكينات upregulated للغاية، فقط IL-6 عرضت على حد سواء ضرورة والاكتفاء لتحريض الدماغ المرتبطة MIA والانحرافات السلوكية. وهذا هو، حقن الأمهات المضادة للIL-6 يمكن منع الانحرافات السلوكية وtranscriptomic غير طبيعية في MIA ذرية على نحو فعال، في حين لم تحييد السيتوكينات الأخرى وليس 10. وعلاوة على ذلك، حقن الأمهات من IL-6 المؤتلف وحدها (دون بولي (I: C)) يستنسخ النسخي المرتبطة MIA والانحرافات السلوكية ينظر في دماغ الجنين وزارة الداخلية وذرية 12،15. بالمقارنة مع الطرق الأخرى للحث وزارة الداخلية (على سبيل المثال، lipopolysaccharide في (LPS) أو الإنفلونزا)، وبولي (I: C) هي آمنة نسبيا ويوفر وسيلة سهلة للسيطرة على شدة الاستجابة المناعية. على الرغم من أن الاستجابة الالتهابية التي تسببها بولي الأمهات (الأول: C) إدارة حادة وعابرة، وتأثيرها على سلوكيات الأبناء ونمو الدماغ هو عميق. عموما، بمجرد أن أسلوب حمل MIA ربولي hrough (الأول: C) ويتقن الحقن في E12.5، يمكن للمرء ثم المضي قدما لإجراء فحوصات مختلفة السلوكية والبيولوجية لدراسة تأثير هذا العامل المخاطر البيئية على ذرية. وفي الوقت نفسه، يمكن للمرء أيضا الجمع بين الأسلوب مع تعديلات وراثية أو غيرها من العلاجات قبل أو أثناء أو بعد الحمل للتحقيق في أسباب والنهج العلاجية الممكنة لمرض التوحد وانفصام الشخصية.

مفهوم التنشيط المناعي للأم (MIA) تنبع من الدراسات الوبائية على جمعية إصابة الأم بمرض التوحد وانفصام الشخصية 1. نظرا لعدم وجود مسببات الأمراض الفيروسية تكرار اكتشافها في المشيمة أو دماغ الجنين بعد عدوى فيروسية الأمهات 2،3، على فرضية تأثير الإصابة على ذرية أن يكون سبب تنشيط الجهاز المناعي للأم بدلا من مسببات الأمراض أنفسهم . لإلقاء الضوء على العلاقة بين السبب والنتيجة بين وزارة الداخلية والاضطرابات النفسية، حقن تصنيعه كيميائيا، الفيروسية تقليد ضعف polyinosinic الحمض النووي الريبي RNA: حمض polycytidylic (بولي (I: C)) في القوارض الحوامل قد استخدمت على نطاق واسع في نموذج حيواني لMIA 4،5. ومن المسلم: (C I) التي تشبه عدد مستقبلات 3 (TLR3)، والإدارة الشاملة للبولي (I: C) بولي يدفع الفيروسية مثل الاستجابة الالتهابية الحادة. واحدة من الآليات التي بولي (I: C) العلاقات العامةالعامة oduces تشوهات وneuropathologies السلوكية في النسل هي التي تسبب اختلالا السيتوكينات الالتهابية المؤيدة والمناهضة في محور الأم والمشيمة، الجنين 6. وقد تبنت عدة مجموعات نموذج MIA لفهم مسببات الاضطرابات النفسية 7، ويرجع ذلك إلى المصالح المتنوعة بين المجموعات البحثية، وقد استخدمت نقاط زمنية مختلفة من تنشيط جهاز المناعة لتحقيق اضطرابات مختلفة على نمو الدماغ والسلوكيات 7. المختبر بول ه باترسون في معهد كاليفورنيا للتكنولوجيا يتبنى استراتيجية حقن بولي (I: C) في الفئران الحوامل في الجنينية 12.5 يوما (E12.5)، الذي أثبت بنجاح أن وزارة الداخلية غير قادرة على إحداث السلوكية والعصبية، والتغيرات المناعية في النسل التي ترتبط مع مرض التوحد والفصام 8-11. تظهر أعمالنا السابقة التي MIA ذرية عرض الانحرافات السلوكية (على سبيل المثال، impairmen الاجتماعيةر، العجز الاتصالات، وتكرار السلوك، والسلوك للقلق مثل، والكامنة العجز تثبيط 8،10،12)، المناعي التقلبات والسيتوكينات الخلل 8،13،14، تغيير الجنين التعبير الجيني الدماغ 15، وفقدان الخلايا العصبية في فصيص السابع المخيخ 11، تغيير خصائص متشابك في قرن آمون 9، جين العاشر بيئة التفاعل 13، تغيير نفاذية الأمعاء، والقناة الهضمية تكوين الجراثيم 16. وعلاوة على ذلك، يتم تطوير استراتيجيات علاجية وقائية أيضا من هذا 13،16،17 نظام نموذجي. عن طريق حفز MIA في E12.5، وقد أظهرت آخرون أن MIA تنتج تنشيط الجنين دبقية والتغيير التنموي الكوليني في الدماغ الأمامي القاعدية 18، سلالة معينة التفاعل 19، الدماغ الشلل synaptosomal تشوهات التركيبية، والشلل الميتوكوندريا التنفسي abnormalties سلسلة فرط الوظيفة، downregulation من جزيئات synaptosomal الدماغية 17 ،السلوكيات الاكتئاب مثل، وضعف في الإدراك وقرن آمون التقوية على المدى الطويل (الكمونية)، والعجز من البالغين الخلايا العصبية الحصين 20. هنا، ونحن نقدم طريقة مفصلة لكيفية إحداث MIA في E12.5 التي كتبها بولي (I: C)، وكذلك نماذج لكيفية تطبيق هذا النموذج لدراسة مسببات مرض التوحد وانفصام الشخصية. ومن المهم الإشارة إلى أن وزارة الداخلية هو أحد عوامل الخطر لمجموعة متنوعة من الاضطرابات 4، ونتائجها حساسة للغاية للوقت وطريقة الاستقراء وكذلك تربية السدود الحوامل. على هذا النحو، حتى التناقضات الثانوية بين المختبرات في كثير من الأحيان يؤدي إلى استنساخ منخفض و / أو الظواهر المختلفة في النسل. تم تصميم طريقة لدينا خصيصا للراغبين في دراسة MIA كعامل خطورة البيئي لمرض التوحد وانفصام الشخصية، وصفا مفصلا تقديمها سوف يساعد الباحثين على تحسين استنساخ البيانات الخاصة بهم.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> حقن 20 ملغ / كغ بولي (I: C) في E12.5 يمكن أن تثير استجابة التهابية حادة في محور الأم والمشيمة والجنين ويعجل له تأثير المزمن لنمو الدماغ والظواهر السلوكية 12،13. مستويات مرتفعة من proinflammatory سايتوكاين، انترلوكين (IL) -6، هو مؤشر موثوق من الاستجابة الالتهابية الحادة بعد MIA. وقت الذروة للتعبير الجين Il6 في المشيمة ودماغ الجنين هو في 3 ساعات بعد بولي (I: C) حقن 12،13. لقد أثبتنا أن بولي (I: C) يدفع أعلى التعبير الجيني Il6 عبر الدماغ الأمهات الطحال-المشيمة-الجنين (الشكل 5) (بيانات مقتبسة من وو وآخرون، 2015). 13. باحثون يمكن الجمع بين هذا النموذج مع العلاج الأخرى لدراسة العوامل التي قد تغير استجابة حادة للالتهابات بعد MIA، على سبيل المثال، والوجبات الغذائية للأمهات، فئرانا معدلة وراثيا الوراثية، والعقاقير المضادة للالتهابات، وما إلى ذلك. <html> والأنف والحنجرة &quot;FO: المحافظة على together.within الصفحات =&quot; 1 &quot;&gt; من ناحية أخرى، والتغيرات السلوكية هي أيضا بصمات من طراز MIA يمكن إجراء العديد من الاختبارات السلوكية على الكبار ذرية MIA لإثبات مختلفة التوحد وانفصام الشخصية مثل. السلوكيات بشكل عام، بالمقارنة مع ذرية المالحة، MIA ذرية عرض أقل مداخل منطقة وسط وأقصر مدة منطقة مركز قضى في اختبار حقل مفتوح، كما أنها تكشف عن السلوكيات دفن أكثر تواترا في الرخام دفن اختبار وانخفاض مؤشر أسعار المنتجين (الشكل 6) (بيانات تكييفها من وو وآخرون، 2015) 13. فقدان الخلايا العصبية في المخيخ فصيص السابع هو السمة المميزة آخر من MIA ذرية (شي وآخرون، 2009). وعندما ملطخة الأجسام المضادة calbindin، هناك عدد أقل من الخلايا العصبية-calbindin إيجابي في المخيخ فصيص السابع من MIA ذرية مقارنة ذرية تحكم المالحة (الشكل 7). 3643 / 53643fig1.jpg &quot;/&gt; الشكل 1. علامة على الفئران الحوامل. منتصف الحمل الماوس يمكن تحديدها عن طريق انتفاخ في منطقة البطن لها (السهم). يستخدم الفطرية السلالة C57BL / 6 الماوس هنا كمثال. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig1large.jpg" target="_blank">يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/53643/53643fig2.jpg" /> الشكل تغيرات الوزن 2. الجسم في الحوامل الفئران C57BL / 6N من الجنينية (E) ،5-12،5 أيام. وعند مقارنة الفئران الحوامل وغير الحوامل مع المقابس المهبلية الحاضرة في E0.5، و (A) من وزن الجسم و (ب) النسبة المئوية من وزن الجسم يخضع زيادة كبيرة في E10.5 في الفئران الحوامل. حامل ن = 10، غير الحوامل ن = ترد 5. البيانات كما يعني ± سراج الدين. *** ع &lt;0.001، ****ف &lt;0.0001. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig2large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (3)" src="/files/ftp_upload/53643/53643fig3.jpg" /> الشكل 3. قياس الامتصاصية من بولي (I: C). الحل تأكد من نسبة 260/280 ما بين 1،54-1،82 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig3large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (4)" src="/files/ftp_upload/53643/53643fig4.jpg" /> الشكل 4. بولي (I: C) الحقن في الجنينية (E) 12.5 أيام القفا الماوس حاملا بلطف. يقع موقع الحقن في منتصف الحلمات العليا. حقن الإبرة، شطبة تصل، في حوالي 20 درجة زاوية بالنسبة للماوس. الفطرية C5يستخدم 7BL / 6 سلالة الماوس هنا كمثال. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig4large.jpg" target="_blank">يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الرقم 5" src="/files/ftp_upload/53643/53643fig5.jpg" /> الرقم 5. بولي (I: C) حقن يزيد من التعبير الجيني Il6 في محور الدماغ الطحال المشيمة والجنين السد يتم عرض البيانات كما يعني ± SEM. * ف &lt;0.05، ** ف &lt;0.01 (البيانات هي في الأصل من وو وآخرون، 2015 والمعدلة للمادة 13). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig5large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (6)" src="/files/ftp_upload/53643/53643fig6.jpg" /> الشكل (6). &amp; #160؛ MIA ذرية الكبار تظهر الانحرافات السلوكية المرتبطة endophenotypes التوحد وانفصام الشخصية في اختبار حقل مفتوح، MIA ذرية (A) دخول منطقة وسط أقل كثيرا و (ب) قضاء وقت أقل في منطقة الوسط. (C) في اختبار دفن الرخام، MIA ذرية دفن المزيد من الرخام من ذرية السيطرة المالحة. MIA ذرية تظهر تثبيط prepulse (PPI) العجز في (D) prepulse 5 ديسيبل و (E) prepulse 15 ديسيبل. يعني ± SEM. * ف &lt;0.05، ** ف &lt;0.01 (البيانات هي في الأصل من وو وآخرون، 2015 والمعدلة للمادة 13). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig6large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الرقم 7" src="/files/ftp_upload/53643/53643fig7.jpg" /> الرقم 7. MIA ذرية الكبار تظهر تشوهات عصبية مرضية المرتبطة endophenotypes من مرض التوحد. فقدان الخلايا العصبية في فصيص وقد تبين السابع في MIA ذرية الكبار. السهم: خلايا Calbindin + العصبية. ML: طبقة الجزيئية، GCL: طبقة الخلايا الحبيبية، PCL: طبقة الخلايا العصبية <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53643/53643fig7large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a>

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

تحريض الأم المناعي التنشيط في الفئران في مرحلة منتصف الحمل مع الفيروسية تقليد بولي (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.2K Views.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Video: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

نموذج الفأر من في الرحم زراعة

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

Medicine

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

تقييم الأم الأوعية الدموية إعادة عرض أثناء الحمل في الرحم ماوس

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Developmental Biology

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

استخدام<em&gt; في الجسم الحي</em&gt; التصوير لرصد تطور التجريبية ماوس عدوى الفيروس المضخم للخلايا في حديثي الولادة

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

تشريح الفطري اشارة المناعة في التهرب الفيروسية من الإنتاج خلوى

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

الماوس في الجسم الحي المشيمة المستهدفة كريسبر التلاعب

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genetics

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

عزل الكريات البيض من أنسجة الفئران في واجهة الأم والجنين

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

Intracerebroventricular وداخل الأوعية الدموية حقن الفيروسية الجسيمات ونيون ميكروبيدات في الدماغ حديثي الولادة

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Neuroscience

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus GBS

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

نموذج مورين للتعرض الجنين لالتهاب الأم لدراسة آثار التهاب المشيمة الحاد على نمو الأمعاء حديثي الولادة

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring

Maternal immune activation (MIA) during pregnancy is consistently linked to increased risk of neurodevelopmental and neuropsychiatric disorders in offspring. Animal models of MIA are used to test causality, investigate mechanisms, and develop diagnostics and treatments for these disorders. Despite their widespread use, many MIA models suffer from a lack of reproducibility and almost all ignore two important aspects of this risk factor: (i) many offspring are resilient to MIA, and (ii) susceptible offspring can exhibit distinct combinations of phenotypes. To increase reproducibility and model both susceptibility and resilience to MIA, the baseline immunoreactivity (BIR) of female mice before pregnancy is used to predict which pregnancies will result in either resilient offspring or offspring with defined behavioral and molecular abnormalities after exposure to MIA. Here, a detailed method of inducing MIA via intraperitoneal (i.p.) injection of the double stranded RNA (dsRNA) viral mimic poly(I:C) at 12.5 days of gestation is provided. This method induces an acute inflammatory response in the dam, which results in perturbations in brain development in mice that map onto similarly impacted domains in human psychiatric and neurodevelopmental disorders (NDDs).

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using PolyI:C to Study Susceptibility and Resilience in Offspring

Maternal infection is a risk factor for neurodevelopmental disorders. Mouse models of maternal immune activation (MIA) may elucidate infection's impact on brain development and function. Here, general guidelines and a procedure are provided to produce reliably resilient and susceptible offspring exposed to MIA.

تحريض الأم المناعي التنشيط في الفئران في مرحلة منتصف الحمل مع الفيروسية تقليد بولي (I: C)

Summary

Explore More Videos

Chapters in this video