We thank Mariko L. Bennett, Liana Nicole Bonanno, and Spyros Darmanis for their help during the development of this protocol. We also thank the Stanford Shared FACS Facility, particularly Meredith Weglarz and Lisa Nichols; Yen Tran, Michael Eckart from Stanford Protein and Nucleic Acid Facility (PAN) for their great support for the filming. This work is funded by the JPB Foundation and Vincent J. Coates Foundation.

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.
NOTE: All solution and buffer compositions are provided in Table of Materials.
1. Preparation on the Day of Cell Isolation
<ol>
	<li>Prepare the following reagents and chill them on ice: medium A (50 mL), magnetic-activated cell sorting (MCS) buffer (30 mL), FACS buffer (25 mL), phosphate-buffered saline (PBS; 30 mL), DNase (320 &#181;L), and RNase inhibitor (30 &#181;L). 
	NOTE: The volumes provided here are sufficient to isolate microglia from 4 brain regions (e.g., cortex, cerebellum, hippocampus and striatum) of a single mouse brain hemisphere. Scale up if more tissues are used.</li>
	<li>Place four clean 2 mL Dounce homogenizers on ice and add 2 mL of medium A with 80 &#181;L of DNase (12,500 units/mL) and 5 &#181;L of RNase inhibitor into each Dounce homogenizer. Chill the pistons in 15 mL tubes.</li>
	<li>Label four 6 cm Petri dishes with brain regions for tissue collection and add 200 &#181;L of cold medium A into each dish on ice. Add about 5 mL of medium A into a 6 cm Petri dish for dissection. 
	NOTE: Prior to use, make sure all reagents are sterile and suitable for RNA applications. Bench and dissection tools need to be clean and sprayed with RNase decontamination solution (Table of Materials).</li>
</ol>
2. Brain Region Dissection
NOTE: This step should take ~30 min.
<ol>
	<li>Inject 400&#8722;500 &#181;L of ketamine/xylazine (24 mg/mL ketamine and 2.4 mg/mL xylazine) into the peritoneum of a juvenile to adult stage mouse (&#62;1 month old). 
	NOTE: A male mouse is used here for illustration, but either gender is suitable.</li>
	<li>Wait for 5 min and pinch a hind paw to ensure lack of retraction.</li>
	<li>Immediately use a 26 G x 3/8 needle to perform transcardial perfusion with 20&#8722;30 mL of ice-cold PBS until buffer runs out with no visible blood.</li>
	<li>Decapitate the mouse with a pair of surgical scissors. Use small scissors to cut open the skin to expose the underneath skull, and then cut through the sagittal suture, lambdoidal suture and coronal suture. Use forceps to pull off both sides of parietal bone and interparietal bone without damaging the tissue, and carefully move the brain into the dissection Petri dish with medium A.</li>
	<li>Use a pre-chilled blade to cut the brain through midline into two hemispheres. 
	NOTE: The four brain regions described here from a single hemisphere yield sufficient numbers of microglia for single-cell or bulk RNA-seq applications. The other hemisphere can be used for immunohistochemistry or RNA in situ validation.</li>
	<li>Separate the cerebellum from the cortical lobe and the brain stem with #55 forceps and transfer the tissue into a collection Petri dish.</li>
	<li>Use #55 forceps to carefully dissect out the hippocampus and the striatum from the cortex and transfer each tissue into a collection Petri dish.</li>
</ol>
3. Mechanical Tissue Dissociation
NOTE: Keep cells and reagents cool all the time except during staining steps. This step should take ~30 min.
<ol>
	<li>Chop each brain tissue with a razor blade into &#60;1 mm3 fine pieces.</li>
	<li>Use 1 mL pipette (with tips cut off) to transfer tissue pieces into the pre-chilled Dounce homogenizers, each containing 2 mL of medium A with DNase and RNase inhibitor.</li>
	<li>Homogenize the tissue by slowly twisting the piston in and out of the Dounce homogenizer for 6&#8722;10 full strokes, until no visible chunks are present. 
	NOTE: Douncing kills neurons and most other glial cells but leave microglial cells rather intact. Both insufficient and over-douncing can lead to low yield of cells.</li>
	<li>Transfer dissociated tissues into 50 mL tubes through 70 &#181;m strainers.</li>
	<li>Rinse each Dounce homogenizer and piston with a total of 6 mL of cold medium A and filter the rinsing solution through the same strainer into the corresponding tube.</li>
	<li>Transfer the single cell suspensions (about 8 mL each) into 15 mL conical tubes and centrifuge at 400 x g for 5 min at 4 &#176;C with brake = 5.</li>
</ol>
4. Myelin Removal
NOTE: This step should take ~60 min.
<ol>
	<li>Prepare 1 large depletion (LD) column (for cortex) and 3 large selection (LS) columns (for the other 3 regions) in a magnetic separator (Table of Materials). Rinse each column with 3 mL of MCS buffer.</li>
	<li>Once centrifugation is finished, pipette out and discard the supernatant without disturbing the pellet. For the cortex and cerebellum tissues, resuspend cells in 850 &#181;L of MCS buffer with 1.8 &#181;L of RNase inhibitor. For hippocampus and striatum tissues, resuspend cells in 400 &#181;L of MCS buffer with 0.9 &#181;L of RNase inhibitor. 
	NOTE: The columns (LD vs. LS) and the volume used for resuspension are optimized based on the amount of myelin present in the tissue. If other brain regions are assayed, these conditions may need to be adjusted depending on the size of the tissue and how much myelin may exist. Effectiveness of myelin removal can be estimated in step 4.9.</li>
	<li>Add 100 &#181;L of myelin removal beads each into cells from cortex and cerebellum and add 50 &#181;L of myelin removal beads each into cells from hippocampus and striatum.</li>
	<li>Gently mix the cells with beads and incubate the tubes on ice for 10 min.</li>
	<li>Bring the volume of the tube with cortical cells to 2 mL with MCS buffer, and all others to 1 mL (i.e., add 1 mL for cortical cells; 500 &#181;L for hippocampal and striatal cells; no need to add buffer to cerebellar cells).</li>
	<li>Once columns are empty of rinsing buffer, place a 15 mL tube below each column. Load cortical cells (2 mL) onto the LD column, and all others (1 mL each) onto the LS columns. Immediately use 1 mL of MCS buffer each to wash the original tubes and load the solution onto the corresponding columns.</li>
	<li>Wash the LD column once with 1 mL of MCS buffer and wash each LS column twice with 1 mL of MCS buffer each wash. Continue to collect the flow-through solution during washing.</li>
	<li>Filter cells into round bottom FACS tubes through 35 &#181;m strainer caps. 
	NOTE: Each tube should collect about 4 mL of single cell suspension depleted of myelin.</li>
	<li>Optionally, take 10 &#181;L of the cell suspension and mix it with 10 &#181;L of 0.4% trypan blue solution. Examine the cells under a 10x bright field microscope to estimate the yield, survival rate and the level of residual myelin. 
	NOTE: A successful preparation should generate over 90% live cells (round in shape and excluding the blue dye) with little to no myelin debris.</li>
	<li>Pellet cells in the FACS tubes at 400 x g for 5 min at 4 &#176;C, with brake = 5. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube with 300 &#181;L of FACS buffer. 
	NOTE: If MCS sorting is preferred, CD11b beads can be used to select microglia and other myeloid cells following myelin removal. These cells can then be used for non-plate-based scRNA-seq as well as bulk RNA-seq. The caveat of this alternative approach is that CD11b beads do not separate microglia from other related immune cells which are also positive for this antigen.</li>
</ol>
5. Staining for Fluorescence-activated Cell Sorting
NOTE: This step should take ~40 min.
<ol>
	<li>Add 5 &#181;L of mouse Fc receptors block reagent (Table of Materials) into each tube. Incubate for 5 min on ice.</li>
	<li>Add 1 &#181;L of CD45-PE-Cy7 and 1 &#181;L of CD11b-BV421 into each tube. 
	NOTE: Antibodies with other conjugated fluorophores may be used. Antibodies against TMEM119, a specific marker for homeostatic microglia9, can also be included, but it is recommended to be used together with CD45 and CD11b, because certain microglia subpopulations may lose TMEM119 surface expression.</li>
	<li>Incubate the tubes on a shaker for 10 min at room temperature (RT).</li>
	<li>Add 2 mL of FACS buffer to wash.</li>
	<li>Pellet cells at 4 &#176;C, 400 x g for 5 min. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube using 400 &#181;L of FACS buffer with 1 &#181;L of RNase inhibitor and 0.5 &#181;L of propidium iodide (PI, 1:1,000 dilution).</li>
</ol>
6. Index FACS Sorting
NOTE: This step should take ~1 h.
<ol>
	<li>Following standard FACS procedure, draw gates based on scatter (excluding debris), single cells, live cells (PI negative), microglia and myeloid cells (CD45+, CD11b+). 
	NOTE: Typical microglial cells express CD45 at lower levels compared with other border-associated macrophages, such as perivascular and meningeal macrophages, and therefore gating on CD45 low CD11b+ should be sufficient if the focus of the research is gene expression profiles in these classical microglia1,2. However, certain subsets of microglia may have higher CD45 expression and this is particularly true during development or in disease conditions. To ensure unbiased analysis of microglial gene expression, CD45 high and CD45 low immunophenotypes can be recorded through index sorting setting and both populations collected for sequencing and downstream analysis. In addition, TMEM119 surface expression may be used to target the homeostatic microglial population (see step 5.2) and analyzed together with CD45 levels and the sequencing results.</li>
	<li>Sort single microglia (with a 100 &#181;m nozzle) into 96-well polymerase chain reaction (PCR) plates, containing 4 &#181;L of lysis buffer each well (see the published protocol14 for details). 
	NOTE: The External RNA Control Consortium (ERCC) RNA spike-in mix (Table of Materials) can be added at 1:2.4 x 107 in the lysis buffer for quality control and normalization purposes2.</li>
	<li>Briefly vortex the plates and spin down using a bench-top centrifuge.</li>
	<li>Immediately freeze the samples on dry ice. Store the plates at -80 &#176;C until library preparation. 
	NOTE: Alternatively, more cells can be collected into 1.5 mL tubes with RNA extraction buffer for bulk RNA-seq. According to authors' experience, 3,000 cells are sufficient to generate good quality libraries following the published protocol2,14.</li>
</ol>
7. Single-cell RNA-sequencing Library Preparation
NOTE: Here, the published protocol14 is followed to generate scRNA-seq libraries with the aid of liquid handling robotics and a few modifications. In this article, the procedure is only briefly described, and the differences are highlighted. Processing 4 plates simultaneously takes about 2.5 days.
<ol>
	<li>Thaw plates on ice and perform reverse transcription with Oligo-dT30VN primer (in the lysis buffer) to generate cDNA with thermal cyclers (Table 1): 42 &#176;C 90 min; 70 &#176;C 5 min; 4 &#176;C hold. Then amplify cDNA with an additional exonuclease digestion step at the beginning (Table 2) using the PCR master mix and in situ PCR (ISPCR) primers (Table of Materials) and the following PCR condition: 37 &#176;C 30 min; 95 &#176;C 3 min; 23 cycles of 98 &#176;C 20 s, 67 &#176;C 15 s, 72 &#176;C 4 min; 72 &#176;C 5 min.</li>
	<li>Purify cDNA using 18 &#181;L of magnetic beads per well (0.7:1 ratio). Incubate the plate on a magnetic stand for 5 min and wash samples twice with freshly made 80% ethanol, 80 &#181;L per well each time. After drying the plate for 15-20 min, elute cDNA with 20 &#181;L of elution buffer per well. 
	NOTE: For quality control, use a fragment analyzer (high sensitivity next-generation sequencing [NGS] fragment analysis, 1&#8722;6,000 bp) to check size distributions and concentrations of cDNA, and only further process samples with a smear between 500&#8722;5,000 bp, and higher than 0.05 ng/&#181;L.</li>
	<li>To generate libraries, mix 0.4 &#181;L of each cDNA sample with 1.2 &#181;L of Tn5 tagmentation reagents from the library preparation kit (Table of Materials) in a 384-well plate with the aid of a nanoliter pipetting machine, at 55 &#176;C 10 min. 
	NOTE: Here, 1/12.5 of the suggested reaction volume (5 &#181;L sample and 15 &#181;L of tagmentation reagents) is added in order to reduce cost and meanwhile increase throughput. A nanoliter pipetting machine (Table of Materials) is used to transfer reagents (this and following steps) from and to 384-well plates.</li>
	<li>Add 0.4 &#181;L of neutralization buffer to stop the tagmentation reaction at RT for 5 min.</li>
	<li>Add 384 indexes (Table of Materials, 0.4 &#181;L forward and 0.4 &#181;L reverse), 1.2 &#181;L of PCR mix to samples (2 &#181;L each), and amplify the libraries using the following condition: 72 &#176;C 3 min; 95 &#176;C 30 s; 10 cycles of 95 &#176;C 10 s, 55 &#176;C 30 s, 72 &#176;C 1 min; 72 &#176;C 5 min.</li>
	<li>Pool all individual libraries (take 1 &#181;L each) from the same 384-well plate together, and use magnetic beads (Table of Materials, 0.7:1 ratio) to purify the final pooled libraries.</li>
	<li>Use a fluorometer (Table of Materials) to measure the concentrations and a bioanalyzer (Table of Materials) to examine the size distributions of pooled libraries before sequencing. Target the sequencing depth at 1 million raw reads per cell.</li>
	<li>Follow standard bioinformatic procedures to filter and trim sequencing reads and perform alignment2. Use the count table and meta data as inputs to do clustering analysis with the Seurat package15.</li>
</ol>

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

The authors have nothing to disclose.

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method9, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are performed in a timely manner (about 3.5 h from dissection to sorting) with fewer washes and less reagents based on limited tissue sizes. We choose douncing over other homogenization methods, such as enzymatic digestion, because mechanical dissociation can kill and thus remove neurons and other glial cells while causing little damage or activation to microglia9,18. Over-douncing, however, may reduce the yield of microglia and should be avoided. It has been previously shown that mechanical dissociation and beads-based myelin removal followed by FACS sorting introduce less activation to microglia, based on minimal expression of classical inflammatory genes, e.g., Tnf, Il1b, Nos2, and Nfkb29 (Figure 4E). Nonetheless, microglia could still respond to the ex vivo conditions during dissociation and sorting by upregulating early response genes such as Fos and Egr1 (Figure 4E), which are not normally expressed by microglia in vivo2,19, and such changes from transcriptomic studies should always be validated on histology sections.
Here we provide procedures for isolating microglia from cortex, cerebellum, hippocampus and striatum from an adult mouse brain hemisphere, and this protocol can be easily adapted to other regions or stages. This is useful for situations, for example, when disease-affected microglia are limited to certain areas of the brain which can be dissected out, or in aging studies, where pooling samples is inappropriate due to significant individual variations. With the availability of antibodies against microglial (or pan innate immune) epitopes, this protocol could also be adapted for isolating microglia in rat or human tissues9. When adjusting for larger or older tissues, it is important to consider and test the volume of myelin-removal beads and the type of columns used. An alternative approach for myelin removal is by density gradient centrifugation in commercial low-viscosity media20. Overall these two methods are comparable in their efficiency, although the density gradient centrifugation method may provide slightly higher yields, and on the other hand, the magnetic beads method is less likely to introduce endotoxins, which may activate microglia21,22.
Due to the small percentage of microglia among total brain cells, it is often essential to enrich or purify microglia before performing single-cell transcriptomic studies. We use FACS as a sensitive approach to capture lowly represented cell types, and select microglia based on CD11b and CD45 surface expression. From one hemisphere, we routinely obtain ~30,000 microglia for cortex, and ~5,000 microglia for cerebellum, hippocampus or striatum. These yields are sufficient for most single-cell applications as well as bulk RNA-seq (3,000 or more cells can be used). It is worth mentioning that microglia may upregulate CD45 immunoreactivity during development or disease2, in which case cells with both low and high levels of CD45 should be recorded and index sorted for analysis. Another option for enriching microglia is to use CD11b beads-mediated magnetic-activated cell sorting following myelin removal, but this would limit scRNA-seq to droplet methods.
To study microglial gene expression at single-cell resolution, we usually sort cells into at least 2&#8722;3 96-well plates per sample and perform library preparation with liquid handling machines. It has been shown that this plate-based full-length library preparation approach is one of the most sensitive scRNA-seq methods in detection limit, allowing accurate quantification of rare transcripts, such as transcription factors13,14,16. Because of full-length sequencing, this approach is not subject to 5' or 3' bias and can be used to analyze splicing variants (Table 3). In addition, unlike droplet-based methods, which usually require hundreds or thousands of cells in a reaction, this plate-based protocol has the flexibility to include a small number of cells in each experiment, and gradually expand the population size by adding more plates into the design later on. This is advantageous when studying small subsets of microglia in certain conditions such as embryonic development.
While this protocol reproducibly generates high-quality scRNA-seq libraries for brain regional microglia, it is often only suitable for small-scale studies due to the relatively high cost (about $5/cell for library preparation, still cheaper than $23/cell if using the off the shelf SmartSeq v4 kit). Several strategies can help reduce the cost and increase the throughput. First, cells can be sorted into 384-well plates with as little as 0.5 &#181;L of lysis buffer, and this only requires 1/8 volumes of reagents for the initial reverse transcription and PCR amplification steps. Second, it is possible to produce in-house Tn5 transposase that has similar quality as the one in a commercially available kit23. These two modifications could reduce the library preparation cost down to $1/cell. Third, using customized indexes, thousands of cells can be pooled together for sequencing on a system without sacrificing the sequencing depth (&#62;1 million reads/cell)17. These improvements along with the incorporation of automated liquid handling robots, will enable high-throughput deep scRNA-seq of microglia isolated from almost any defined regions.

Microglia, representing 5%&#8722;10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)1. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease1,2,3,4. Recent exciting discoveries have clearly demonstrated that microglia are by no means passive bystanders to brain-derived or pathological signals, but play pivotal roles in controlling brain development and homeostasis, for instance, by supporting neuronal survival, pruning immature synapses, promoting oligodendrocyte lineage cells differentiation as well as angiogenesis1. As more functions of microglia are elucidated, the excitement is further fueled by human genetics studies, which showed that many neurodegenerative disease risk genes, such as TREM2, are predominantly or exclusively expressed by microglia5,6,7. Given their significance in development and plausible disease-driving roles, tremendous effort has recently been put towards our understanding of microglial gene regulation and function in hope of finding new therapeutic targets for neurodegenerative diseases1,8.
RNA sequencing (RNA-seq) allows unbiased characterization of cell type-specific gene expression, which in turn guides scientists to investigate gene functions in dense cellular networks7. RNA-seq had been mostly done on bulk samples, leading to the discovery of a homeostatic microglial gene signature that distinguishes them from other neural and immune cells9. However, such an approach could overlook molecular and functional differences among microglia, especially those transiently present in development, or associated with aging and disease. Indeed, single-cell RNA-seq (scRNA-seq) offers the sensitivity and resolution that have revolutionized the field by revealing previously underappreciated heterogeneity of microglia in a variety of contexts2,3,10. In addition, due to the presence of other similar immune cells at the CNS-circulation interface, scRNA-seq provides information aiding the design of new tools to separate and functionally dissect these related cells with little prior knowledge2,11.
A diverse array of scRNA-seq platforms have been invented, each suitable for certain applications12. In general, droplet-based methods, such as 10x Genomics, are higher in throughput with (tens of) thousands of cells sequenced in each run, and they are less selective for the input which may contain mixed cell populations requiring broad categorization. Plate-based methods provide higher sensitivity and read depth13,14, usually targeting specific populations from cell sorting to reveal subtle differences or rare transcripts. Given the small percentage of microglial cells, particularly those development- or disease-associated subpopulations, among all CNS cell types, it is often desirable to isolate microglia from a specific region of interest and obtain deep and full-length transcriptomic information in order to understand their heterogeneity.
Here, we provide details on how to isolate microglia from different mouse brain regions dissected from a single hemisphere, which are used for single-cell (or bulk) RNA-seq following a semi-automated plate-based library preparation procedure. The other hemisphere can then be used for histological validation. Streamlined from a previously published method9, this isolation protocol aims to maximize the yield from small amount of starting materials, and meanwhile maintain endogenous microglial gene expression profiles. We use fluorescence-activated cell sorting (FACS) to enrich microglia (or other related immune cells of interest) into 96-well plates and miniaturize the volumes of reagents for library preparation in order to increase throughput. We highlight this sensitive scRNA-seq platform, although other plate-based strategies may be applied. This method can be easily adapted to isolate microglia from other dissected tissues, such as injury or disease foci, and the age of the mouse can vary across almost any postnatal stages. Efficient isolation of regional microglia for single-cell transcriptomics studies will facilitate better understanding of their functions in health and disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5 M Betaine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B0300-5VL</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA, pH 8.0</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Hanks' Balanced Salt Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M HEPES</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>1X KAPA HIFI Hotstart Master Mix</td>
			<td>Kapa Biosciences</td>
			<td>Cat# KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td>
			<td>Corning</td>
			<td>Cat# 352235</td>
			<td></td>
		</tr>
		<tr>
			<td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &#8211; 6,000 bp)</td>
			<td>Advanced Analytical</td>
			<td>Cat# DNF-474-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A8806</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>Worthington</td>
			<td>Cat# LS002007</td>
			<td>Working solution: 12500 units/ml</td>
		</tr>
		<tr>
			<td>DTT, Molecular Grade</td>
			<td>Promega</td>
			<td>Cat# P1171</td>
			<td></td>
		</tr>
		<tr>
			<td>ERCC RNA Spike-In Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 4456740</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set A (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set B (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2002</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set C (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set D (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2004</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease (5 U/&#956;l)</td>
			<td>New England BioLabs</td>
			<td>Cat# M0262S</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Fc block</td>
			<td>BD Pharmingen</td>
			<td>Cat# 553142</td>
			<td></td>
		</tr>
		<tr>
			<td>Myelin removal beads</td>
			<td>Miltenyl Biotec</td>
			<td>Cat# 130-096-433</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT DNA Sample Prep Kit</td>
			<td>Illumina</td>
			<td>Cat# FC-131-1096</td>
			<td></td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td>
			<td>Illumina</td>
			<td>Cat# 20024907</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10X), pH 7.4</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>PCRClean DX beads</td>
			<td>Aline Biosciences</td>
			<td>Cat# C-1003-50</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# P3566</td>
			<td>Staining: 1:1000</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermal Fisher Scientific</td>
			<td>Cat# Q32851</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td>
			<td>BioLegend</td>
			<td>Cat# 101236; RRID: AB_11203704</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 25-0451-82; RRID: AB_469625</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Recombinant RNase Inhibitor</td>
			<td>Takara Bio</td>
			<td>Cat# 2313B</td>
			<td></td>
		</tr>
		<tr>
			<td>SMARTScribe Reverse Transcriptase (100 U/&#956;l)</td>
			<td>Clontech</td>
			<td>Cat# 639538</td>
			<td>Containing 5x First strand buffer</td>
		</tr>
		<tr>
			<td colspan="4">Oligonucleotides</td>
		</tr>
		<tr>
			<td>0.1 &#956;M ISPCR Oligo: 5&#39; - AAGCAGTGGTATCAA CGCAGAGT-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>Oligo-dT30VN primer: 5&#39; - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>TSO 5&#39; - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3&#39; (&#34;r&#34; is forribobases and &#34;+&#34; is for an LNA base)</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td colspan="4">Solutions</td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td>
		</tr>
		<tr>
			<td>MCS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td>
		</tr>
		<tr>
			<td>Medium A</td>
			<td></td>
			<td></td>
			<td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td>
		</tr>
		<tr>
			<td colspan="4">Plates</td>
		</tr>
		<tr>
			<td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td>
			<td>VWR</td>
			<td>89005-556</td>
			<td></td>
		</tr>
		<tr>
			<td>Hard-shell 96-well PCR plates</td>
			<td>Bio-Rad</td>
			<td>HSP9631</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Others</td>
		</tr>
		<tr>
			<td>Dumont #55 forceps</td>
			<td>Fine Science Tools</td>
			<td>11295-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Dounce homogenizer, 2 ml</td>
			<td>Wheaton</td>
			<td>357422</td>
			<td></td>
		</tr>
		<tr>
			<td>Large depletion column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Large selection column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAzap</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer (70 &#956;m)</td>
			<td>Falcon</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Equipment</td>
		</tr>
		<tr>
			<td>BD FACSAria II</td>
			<td>BD Biosciences</td>
			<td><a href="http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf" target="_blank">http://www.bdbiosciences.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fragment Analyzer</td>
			<td>Agilent</td>
			<td>5300</td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito HTS nanoliter pipetting robot</td>
			<td>TTP Labtech</td>
			<td><a href="https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/" target="_blank">https://www.ttplabtech.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

This protocol describes a method to isolate and sort microglia from different brain regions in one adult perfused brain hemisphere, followed by scRNA-seq. We use douncing to create single cell suspension and also as a first step to enrich microglia. Insufficient or over-douncing reduces the yield. In addition, adult mouse brains contain high levels of myelin, which can also reduce sorting efficiency and yield if not removed properly. Therefore, we examine the cell suspension under microscope by using trypan blue and a hemocytometer to estimate the yield, cell viability and efficacy of myelin removal (step 4.9) before performing antibody staining (Figure 1). Total cell counts at this point should be over 30,000 for cortex, and over 5,000 for other tissues. Over 90% of cells should be viable with little myelin debris.
We use a FACS machine to sort microglia (or myeloid cells), which are typically CD45 low and CD11b positive. At least for the cortical tissue, successful isolation should generate over 80% microglia out of all live single cells (Figure 2). The dying/dead population represents only a small fraction of the preparation (around 10%).
Once individual microglia are captured into the lysis buffer, RNA is released and subsequently reverse transcribed to cDNA, which is then amplified for 23 cycles. It is important to check the quality of these cDNA samples&#8212;at least a portion of them&#8212;before making libraries. As a capillary electrophoresis platform, the fragment analyzer and high-sensitive NGS fragment kits (1&#8722;6,000 bp) provide quick and accurate information about size distribution as well as quantity of cDNA molecules present in each well of a 96-well plate (Figure 3A). Samples showing a smear (500&#8722;5,000 bp) and above certain concentration threshold (e.g., 0.05 ng/&#181;L) can be used to make libraries. Similarly, the pooled libraries should be tested on a bioanalyzer before sequencing (Figure 3B).
We sequence the samples to a depth of over 1 million raw reads per cell, which saturates the detection power of this scRNA-seq methodology16. With about 60% mapping rate, over 2,000 genes per microglial cell can be detected. We obtained published data that were generated using this isolation method17, and demonstrate its reproducibility from independent experiments and sensitivity for detecting microglia-specific genes across the sequenced population (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60347/60347fig01.jpg" /> 
Figure 1: Estimation of microglia isolation yield, cell viability and efficiency of myelin removal. The left panel showed the bright field image (4x magnification) of trypan blue stained cells (from cortex) after passing through myelin removal columns. Results for other regions would look similar but with fewer cells. The vast majority (if not all) of cells appeared bright (non-stained) and round due to loss of processes. The right image was the zoom-in (20x) of the boxed area and little myelin debris was present. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60347/60347fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60347/60347fig02.jpg" /> 
Figure 2: Gates used for sorting microglia. Data showed the gating strategy for sorting microglia from the cortex, and the same strategy was used for other regions. Cell debris was first excluded from the scatter plot, and single cells were gated by forward scatter-area (FSC-A)/forward scatter-width (FSC-W). Live cells were gated by PI negative staining, which were from about 90% of all single cells. Microglia, representing roughly 80% of live cells, were sorted from the CD45 low CD11b+ gate. A total of ~30,000 microglia could be isolated and sorted from the cortex tissue (from one hemisphere of a 3-month old mouse). Index sorting was performed on a FACS machine. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60347/60347fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60347/60347fig3a1.jpg" />
<img alt="Figure 3" src="/files/ftp_upload/60347/60347fig3b1.jpg" /> 
Figure 3: Representative quality control results for amplified cDNA from a single microglial cell and an eventual pooled library. (A) Using a fragment analyzer, all fragments are plotted with their sizes on the X axis, and relative fluorescence intensity on the Y axis, signifying the abundance of a given sized cDNA. LM (lower marker, 1 bp) and UM (upper marker, 6,000 bp) are loading markers with known concentrations used for measuring cDNA quantity. Successfully amplified cDNA from a representative microglial cell forms a curve (green dotted line) on the size distribution graph or a smear (labeled bracket) on the gel graph between 500 bp and 5,000 bp. Other labeled peaks were amplified from ERCC spike-in molecules or ribosomal RNA. The concentration of cDNA between 500 bp and 5,000 bp can be quantified, and those samples with concentrations higher than 0.05 ng/&#956;L and showing such typical curves are retained for library preparation. RFU, relative fluorescence unit. (B) Representative quality control result on a bioanalyzer showing size distribution of a final pooled library (with about 380 cells). Typically, it ranges from 200 bp to 2,000 bp with an average size of 400&#8722;600 bp. The two sharp peaks were loading markers. FU, fluorescence unit. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60347/60347fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60347/60347fig04v2.jpg" /> 
Figure 4: scRNA-seq analysis of microglia isolated from 4 brain regions of two male mice. (A) tSNE plot showing intermingled pattern of regional microglia (only cells from mouse #1 were highlighted). They do not form distinct clusters according to region origins beyond subtle shift into concentrated areas on the tSNE plot (possibly due to batch effects). This observation is consistent with limited regional heterogeneity of microglia based on global gene expression in the adult mice (see a recent publication2 for further discussion on this topic). (B) tSNE plot showing overlapping pattern of microglia from two individual mice that were processed independently. Although small batch effects may exist (cells concentrating in certain areas of the plot), these cells do not form distinct clusters according to animal origins. This result suggests the reproducibility of the protocol for comparing data between experiments. (C) Expression of microglia signature genes detected by scRNA-seq showing over 95% detection rate for specific markers, such as Tmem119 and P2ry12, and over 80% detection rate for known transcription factors such as Sall1 and Pu.1. The data were re-analyzed from published literature17. (D) Vast majority of isolated microglia lack expression of genes specific to other cell types, such as Tubb3 (neurons), Aldh1l1 (astrocytes), Gjb1 (oligodendrocytes), and Tie1 (endothelial cells). (E) Expression of genes related microglial activation or stress. Classical markers, Tnf, Il1b, Nos2, and Nfkb2, which are lowly expressed, are shown on the top. Early response genes, Egr1 and Fos, are shown at the bottom (see discussion). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60347/60347fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;L)</td>
		</tr>
		<tr>
			<td>Cell lysis</td>
			<td>4</td>
		</tr>
		<tr>
			<td>Reverse transcriptase (100 U/&#181;L)</td>
			<td>0.95</td>
		</tr>
		<tr>
			<td>Rnase inhibitor</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>5x First strand buffer</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT; 100 mM)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Betaine (5 M)</td>
			<td>2</td>
		</tr>
		<tr>
			<td>MgCl2 (1 M)</td>
			<td>0.06</td>
		</tr>
		<tr>
			<td>Template switch oligo (TSO; 100 &#181;M)</td>
			<td>0.1</td>
		</tr>
		<tr>
			<td>H2O</td>
			<td>0.14</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>10</td>
		</tr>
	</tbody>
</table>
Table 1: Reverse transcription condition. Reagent volumes for one reverse transcription reaction are provided.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;L)</td>
		</tr>
		<tr>
			<td>Reverse transcription product</td>
			<td>10</td>
		</tr>
		<tr>
			<td>2x PCR master mix</td>
			<td>12.5</td>
		</tr>
		<tr>
			<td>ISPCR primer (10 &#181;M)</td>
			<td>0.25</td>
		</tr>
		<tr>
			<td>Lambda exonuclease</td>
			<td>0.1125</td>
		</tr>
		<tr>
			<td>H2O</td>
			<td>2.1375</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25</td>
		</tr>
	</tbody>
</table>
Table 2: PCR amplification condition. Reagent volumes for one PCR amplification of cDNA from a single cell are provided.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Plate-based (this protocol)</td>
			<td>Droplet-based (10x Genomics)</td>
		</tr>
		<tr>
			<td>Sensitivity</td>
			<td>More genes detected</td>
			<td>Fewer genes detected</td>
		</tr>
		<tr>
			<td>Full length</td>
			<td>Yes</td>
			<td>No (5&#39; or 3&#39; end)</td>
		</tr>
		<tr>
			<td>Flexibility for cell numbers/populations</td>
			<td>Suitable for characterization of small or rare subpopulations</td>
			<td>Suitable for broad categorization of large cell populations</td>
		</tr>
		<tr>
			<td>Throughput</td>
			<td>Up to several thousands of cells</td>
			<td>Hundreds to tens of thousands of cells</td>
		</tr>
		<tr>
			<td>Unique molecular identifier</td>
			<td>No</td>
			<td>Yes</td>
		</tr>
		<tr>
			<td>Cost per cell</td>
			<td>$1&#8722;$5</td>
			<td>less than $1</td>
		</tr>
		<tr>
			<td>Experimental difficulty</td>
			<td>More steps and usually require liquid handling robotics</td>
			<td>Simple to perform with commercialized machines</td>
		</tr>
		<tr>
			<td>Cell populations</td>
			<td>Targeted by FACS sorting</td>
			<td>Unbiased</td>
		</tr>
	</tbody>
</table>
Table 3: Comparison between plate-based and droplet-based scRNA-seq methods. In this article, the plate-based full-length scRNA-seq procedure is provided, which has the advantages of higher sensitivity, full-length sequencing and flexibility for small numbers of cells as inputs. Droplet-based methods offer the advantages of higher throughput, lower cost, easy to perform and data in unique molecular identifiers. They are complementary depending on the purpose of the experiments.

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

isolation-region-specific-microglia-from-one-adult-mouse-brain

Nanyang Technological University

Research

JoVE Journal

Neuroscience

10.7K Views.  Stanford University School of Medicine. We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

Video: Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of the breadth of molecular regulation. Newer approaches such as high-resolution RNA sequencing (RNA-Seq)1 provides new and expansive information about tissue- or state-specific expression such as relative transcript levels, alternative splicing, and micro RNAs2-4. Prospects for employing the RNA-Seq method in comparative whole transcriptome profiling5 within discrete tissues or between phenotypically distinct groups of individuals affords new avenues for elucidating molecular mechanisms involved in both normal and abnormal physiological states. Recently, whole transcriptome profiling has been performed on human brain tissue, identifying gene expression differences associated with disease progression6. However, the use of next-generation sequencing has yet to be more widely integrated into mammalian studies.
Gene expression studies in mouse models have reported distinct profiles within various brain nuclei using laser capture microscopy (LCM) for sample excision7,8. While LCM affords sample collection with single-cell and discrete brain region precision, the relatively low total RNA yields from the LCM approach can be prohibitive to RNA-Seq and other profiling approaches in mouse brain tissues and may require sub-optimal sample amplification steps. Here, a protocol is presented for microdissection and total RNA extraction from discrete mouse brain regions. Set-diameter tissue corers are used to isolate 13 tissues from 750-&mu;m serial coronal sections of an individual mouse brain. Tissue micropunch samples are immediately frozen and archived. Total RNA is obtained from the samples using magnetic bead-enabled total RNA isolation technology. Resulting RNA samples have adequate yield and quality for use in downstream expression profiling. This microdissection strategy provides a viable option to existing sample collection strategies for obtaining total RNA from discrete brain regions, opening possibilities for new gene expression discoveries.

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

RNA expression profiling of discrete mouse brain regions requires a precise and repeatable tissue collection strategy. A protocol that uses both coronal brain sectioning and tissue corer-assisted microdissection is described here. The yield and quality of total RNA obtained from the resulting samples confirms the utility of the outlined method.

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

One Mouse, Two Cultures: Isolation and Culture of Adult Neural Stem Cells from the Two Neurogenic Zones of Individual Mice

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult neural stem cells in vitro. These assays can be used to compare the precursor potential of cells isolated from genetically different or differentially treated animals&#160;to determine the effects of exogenous factors on neural precursor cell proliferation and differentiation and to generate neural precursor cell lines that can be assayed over continuous passages. The neurosphere assay is traditionally used for the post-hoc identification of stem cells, primarily due to the lack of definitive markers with which they can be isolated from primary tissue&#160;and has the major advantage of giving a quick estimate of precursor cell numbers in brain tissue derived from individual animals. Adherent monolayer cultures, in contrast, are not traditionally used to compare proliferation between individual animals, as each culture is generally initiated from the combined tissue of between 5-8 animals. However, they have the major advantage that, unlike neurospheres, they consist of a mostly homogeneous population of precursor cells and are useful for following the differentiation process in single cells. Here, we describe, in detail, the generation of neurosphere cultures and, for the first time, adherent cultures from individual animals. This has many important implications including paired analysis of proliferation and/or differentiation potential in both the subventricular zone (SVZ) and dentate gyrus (DG) of treated or genetically different mouse lines, as well as a significant reduction in animal usage.

Here we describe a detailed protocol for the simultaneous generation of neural precursor cell cultures, as either adherent monolayers or neurospheres, from the subventricular zone and dentate gyrus of individual adult mice.

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult ...

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion channel, and transporter cell surface presentation on a minutes time scale.&#160;There is a broad diversity of mechanisms that control endocytic trafficking of individual proteins. Studies investigating the molecular underpinnings of trafficking have primarily relied upon surface biotinylation to quantitatively measure changes in membrane protein surface expression in response to exogenous stimuli and gene manipulation.&#160;However, this approach has been mainly limited to cultured cells, which may not faithfully reflect the physiologically relevant mechanisms at play in adult neurons.&#160;Moreover, cultured cell approaches may underestimate region-specific differences in trafficking mechanisms.&#160;Here, we describe an approach that extends cell surface biotinylation to the acute brain slice preparation.&#160;We demonstrate that this method provides a high-fidelity approach to measure rapid changes in membrane protein surface levels in adult neurons.&#160;This approach is likely to have broad utility in the field of neuronal endocytic trafficking.

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Neuronal membrane trafficking dynamically controls plasma membrane protein availability and significantly impacts neurotransmission.&#160;To date, it has been challenging to measure neuronal endocytic trafficking in adult neurons.&#160;Here, we describe a highly effective, quantitative method to measure rapid changes in surface protein expression ex vivo in acute brain slices.

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion ...

Characterization and Isolation of Mouse Primary Microglia by Density Gradient Centrifugation

Microglia, the resident immune cells in the brain, are the first responders to inflammation or injury in the central nervous system. Recent research has revealed microglia to be dynamic, capable of assuming both pro-inflammatory and anti-inflammatory phenotypes. Both M1 (pro-inflammatory) and M2 (pro-reparative) phenotypes play an important role in neuroinflammatory conditions such as perinatal brain injury, and exhibit differing functions in response to certain environmental stimuli. The modulation of microglial activation has been noted to confer neuroprotection thus suggesting microglia may have therapeutic potential in brain injury. However, more research is required to better understand the role of microglia in disease, and this protocol facilitates that. The protocol described below combines a density gradient centrifugation process to reduce cellular debris, with magnetic separation, producing a highly pure sample of primary microglial cells that can be used for in vitro experimentation, without the need for 2-3 weeks culturing. Additionally, the characterization steps yield robust functional data about microglia, aiding studies to better our understanding of the polarization and priming of these cells, which has strong implications in the field of regenerative medicine.

A protocol for the isolation of primary microglia from murine brains is presented. This technique aids in furthering the current understanding of neurological conditions. Density gradient centrifugation and magnetic separation are combined to produce sufficient yield of a highly pure sample. Furthermore, we outline the steps for characterization of microglia.

Microglia, the resident immune cells in the brain, are the first responders to inflammation or injury in the central nervous system. Recent research has ...

Isolation and RNA Extraction of Neurons, Macrophages and Microglia from Larval Zebrafish Brains

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is important to isolate these cells without changing their gene expression profile. The zebrafish model provides a large number of transgenic fish lines in which specific cell types are labelled; for example neurons in the NBT:DsRed line or macrophages/microglia in the mpeg1:eGFP line. Furthermore, antibodies have been developed to stain specific cells, such as microglia with the 4C4 antibody.
Here, we describe the isolation of neurons, macrophages and microglia from larval zebrafish brains. Central to this protocol is the avoidance of an enzymatic tissue digestion at 37 &#176;C, which could modify cellular profiles. Instead a mechanical system of tissue homogenization at 4 &#176;C is used. This protocol entails homogenization of brains into cell suspension, their immuno-staining and the isolation of neurons, macrophages and microglia by FACS. Afterwards, we extracted RNA from those cells and evaluated their quality/quantity. We managed to obtain RNA of high quality (RNA Integrity Number (RIN) &#62; 7) to perform qPCR on macrophages/microglia and neurons, and transcriptomic analysis on microglia. This approach enables a better characterization of these cells, as well as a clearer understanding about their role in development and pathologies.

We present a protocol to isolate neurons, macrophages and microglia from larval zebrafish brains under physiological and pathological conditions. Upon isolation, RNA is extracted from these cells to analyze their gene expression profile. This protocol allows for the collection of high-quality RNA for performing downstream analysis like qPCR and transcriptomics.

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a powerful tool for studying transcriptional profiles of cells, particularly in heterogeneous tissues such as the central nervous system. However, dissociation methods required for single cell sequencing can lead to experimental changes in the gene expression and cell death. Furthermore, these methods are generally restricted to fresh tissue, thus limiting studies on archival and bio-bank material. Single nucleus RNA sequencing (snRNA-Seq) is an appealing alternative for transcriptional studies, given that it accurately identifies cell types, permits the study of tissue that is frozen or difficult to dissociate, and reduces dissociation-induced transcription. Here, we present a high-throughput protocol for rapid isolation of nuclei for downstream snRNA-Seq. This method enables isolation of nuclei from fresh or frozen spinal cord samples and can be combined with two massively parallel droplet encapsulation platforms.

Here, we present a protocol to rapidly isolate high-quality nuclei from the fresh or frozen tissue for downstream massively parallel RNA sequencing. We include detergent-mechanical and hypotonic-mechanical tissue disruption and cell lysis options, both of which can be used for isolation of nuclei.

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing platforms process all input cells indiscriminately. Sometimes, fluorescence-activated cell sorting (FACS) is used upstream to isolate a specifically labeled population of interest. A limitation of FACS is the need for high numbers of input cells with significantly labeled fractions, which is impractical for collecting and profiling rare or sparsely labeled neuron populations from the mouse brain. Here, we describe a method for manually collecting sparse fluorescently labeled single neurons from freshly dissociated mouse brain tissue. This process allows for capturing single-labeled neurons with high purity and subsequent integration with an in vitro transcription-based amplification protocol that preserves endogenous transcript ratios. We describe a double linear amplification method that uses unique molecule identifiers (UMIs) to generate individual mRNA counts. Two rounds of amplification results in a high degree of gene detection per single cell.

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

This protocol describes the manual sorting procedure to isolate single fluorescently labeled neurons followed by in vitro transcription-based mRNA amplification for high-depth single-cell RNA sequencing.

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...

Evaluation of Hemisphere Lateralization with Bilateral Local Field Potential Recording in Secondary Motor Cortex of Mice

This article demonstrates complete, detailed procedures for both in vivo bilateral recording and analysis of local field potential (LFP) in the cortical areas of mice, which are useful for evaluating possible laterality deficits, as well as for assessing brain connectivity and coupling of neural network activities in rodents. The pathological mechanisms underlying Alzheimer&#39;s disease (AD), a common neurodegenerative disease, remain largely unknown. Altered brain laterality has been demonstrated in aging people, but whether or not abnormal lateralization is one of the early signs of AD has not been determined. To investigate this, we recorded bilateral LFPs in 3-5-month-old AD model mice, APP/PS1, together with littermate wild type (WT) controls. The LFPs of the left and right secondary motor cortex (M2), specifically in the gamma band, were more synchronized in APP/PS1 mice than in WT controls, suggesting a declined hemispheric asymmetry of bilateral M2 in this AD mouse model. Notably, the recording and data analysis processes are flexible and easy to carry out, and can also be applied to other brain pathways when conducting experiments that focus on neuronal circuits.

We present in vivo electrophysiological recording of the local field potential (LFP) in bilateral secondary motor cortex (M2) of mice, which can be applied to evaluate hemisphere lateralization. The study revealed altered levels of synchronization between the left and right M2 in APP/PS1 mice compared to WT controls.

This article demonstrates complete, detailed procedures for both in vivo bilateral recording and analysis of local field potential (LFP) in the cortical ...

Assessment of Long-term Depression Induction in Adult Cerebellar Slices

Synaptic plasticity provides a mechanism for learning and memory. For cerebellar motor learning, long-term depression (LTD) of synaptic transmissions from parallel fibers (PF) to Purkinje cells (PC) is considered the basis for motor learning, and deficiencies of both LTD and motor learning are observed in various gene-manipulated animals. Common motor learning sets, such as adaptation of the optokinetic reflex (OKR), the vestibular-ocular reflex (VOR), and rotarod test were used for evaluation of motor learning ability. However, results obtained from the GluA2-carboxy terminus modified knock-in mice demonstrated normal adaptation of the VOR and the OKR, despite lacking PF-LTD. In that report, induction of LTD was only attempted using one type of stimulation protocol at room temperature. Thus, conditions to induce cerebellar LTD were explored in the same knock-in mutants using various protocols at near physiological temperature. Finally, we found stimulation protocols, by which LTD could be induced in these gene-manipulated mice. In this study, a set of protocols are proposed to evaluate LTD-induction, which will more accurately allow examination of the causal relationship between LTD and motor learning. In conclusion, experimental conditions are crucial when evaluating LTD in gene-manipulated mice.

In some gene-manipulated animals, using a single protocol may fail to induce LTD in cerebellar Purkinje cells, and there may be a discrepancy between LTD and motor learning. Multiple protocols are necessary to assess LTD-induction in gene-manipulated animals. Standard protocols are shown.

Synaptic plasticity provides a mechanism for learning and memory. For cerebellar motor learning, long-term depression (LTD) of synaptic transmissions from ...

Obtaining Human Microglia from Adult Human Brain Tissue

Microglia are resident innate immune cells of the central nervous system (CNS). Microglia play a critical role during development, in maintaining homeostasis, and during infection or injury. Several independent research groups have highlighted the central role that microglia play in autoimmune diseases, autoinflammatory syndromes and cancers. The activation of microglia in some neurological diseases may directly participate in pathogenic processes. Primary microglia are a powerful tool to understand the immune responses in the brain, cell-cell interactions and dysregulated microglia phenotypes in disease. Primary microglia mimic in vivo microglial properties better than immortalized microglial cell lines. Human adult microglia exhibit distinct properties as compared to human fetal and rodent microglia. This protocol provides an efficient method for isolation of primary microglia from adult human brain. Studying these microglia can provide critical insights into cell-cell interactions between microglia and other resident cellular populations in the CNS including, oligodendrocytes, neurons and astrocytes. Additionally, microglia from different human brains may be cultured for characterization of unique immune responses for personalized medicine and a myriad of therapeutic applications.

This protocol is an efficient, cost effective and robust method of isolating primary microglia from live, adult, human brain tissue. Isolated primary human microglia can serve as a tool for studying cellular processes in homeostasis and disease.