This work was made possible by the&#160;NIH R01 grant (NS094721, K.A.J.).&#160;

<ol>
	<li>Wilkinson, K. A., Merino, E. J., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+2'-hydroxyl+acylation+analyzed+by+primer+extension+(SHAPE):+Quantitative+RNA+structure+analysis+at+single+nucleotide+resolution.">Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE): Quantitative RNA structure analysis at single nucleotide resolution.</a> Nature Protocols. 1, 1610-1616 (2006).</li><li>Trausch, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+diversity+in+the+SAM+clan+of+riboswitches.">Structural basis for diversity in the SAM clan of riboswitches.</a> Proceedings of the National Academy of Sciences. 111, 6624-6629 (2014).</li><li>Souliere, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+a+riboswitch+response+through+structural+extension+of+a+pseudoknot.">Tuning a riboswitch response through structural extension of a pseudoknot.</a> Proceedings of the National Academy of Sciences. 110, E3256-E3264. , E3256-E3264 (2013).</li><li>Rice, G. M., Busan, S., Karabiber, F., Favorov, O. V., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SHAPE+Analysis+of+Small+RNAs+and+Riboswitches.">SHAPE Analysis of Small RNAs and Riboswitches.</a> Methods in Enzymology. , 165-187 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+SHAPE+analysis+in+living+cells.">RNA SHAPE analysis in living cells.</a> Nature Chemical Biology. 9, 18-20 (2013).</li><li>Wang, J., Schultz, P. G., Johnson, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanistic+studies+of+a+small-molecule+modulator+of+SMN2+splicing.">Mechanistic studies of a small-molecule modulator of SMN2 splicing.</a> Proceedings of the National Academy of Sciences. 115, E4604-E4612 (2018).</li><li>Price, I. R., Gaballa, A., Ding, F., Helmann, J. D., Ke, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mn+2++-Sensing+Mechanisms+of+yybP-ykoY+Orphan+Riboswitches.">Mn 2+ -Sensing Mechanisms of yybP-ykoY Orphan Riboswitches.</a> Molecular Cell. 57, 1110-1123 (2015).</li><li>Hennelly, S. P., Sanbonmatsu, K. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+contacts+control+switching+of+the+SAM-I+riboswitch.">Tertiary contacts control switching of the SAM-I riboswitch.</a> Nucleic Acids Research. 39, 2416-2431 (2011).</li><li>Abulwerdi, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Small+Molecules+with+a+Noncanonical+Binding+Mode+to+HIV-1+Trans+Activation+Response+(TAR)+RNA.">Development of Small Molecules with a Noncanonical Binding Mode to HIV-1 Trans Activation Response (TAR) RNA.</a> Journal of Medicinal Chemistry. 59, 11148-11160 (2016).</li><li>Shortridge, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Macrocyclic+Peptide+Ligand+Binds+the+Oncogenic+MicroRNA-21+Precursor+and+Suppresses+Dicer+Processing.">A Macrocyclic Peptide Ligand Binds the Oncogenic MicroRNA-21 Precursor and Suppresses Dicer Processing.</a> ACS Chemical Biology. 12, 1611-1620 (2017).</li><li>Warner, K. D., Hajdin, C. E., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+for+targeting+RNA+with+drug-like+small+molecules.">Principles for targeting RNA with drug-like small molecules.</a> Nature Reviews Drug Discovery. 17, 547-558 (2018).</li><li>Mullard, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules+against+RNA+targets+attract+big+backers.">Small molecules against RNA targets attract big backers.</a> Nature Reviews Drug Discovery. 16, 813-815 (2017).</li><li>Shortridge, M. D., Varani, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+based+approaches+for+targeting+non-coding+RNAs+with+small+molecules.">Structure based approaches for targeting non-coding RNAs with small molecules.</a> Current Opinion in Structural Biology. 30, 79-88 (2015).</li><li>Gallego, J., Varani, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+RNA+with+Small-Molecule+Drugs:+Therapeutic+Promise+and+Chemical+Challenges.">Targeting RNA with Small-Molecule Drugs: Therapeutic Promise and Chemical Challenges.</a> Accounts of Chemical Research. 34, 836-843 (2001).</li><li>Rizvi, N. F., Smith, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+as+a+small+molecule+druggable+target.">RNA as a small molecule druggable target.</a> Bioorganic &amp; Medicinal Chemistry Letters. 27, 5083-5088 (2017).</li><li>Connelly, C. M., Moon, M. H., Schneekloth, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Emerging+Role+of+RNA+as+a+Therapeutic+Target+for+Small+Molecules.">The Emerging Role of RNA as a Therapeutic Target for Small Molecules.</a> Cell Chemical Biology. 23, 1077-1090 (2016).</li><li>Palacino, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMN2+splice+modulators+enhance+U1-pre-mRNA+association+and+rescue+SMA+mice.">SMN2 splice modulators enhance U1-pre-mRNA association and rescue SMA mice.</a> Nature Chemical Biology. 11, 511-517 (2015).</li><li>Ratni, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Risdiplam,+a+Selective+Survival+of+Motor+Neuron-2+(+SMN2+)+Gene+Splicing+Modifier+for+the+Treatment+of+Spinal+Muscular+Atrophy+(SMA).">Discovery of Risdiplam, a Selective Survival of Motor Neuron-2 ( SMN2 ) Gene Splicing Modifier for the Treatment of Spinal Muscular Atrophy (SMA).</a> Journal of Medicinal Chemistry. 61, 6501-6517 (2018).</li><li>Naryshkin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMN2+splicing+modifiers+improve+motor+function+and+longevity+in+mice+with+spinal+muscular+atrophy.">SMN2 splicing modifiers improve motor function and longevity in mice with spinal muscular atrophy.</a> Science. 345, (2014).</li><li>Chiriboga, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preliminary+Evidence+for+Pharmacodynamics+Effects+of+RG7916+in+JEWELFISH,+a+Study+in+Patients+with+Spinal+Muscular+Atrophy+who+Previously+Participated+in+a+Study+with+Another+SMN2-Splicing+Targeting+Therapy+(S46.003).">Preliminary Evidence for Pharmacodynamics Effects of RG7916 in JEWELFISH, a Study in Patients with Spinal Muscular Atrophy who Previously Participated in a Study with Another SMN2-Splicing Targeting Therapy (S46.003).</a> Neurology. 90, (2018).</li><li>Sivaramakrishnan, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+to+SMN2+pre-mRNA-protein+complex+elicits+specificity+for+small+molecule+splicing+modifiers.">Binding to SMN2 pre-mRNA-protein complex elicits specificity for small molecule splicing modifiers.</a> Nature Communications. 8, (2017).</li><li>Lee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+SHAPE+reagents+for+mapping+RNA+structures+inside+living+cells.">Comparison of SHAPE reagents for mapping RNA structures inside living cells.</a> RNA. 23, 169-174 (2017).</li><li>Weeks, K. M., Mauger, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+RNA+Structural+Codes+with+SHAPE+Chemistry.">Exploring RNA Structural Codes with SHAPE Chemistry.</a> Accounts of Chemical Research. 44, 1280-1291 (2011).</li><li>Smola, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SHAPE+reveals+transcript-wide+interactions+,+complex+structural+domains+,+and+protein+interactions+across+the+Xist+lncRNA+in+living+cells.">SHAPE reveals transcript-wide interactions , complex structural domains , and protein interactions across the Xist lncRNA in living cells.</a> Proceedings of the National Academy of Sciences. 113, 10322-10327 (2016).</li><li>Flynn, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome-wide+interrogation+of+RNA+secondary+structure+in+living+cells+with+icSHAPE.">Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE.</a> Nature Protocols. 11, 273-290 (2016).</li><li>Smola, M. J., Rice, G. M., Busan, S., Siegfried, N. A., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+2+&#8242;+-hydroxyl+acylation+analyzed+by+primer+extension+and+mutational+profiling+(SHAPE-MaP)+for+direct+,+versatile+and+accurate+RNA+structure+analysis.">Selective 2 &#8242; -hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct , versatile and accurate RNA structure analysis.</a> Nature Protocols. 10, 1643-1669 (2015).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+correction+of+SMN2+splicing+in+the+CNS+rescues+necrosis+in+a+type+III+SMA+mouse+model.">Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model.</a> Genes &amp; Development. 24, 1634-1644 (2010).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478, 123-126 (2011).</li><li>Wee, C. D., Havens, M. A., Jodelka, F. M., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+SR+proteins+improves+SMN+expression+in+spinal+muscular+atrophy+cells.">Targeting SR proteins improves SMN expression in spinal muscular atrophy cells.</a> PloS One. 9, e115205 (2014).</li><li>Hammond, J. A., Rambo, R. P., Filbin, M. E., Kieft, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+and+functional+implications+of+the+3D+architectures+of+viral+tRNA-like+structures.">Comparison and functional implications of the 3D architectures of viral tRNA-like structures.</a> RNA. 15, 294-307 (2009).</li><li>Singh, N. N., Singh, R. N., Androphy, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulating+role+of+RNA+structure+in+alternative+splicing+of+a+critical+exon+in+the+spinal+muscular+atrophy+genes.">Modulating role of RNA structure in alternative splicing of a critical exon in the spinal muscular atrophy genes.</a> Nucleic Acids Research. 35, 371-389 (2007).</li><li>Deigan, K. E., Li, T. W., Mathews, D. H., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+SHAPE-directed+RNA+structure+determination.">Accurate SHAPE-directed RNA structure determination.</a> Proceedings of the National Academy of Sciences. 106, 97-102 (2009).</li><li>Qi, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Preparation of pyridopyrimidine derivatives and related compounds for treating spinal muscular atrophy. , (2013).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proceedings of the National Academy of Sciences of the United States of America. 96, 6307-6311 (1999).</li><li>Siegfried, N. A., Busan, S., Rice, G. M., Nelson, J. A. E., Weeks, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+motif+discovery+by+SHAPE+and+mutational+profiling+(SHAPE-MaP).">RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP).</a> Nature Methods. 11, 959 (2014).</li><li>Milligan, J. F., Groebe, D. R., Witherell, G. W., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oligoribonucleotide+synthesis+using+T7+RNA+polymerase+and+synthetic+DNA+templates.">Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates.</a> Nucleic Acids Research. 15, 8783-8798 (1987).</li><li>Nilsen, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+Footprinting+to+Map+Sites+of+RNA-Protein+Interactions.">RNase Footprinting to Map Sites of RNA-Protein Interactions.</a> Cold Spring Harbor Protocols. , (2014).</li><li>Velagapudi, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+a+small+molecule+against+an+oncogenic+noncoding+RNA.">Design of a small molecule against an oncogenic noncoding RNA.</a> Proceedings of the National Academy of Sciences. , 5898-5903 (2016).</li><li>Barnwal, R. P., Yang, F., Varani, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+NMR+to+structure+determination+of+RNAs+large+and+small.">Applications of NMR to structure determination of RNAs large and small.</a> Archives of Biochemistry and Biophysics. 628, 42-56 (2017).</li><li>Scott, L. G., Hennig, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+structure+determination+by+NMR.">RNA structure determination by NMR.</a> Methods in Molecular Biology. 452, 29-61 (2008).</li></ol>

The authors declare no conflict of interest.

In in vitro SHAPE, it is critical to use high quality homogeneous RNA template. T7 transcription, however, often yields heterogeneous sequences36. Especially, sequences with &#177;1 nucleotide at the 3&#39;-terminus with non-negligible yields36 are usually difficult to be removed by polyacrylamide gel purification. Heterogeneous RNA template can result in more than one set of the signal in the sequencing gel profiling of the primer extension product, which sometimes makes it difficult to interpret the result. The ribozyme at both 5&#39;- and 3&#39;-ends of the RNA template expression cassette will make both ends homogenous.
For both in vitro and in-cell SHAPE, the incubation time of 2&#39;-OH modification reagents is another critical factor. It was suggested by the Weeks group that at least five times the half-life of the water-quenching 2&#39;-OH acylation reagent should be used1. In our hands, incubating with NAI (T1/2 = ~20 min) for &#62;30 min in both in vitro and in-cell SHAPE results in an overreacted result. As shown in Figure 1D, a good in vitro SHAPE profiling should have &#62;50% total signal on top of the gel as full-length transcript, ensuring that most of the modified RNA is only acylated once. Overreaction will render the double-acylated product non-negligible and the profiling biased to the enriched short length extension products. In in-cell SHAPE, the amplicon for the library construction should appear as a single band in agarose gel analysis (step 2.6.3). Smear of the band indicates an overreaction, and the incubate time should be reduced. In the representative experiments, a 15 min incubation time at 37 &#176;C was optimal for in vitro and in-cell SHAPE. This should be used as a starting point for NAI modification in similar applications.
There are other 2&#39;-OH modification reagents22 widely used for SHAPE, such as 1M7. Compared to NAI, 1M7 has a better reactivity to 2&#39;-OH group and shorter half-life in water22. In our hands, 1M7 formed massive amount of yellow precipitation in cell culture media in an in-cell SHAPE experiment, which complicated the RNA isolation. For a comparison reason, both in vitro and in-cell SHAPE used NAI as the 2&#39;-OH modification reagent for a study of SMN-C2 and SMN2 pre-mRNA interactions. If only in vitro SHAPE is required, 1M7 is an alternative option as demonstrated by various studies in riboswitch structural determination7,8.
In general, in-cell SHAPE over in vitro SHAPE is preferred, especially if the molecule is presumably acting in the nucleus of a eukaryotic cell. RNA-binding proteins in the nucleus are abundant, and it is almost impossible to recapitulate the cellular context under in vitro conditions.
In the past decade, SHAPE becomes the standard method for studying the secondary structure of RNA. Compared to traditional RNA footprinting with RNase37, it is more suitable to study small molecule-RNA interactions, as these interaction can sometimes be weak and insensitive to RNase challenges.
The major limitation of using SHAPE to study small molecule-induced RNA structural changes is that its results do not reveal the binding site. In in vitro and in-cell SHAPE for SMN-C2 bound pre-mRNA, the SHAPE reactivity did not change at the putative binding site (Figure 1D, Figure 2B); rather, the reactivity at 2 to 3 remote sites at the loop or budge region were altered. SMN-C2 presumably binds to an RNA double-helix region (Figure 1D, Figure 2D), which usually has a low SHAPE reactivity. Therefore, further stabilizing the structure to decrease SHAPE reactivity would probably not be observable. To generate a putative binding site, other methods such as ChemCLIP38 should be used, in which a crosslinking chemical probe is involved.
A common alternative approach to map RNA secondary or higher structure and nucleotide dynamics is NMR spectrometry39,40. It has been demonstrated that RNA dynamics derived from quantitative NMR analysis strongly correlate with SHAPE activity39. In the context of small molecule binding, chemical shift perturbations can reveal the interacting nucleotides21.
As RNA-targeting small molecules become a new modality of drug development11, we envision that SHAPE will be established as a standard methodology to evaluate the structural impacts of target RNA in the presence of small molecules. In the future, a transcriptome-wide interrogation method for RNA-targeting small molecule drugs is desired.

Selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) is a method of measuring the kinetics of each nucleotide in an RNA sequence of interest and elucidating the secondary structure at single-nucleotide resolution1. SHAPE methodologies, both in in vitro conditions2,3,4 (purified RNA in a defined buffer system) and in living mammalian cells5,6, have been developed to investigate the secondary structure of medium length RNA sequences (typically &#60;1,000 nucleotides for in-cell SHAPE and &#60;200 nucleotides for in vitro SHAPE). It is particularly useful to evaluate structural changes in receptor RNA upon binding to RNA-interacting small molecule metabolites2,4,7,8 and to study mechanistic actions of RNA-targeting molecules during drug development9,10.
RNA-targeting drug discovery has recently drawn attention in academic laboratories and the pharmaceutical industry11,12 via different approaches and strategies13,14,15,16. Recent examples of RNA-targeting small molecules for clinical use include two structurally distinct experimental drugs, LMI-07017 and RG-791618,19, for spinal muscular atrophy (SMA), which showed promising results in phase II clinical trials20. Both molecules were demonstrated to target survival of motor neuron (SMN) 2 pre-mRNA and regulate the splicing process of the SMN2 gene6,17,21. We previously demonstrated the application of in vitro and in-cell SHAPE in an examination of the target RNA structural changes in the presence of an analog of RG-7916 known as SMN-C26.
In principle, SHAPE measures the 2&#39;-OH acylation rate of each nucleotide of an RNA sequence in the presence of excess amounts of a self-quenching acylation reagent in an unbiased manner. The acylation reagent is not stable in water, with a short half-life of (e.g., T1/2 = 17 s for 1-methyl-7-nitroisatoic anhydride; or 1M7, ~20 min for 2-methylnicotinic acid imidazolide, or NAI)22 and insensitivity to the identity of the bases23. This results in a more favorable acylation of the 2&#39;-OH groups of flexible bases, which can be transformed into an accurate assessment of the dynamics of each nucleotide. Specifically, a nucleotide in a base-pair is usually less reactive than an unpaired one to a 2&#39;-OH modifying reagent, such as NAI and 1M7.
Looking at the source of the RNA template and where 2&#39;-OH acylation takes place, SHAPE can generally be categorized into in vitro and in-cell SHAPE. In vitro SHAPE uses purified T7 transcribed RNA and lacks a cellular context in experimental designs. In in-cell SHAPE, both the RNA template transcription and 2&#39;-OH acylation occur within living cells; therefore, the results can recapitulate the RNA structural model in a cellular context. In-cell SHAPE has been referred to as in vivo SHAPE for the SHAPE carried in living cells in the literature24. Since this experiment is not performed in an animal, we termed this experiment as in-cell SHAPE for accuracy.
The strategies for the primer extension stage of in vitro and in-cell SHAPE are also different. In in vitro SHAPE, reverse transcription stops at the 2&#39;-OH acylation position in the presence of Mg2+. A 32P-labled primer extension therefore appears as a band in polyacrylamide gel electrophoresis (PAGE) and the intensity of the band is proportional to the acylation rate1. In in-cell SHAPE, reverse transcription generates random mutations at the 2&#39;-OH adduct position in the presence of Mn2+. The mutational rate of each nucleotide can be captured by in depth next-generation sequencing, and the SHAPE reactivity at single-nucleotide resolution can then be calculated.
A potential problem for in-cell SHAPE is the low signal-to-noise ratio (i.e., a majority of the 2&#39;-OH groups is unmodified, while the unmodified sequences occupy most of the read in next-generation sequencing). Recently, a method to enrich the 2&#39;-OH modified RNA, referred to as in vivo click SHAPE (icSHAPE), was developed by the Chang laboratory25. This enrichment method may be advantageous in studying weak small molecules such as RNA interactions, especially in a transcriptome-wide interrogation.

<table><tbody><tr><td>DNA oligonucleotide</td><td>IDT</td><td></td><td>gBlock for &gt;200 bp DNA synthesis</td></tr><tr><td>Phusion Green Hot Start II High-Fidelity PCR Master Mix</td><td>Thermo Fisher</td><td>F566S</td><td></td></tr><tr><td>NucleoSpin gel and PCR clean-up kit</td><td>Takara</td><td>740609.50</td><td></td></tr><tr><td>MegaScript T7 transcription kit</td><td>Thermo Fisher</td><td>AM1333</td><td>Contains 10x reaction buffer, T7 enzyme, NTP and Turbo DNase</td></tr><tr><td>DEPC-treated water</td><td>Thermo Fisher</td><td>750023</td><td></td></tr><tr><td>2x TBE-urea sample buffer</td><td>Thermo Fisher</td><td>LC6876</td><td></td></tr><tr><td>40% acrylamide/ bisacrylamide solution (29:1)</td><td>Bio-Rad</td><td>1610146</td><td></td></tr><tr><td>10x TBE buffer</td><td>Thermo Fisher</td><td>15581044</td><td></td></tr><tr><td>Nalgene Rapid-Flow&amp;trade; Filter Unit</td><td>Thermo Fisher</td><td>166-0045</td><td></td></tr><tr><td>Kimwipe</td><td>Kimberly-Clark</td><td>34133</td><td></td></tr><tr><td>TEMED</td><td>Thermo Fisher</td><td>17919</td><td></td></tr><tr><td>SYBR-Safe dye</td><td>Thermo Fisher</td><td>S33102</td><td></td></tr><tr><td>6% TBE-urea mini-gel</td><td>Thermo Fisher</td><td>EC6865BOX</td><td></td></tr><tr><td>ChemiDoc</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>T4 PNK</td><td>NEB</td><td>M0201S</td><td></td></tr><tr><td>&amp;gamma;-&lt;sup&gt;32&lt;/sup&gt;P-ATP</td><td>Perkin Elmer</td><td>NEG035C005MC</td><td></td></tr><tr><td>Hyperscreen&amp;trade; Intensifying Screen</td><td>GE Healthcare</td><td>RPN1669</td><td>calcium tungstate phosphor screen</td></tr><tr><td>phosphor storage screen</td><td>Molecular Dynamics</td><td>BAS-IP MS 3543 E</td><td></td></tr><tr><td>Amersham Typhoon</td><td>GE Healthcare</td><td></td><td></td></tr><tr><td>NAI (2M)</td><td>EMD Millipore</td><td>03-310</td><td></td></tr><tr><td>GlycoBlue</td><td>Thermo Fisher</td><td>AM9515</td><td></td></tr><tr><td>SuperScript IV Reverse Transcriptase</td><td>Thermo Fisher</td><td>18090010</td><td>Contains 5x RT buffer, SuperScript IV</td></tr><tr><td>dNTP mix (10 mM)</td><td>Thermo Fisher</td><td>R0192</td><td></td></tr><tr><td>ddNTP set (5 mM)</td><td>Sigma</td><td>GE27-2045-01</td><td></td></tr><tr><td>large filter paper</td><td>Whatman</td><td>1001-917</td><td></td></tr><tr><td>Gel dryer</td><td>Hoefer</td><td>GD 2000</td><td></td></tr><tr><td>QIAamp DNA Blood Mini Kit</td><td>Qiagen</td><td>51104</td><td>Also contains RNase A and protease K</td></tr><tr><td>SMN2 minigene&lt;sup&gt;34&lt;/sup&gt;</td><td>Addgene</td><td>72287</td><td></td></tr><tr><td>Heat inactivated FBS</td><td>Thermo Fisher</td><td>10438026</td><td></td></tr><tr><td>Pen-Strep</td><td>Thermo Fisher</td><td>15140122</td><td></td></tr><tr><td>Opti-MEM I</td><td>Thermo Fisher</td><td>31985062</td><td></td></tr><tr><td>FuGene HD</td><td>Promega</td><td>E2311</td><td></td></tr><tr><td>TrpLE</td><td>Thermo Fisher</td><td>12605010</td><td></td></tr><tr><td>DPBS without Ca/Mg</td><td>Thermo Fisher</td><td>14190250</td><td></td></tr><tr><td>TRIzol</td><td>Thermo Fisher</td><td>15596018</td><td></td></tr><tr><td>RNeasy mini column</td><td>Qiagen</td><td>74104</td><td>Also contains RW1, RPE buffer</td></tr><tr><td>RNase-Free DNase Set</td><td>Qiagen</td><td>79254</td><td>Contains DNase I and RDD buffer</td></tr><tr><td>Deionized formamide</td><td>Thermo Fisher</td><td>AM9342</td><td></td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt;&amp;bull;4H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma-Aldrich</td><td>M3634</td><td></td></tr><tr><td>random nonamer</td><td>Sigma-Aldrich</td><td>R7647</td><td></td></tr><tr><td>SuperScript First-Strand Synthesis System</td><td>Thermo Fisher</td><td>11904-018</td><td>Contains 10x RT buffer, SuperScript II reverse transcriptase</td></tr><tr><td>AccuPrime pfx DNA polymerse</td><td>Thermo Fisher</td><td>12344024</td><td></td></tr><tr><td>NextSeq500</td><td>Illumina</td><td></td><td></td></tr><tr><td>NucAway column</td><td>Thermo Fisher</td><td>AM10070</td><td>for desalting purpose</td></tr></tbody></table>

using in vitro and in-cell shape to investigate small molecule induced pre-mrna structural changes

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences is desired. We herein provide a detailed in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) protocol to study the RNA structural change in the presence of an experimental drug for spinal muscular atrophy (SMA), survival of motor neuron (SMN)-C2, and in exon 7 of the pre-mRNA of the SMN2 gene. In in vitro SHAPE, an RNA sequence of 140 nucleotides containing SMN2 exon 7 is transcribed by T7 RNA polymerase, folded in the presence of SMN-C2, and subsequently modified by a mild 2&#39;-OH acylation reagent, 2-methylnicotinic acid imidazolide (NAI). This 2&#39;-OH-NAI adduct is further probed by a 32P-labeled primer extension and resolved by polyacrylamide gel electrophoresis (PAGE). Conversely, 2&#39;-OH acylation in in-cell SHAPE takes place in situ with SMN-C2 bound cellular RNA in living cells. The pre-mRNA sequence of exon 7 in the SMN2 gene, along with SHAPE-induced mutations in the primer extension, was then amplified by PCR and subject to next-generation sequencing. Comparing the two methodologies, in vitro SHAPE is a more cost-effective method and does not require computational power to visualize results. However, the in vitro SHAPE-derived RNA model sometimes deviates from the secondary structure in a cellular context, likely due to the loss of all interactions with RNA-binding proteins. In-cell SHAPE does not need a radioactive material workplace and yields a more accurate RNA secondary structure in the cellular context. Furthermore, in-cell SHAPE is usually applicable for a larger range of RNA sequences (~1,000 nucleotides) by utilizing next-generation sequencing, compared to in vitro SHAPE (~200 nucleotides) that usually relies on PAGE analysis. In case of exon 7 in SMN2 pre-mRNA, the in vitro and in-cell SHAPE derived RNA models are similar to each other.

We previously demonstrated that an RNA splicing modulator, SMN-C2, interacts with AGGAAG motif on exon 7 of the SMN2 gene&#39;s pre-mRNA, and used SHAPE to assess the RNA structural changes in the presence of SMN-C26. The binding site of SMN-C2 is distinct from the FDA-approved antisense oligonucleotide (ASO) for SMA, nusinersen, which binds and blocks the intronic splicing silencer (ISS) on intron 727,28 (Figure 1A). Most known splicing regulators of SMN2 exon 7 are within the ~100 nucleotide range of exon 7 in the pre-mRNA29; therefore, a 140 and 276 nucleotide-long RNA sequences were used for in vitro and in-cell SHAPE, representatively, which covers exon 7 and the adjacent intron region (Figure 1A).
In this representative in vitro SHAPE analysis, the RNA sequence of interest is embedded into an optimized cassette developed by the Weeks laboratory, which is compatible for most RNA sequences1. Occasionally, the sequence of interest interacts or interferes with this cassette. In these cases, a modified cassette can be used with the following three characteristics: i) a 3&#39;-end specific primer binding site with a more efficient hybridization affinity for the primer than any part of the RNA sequence, ii) a highly structured hairpin loop located directly upstream of the primer binding site that will show specific and reproducible SHAPE signal (this will act as both an internal control for the experiment and method to align the signal from experiment to experiment), and iii) a 5&#39;-end hairpin structure element, which indicates the end of the SHAPE signal. The SHAPE cassette is further flanked with self-cleaving ribozyme sequences at both 5&#39;- and 3&#39;-ends in order to generate a homogenous RNA30. We found that hammerhead and hepatitis delta virus ribozymes are compatible to the SHAPE cassette and usually give high yield of the desired RNA. The resulting template RNA has a 3&#39;-end of 2&#39;,3&#39;-cyclic phosphate and a 5&#39;-end of hydroxyl group, which do not interfere with primer extension. A 140-nucleoside long sequence covering exon 7 of SMN2 and adjacent region in the pre-mRNA was synthesized within SHAPE and ribozyme cassette as illustrated in Scheme 1.
In general, the sequence of interest ligated in the expression cassette should be long enough to cover the potential secondary or higher order of structure. In the case of SMN2 exon 7, a 140-nucleotide region contains two stem-loop structures6,31. The structure of the region of interest varies case-by-case and should be evaluated by trial-and-error.
Polyacrylamide sequencing gel with 32P-labeled primer extension products was chosen to visualize the in vitro SHAPE profile in this representative experiment. An alternative visualization method is to use capillary electrophoresis with a fluorescently labeled DNA primer32. In polyacrylamide sequencing gels, ~20 nucleosides near the 5&#39;-end and ~10 nucleotides near the 3&#39;-end of the RNA sequence of interest will not be visualized quantitatively, due to occasionally stops at the initiation steps of reverse transcription and intense bands on PAGE gels for full-length transcripts1.
An alternative way for preparative gel recovery of an RNA template (steps 1.1.6 to 1.1.12) is to overload a mini-gel if the yield of desired RNA template is &#62;90%. It is advised to remove the excess NTP from the RNA product by desalting the column and eluting the RNA in 50 &#181;L of TE buffer. Measure the concentration of the RNA and load 5.0 &#181;g in each well. During the purification step of the T7 transcribed RNA template, stop the PAGE when the xylene cyanol FF dye (light blue) passed two-thirds of the 6% denatured TBE-urea gel. The self-cleavage RNA fragment (&#60;80 nucleosides) passed through the gel, which left the desired RNA as the only major band in the gel upon staining (Figure 1B).
SMN-C2 (Figure 1C) was synthesized according to the published procedure33 and dissolved in 10 mM DMSO stock solution. The stock solution is further diluted into 500 and 50 &#181;M in 10% DMSO solution to achieve final concentrations of 50 and 5 &#181;M, respectively. Snap-cooled RNA refolded to its equilibrium stage in the presence of DMSO or SMN-C2 within 30 min at 37 &#176;C. A longer incubation time did not change the outcome of the experiment. Two experimental samples (50 and 5 &#181;M SMN-C2), two controls (DMSO and NAI- controls), and four markers (A, T, G, C) were treated for primer extension. After exposing the gel to phosphor storage screen, a successful SHAPE experiment will show: i) a single and most-intense band at the top of the gel and ii) bands throughout the gel at single-nucleotide resolution without smear (Figure 1D). A common problem in PAGE analysis is that a smear region known as the &#34;salt front&#34; may appear in the middle of the gel (Figure 1E). This is probably due to high concentration of salt, DMSO, or other unwanted substance in the loading sample that can be removed by ethanol precipitation.
In in vitro SHAPE, a pure RNA template is the key for a successful experiment. An impure RNA template is usually the cause of undesired results. If PAGE analysis clearly shows a pattern of 2 sets of markers, it indicates that the RNA template is not homogenous and needs to be repurified by preparative TBE-urea gel.
For in-cell SHAPE, a key to a successful experiment is to design an optimized primer set for amplification. With 0.10 &#181;g of genomic DNA-free cDNA template, a single band should be observed within 25 PCR cycles in agarose gel analysis. The repetitive intron sequences should therefore be avoided. To study the structural impact of SMN-C2 on SMN2 pre-mRNA, three primer sets (Table 2) was tested, and all were satisfactory (Figure 2A).
A low copy number of a target RNA sequence is generally a problem for in-cell SHAPE. To enrich the RNA of interest, a minigene that contains the RNA sequence of interest under a strong CMV promoter was transfected into 293T cells. Because the splicing pattern of the SMN2 minigene recapitulates that of endogenous SMN2 with or without SMN-C219,34, we envision that the structure of SMN-C2 interacting RNA in the overexpressed SMN2 pre-mRNA likely was the same as the endogenous gene product. While the EC50 of SMN-C3 in the splicing assay was ~0.1 &#181;M6,19, a concentration at the higher end (20 &#181;M) was used to ensure the binding state of the small molecule and target RNA sequence.
Upon isolation of the RNA, both gene-specific and random primers can be used for extension. In the case of exon 7 of SMN2, we found that SMN2E7-338-RV (Table 2) yields a higher copy of desired cDNA than a random nonamer, evidenced by a more intense band in the PCR amplification with SMN2E7-276 primer set (Table 2) after 25 cycles. In the 2&#39;-OH modification step, a 91 &#181;M final NAI concentration was used for an incubation period of 15 min. If a different cell type or medium is used, the incubation time must be re-optimized. If the incubation time is too long, agarose gel analysis of the amplicon will sometimes fail to show a band.
A python-based program, ShapeMapper, developed by the Weeks laboratory35 was used to analyze the data generated by next-generation sequencing [for raw data of SMN-C2 treated in-cell SHAPE of SMN2 exon 7 pre-mRNA, refer to the Sequence Read Archive (SRA) database]. Throughout the amplicon, the SHAPE reactivity did not significantly change (&#62;1), which indicated that the secondary structure remains in the presence of SMN-C2 (Figure 2B). This is also confirmed by the arc plots generated by SuperFold35. The connection lines indicate the possible base pairing based on SHAPE activity of each nucleotide. SMN-C2- and DMSO-treated RNA modeling is essentially the same (Figure 2C). Differential in-cell SHAPE reactivity was calculated for each nucleotide (Figure 2B), and the most reactivity change occurred at TSL-1 (5&#39;-end of exon 7) but not TSL-2 (3&#39;-end of exon 7). This result agrees with the in vitro SHAPE; although, the base pairing shifted from in vitro SHAPE RNA modeling in the in-cell SHAPE analyses (Figure 2D).
A common problem of in-cell SHAPE is the low mutation rate throughout the amplicon. This is usually due to genomic DNA contamination. DNA does not contain 2&#39;-OH group; therefore, no acylation product is formed with NAI. PCR amplification thus merely reflects the low mutation rate of the DNA polymerase. Isolation of RNA by guanidinium thiocyanate followed by on-column DNase digestion is sufficient to remove all DNA in most cases. If DNA contamination persists, repeat step 2.3 for RNA isolation.
<img alt="Scheme 1" src="/files/ftp_upload/59021/59021fig0.jpg" /> 
Scheme 1: DNA sequence for the template of RNA transcription. The 12 bp sequence within the Hammerhead virus ribozyme sequence in red is the reverse complement of the first 12 bp of the 5&#39;-cassette. The RNA sequence of interest presented herein is a 140 bp pre-mRNA sequence contains exon 7 of human SMN2 gene. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59021/59021fig0large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59021/59021fig1.jpg" /> 
Figure 1: Experimental design and result of in vitro SHAPE for SMN2 exon 7 pre-mRNA in the presence of SMN-C2. (A) Overview of the sequence of interest for in vitro and in-cell SHAPE studies of the SMN2 gene. SMN-C2 binds to the AGGAAG motif on exon 7, a distinct location from the nusinersen binding site. (B) Purification of the T7 transcription product. Each of the three lanes contains 5.0 &#181;g of crude RNA. The TBE-urea gel was stained with SYBR-Safe (1:10,000) for 5 min in 1x TBE buffer. Red dashed box indicates the edge of excision for RNA recovery. (C) The structure of SMN-C2. (D) In vitro SHAPE experiment with NAI and a 140 nucleotide-long RNA template containing exon 7. 1 = DMSO; 2 = SMN-C2 (50 &#181;M); 3 = SMN-C2 (5 &#181;M); 4 = lacking of NAI; 5-8 = ladders generated by addition of ddATP, ddTTP, ddCTP, and ddGTP during primer extension. PAGE was carried out on a TBE-urea sequencing gel at 60 W for 3 h. Red asterisks indicate increased band intensity with 50 &#181;M SMN-C26. (E) An example of a &#34;salt front&#34; region in the dashed red box from a separate experiment. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59021/59021fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59021/59021fig2.jpg" /> 
Figure 2: In-cell SHAPE derived RNA modeling for SMN2 exon 7 pre-mRNA. (A) PCR amplification with all three primer sets (Table 2) yielded a single band in agarose gel analysis. 1 = SMN2E7-338, 2 = SMNE7-276, 3 = SMN2E7-251, 4 = DNA ladder. (B) Differential in-cell SHAPE reactivity in SMN2 minigene-transfected 293T cells for 10 &#181;M SMN-C2 and DMSO in TSL1. SHAPE reactivity at single-nucleotide resolution. Its standard deviation was calculated by ShapeMapper software35. Green asterisks indicate significant SHAPE reactivity change induced by 10 &#181;M SMN-C2. The numbering of the nucleotides in the 276 bp amplicon shown on x-axis. Error bars were estimated by Shape-Mapper software26. (C) Arc plot generated by SuperFold35 for the most plausible RNA secondary structure modeling by in-cell SHAPE data. (D) In vitro and&#160;in-cell SHAPE-directed modeling of exon 7 and adjacent regions. For in vitro RNA model, SHAPE stabilizing cassette (orange) and nucleotides 1-19 (blue) are shown in sketch. For&#160;in-cell RNA model, nucleotide numbering is aligned with in vitro SHAPE template. Nucleotides 1-18 and 120-140 were omitted. Significant reactivity changes are indicated in red and green asterisks for in vitro and in-cell SHAPE, respectively. The secondary structures that were previously named TSL1 and TSL231 are enclosed in blue boxes. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59021/59021fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>5&#39;-3&#39; Sequence</td>
		</tr>
		<tr>
			<td>Ribozyme-FW</td>
			<td>TAAAACGACGGCCAGTGAAT</td>
		</tr>
		<tr>
			<td>Ribozyme-RV</td>
			<td>GCAGGTCGACTCTAGAGGAT</td>
		</tr>
		<tr>
			<td>RT primer</td>
			<td>GAACCGGACCGAAGCCCG</td>
		</tr>
	</tbody>
</table>
Table 1: The primer sequences used in the representative experiment. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequence (5&#39;-&#62;3&#39;)</td>
		</tr>
		<tr>
			<td>SMN2E7-338-FW</td>
			<td>AAAGACTATCAACTTAATTTCTGA</td>
		</tr>
		<tr>
			<td>SMN2E7-338-RV</td>
			<td>TGTTTTACATTAACCTTTCAACT</td>
		</tr>
		<tr>
			<td>SMN2E7-276-FW</td>
			<td>AATGTCTTGTGAAACAAAATGCT</td>
		</tr>
		<tr>
			<td>SMN2E7-276-RV</td>
			<td>AACCTTTCAACTTTCTAACATCT</td>
		</tr>
		<tr>
			<td>SMN2E7-251-FW</td>
			<td>TGAAACAAAATGCTTTTTAACATCC</td>
		</tr>
		<tr>
			<td>SMN2E7-251-RV</td>
			<td>TCAACTTTCTAACATCTGAACTTTT</td>
		</tr>
	</tbody>
</table>
Table 2: The primer sets for amplification of the pre-mRNA sequence of interest. All three primer sets yield a single amplicon in a PCR reaction with genomic DNA-free cDNA template.

Watch this Scientific Journal Video about Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes at JoVE.com

Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

Detailed protocols for both in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) experiments to determine the secondary structure of pre-mRNA sequences of interest in the presence of an RNA-targeting small molecule are presented in this article.

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences ...

using-vitro-cell-shape-to-investigate-small-molecule-induced-pre-mrna

Nanyang Technological University

Research

JoVE Journal

Genetics

8.2K Views.  The Scripps Research Institute. Detailed protocols for both in vitro and in-cell selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) experiments to determine the secondary structure of pre-mRNA sequences of interest in the presence of an RNA-targeting small molecule are presented in this article.

Video: Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

An In Vitro Assay to Detect tRNA-Isopentenyl Transferase Activity

N6-isopentenyladenosine RNA modifications are functionally diverse and highly conserved among prokaryotes and eukaryotes. One of the most highly conserved N6-isopentenyladenosine modifications occurs at the A37 position in a subset of tRNAs. This modification improves translation efficiency and fidelity by increasing the affinity of the tRNA for the ribosome. Mutation of enzymes responsible for this modification in eukaryotes are associated with several disease states, including mitochondrial dysfunction and cancer. Therefore, understanding the substrate specificity and biochemical activities of these enzymes is important for understanding of normal and pathologic eukaryotic biology. A diverse array of methods has been employed to characterize i6A modifications. Herein is described a direct approach for the detection of isopentenylation by Mod5. This method utilizes incubation of RNAs with a recombinant isopentenyl transferase, followed by RNase T1 digestion, and 1-dimensional gel electrophoresis analysis to detect i6A modifications. In addition, the potential adaptability of this protocol to characterize other RNA-modifying enzymes is discussed.

An In Vitro Assay to Detect tRNA-Isopentenyl Transferase Activity

Here, we describe a protocol for the biochemical characterization of the yeast RNA-modifying enzyme, Mod5, and discuss how this protocol could be applied to other RNA-modifying enzymes.

N6-isopentenyladenosine RNA modifications are functionally diverse and highly conserved among prokaryotes and eukaryotes. One of the most highly conserved ...

Biochemistry

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

Extremely Rapid and Specific Metabolic Labelling of RNA In Vivo with 4-Thiouracil (Ers4tU)

The nucleotide analogue, 4-thiouracil (4tU), is readily taken up by cells and incorporated into RNA as it is transcribed in vivo, allowing isolation of the RNA produced during a brief period of labelling. This is done by attaching a biotin moiety to the incorporated thio group and affinity purifying, using streptavidin coated beads. Achieving a good yield of pure, newly synthesized RNA that is free of pre-existing RNA makes shorter labelling times possible and permits increased temporal resolution in kinetic studies. This is a protocol for very specific, high yield purification of newly synthesized RNA. The protocol presented here describes how RNA is extracted from the yeast Saccharomyces cerevisiae. However, the protocol for purification of thiolated RNA from total RNA should be effective using RNA from any organism once it has been extracted from the cells. The purified RNA is suitable for analysis by many widely used techniques, such as reverse transcriptase-qPCR, RNA-seq and SLAM-seq. The specificity, sensitivity and flexibility of this technique allow unparalleled insights into RNA metabolism.

Extremely Rapid and Specific Metabolic Labelling of RNA In Vivo with 4-Thiouracil Ers4tU

The use of thiolated uracil to sensitively and specifically purify newly transcribed RNA from the yeast Saccharomyces cerevisiae.

The nucleotide analogue, 4-thiouracil (4tU), is readily taken up by cells and incorporated into RNA as it is transcribed in vivo, allowing isolation of ...

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biology

Probing RNA Structure with Dimethyl Sulfate Mutational Profiling with Sequencing In Vitro and in Cells

The role of RNA structure in virtually any biological process has become increasingly evident, especially in the past decade. However, classical approaches to solving RNA structure, such as RNA crystallography or cryo-EM, have failed to keep up with the rapidly evolving field and the need for high-throughput solutions. Mutational profiling with sequencing using dimethyl sulfate (DMS) MaPseq is a sequencing-based approach to infer the RNA structure from a base&#39;s reactivity with DMS. DMS methylates the N1 nitrogen in adenosines and the N3 in cytosines at their Watson-Crick face when the base is unpaired. Reverse-transcribing the modified RNA with the thermostable group II intron reverse transcriptase (TGIRT-III) leads to the methylated bases being incorporated as mutations into the cDNA. When sequencing the resulting cDNA and mapping it back to a reference transcript, the relative mutation rates for each base are indicative of the base&#39;s &#34;status&#34; as paired or unpaired. Even though DMS reactivities have a high signal-to-noise ratio both in vitro and in cells, this method is sensitive to bias in the handling procedures. To reduce this bias, this paper provides a protocol for RNA treatment with DMS in cells and with in vitro transcribed RNA.

Probing RNA Structure with Dimethyl Sulfate Mutational Profiling with Sequencing In Vitro and in Cells

The protocol provides instruction for modifying RNA with dimethyl sulfate for mutational profiling experiments. It includes in vitro and in vivo probing with two alternative library preparation methods.

The role of RNA structure in virtually any biological process has become increasingly evident, especially in the past decade. However, classical ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an application of smFISH to measure the rates of transcription and mRNA degradation in Escherichia coli. As smFISH is based on fixed cells, we perform smFISH at multiple time points during a time-course experiment, i.e., when cells are undergoing synchronized changes upon induction or repression of gene expression. At each time point, sub-regions of an mRNA are spectrally distinguished to probe transcription elongation and premature termination. The outcome of this protocol also allows for analyzing intracellular localization of mRNAs and heterogeneity in mRNA copy numbers among cells. Using this protocol many samples (~50) can be processed within 8 h, like the amount of time needed for just a few samples. We discuss how to apply this protocol to study the transcription and degradation kinetics of different mRNAs in bacterial cells.

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an ...

Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

Summary

Explore More Videos

Chapters in this video

An In Vitro Assay to Detect tRNA-Isopentenyl Transferase Activity

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Extremely Rapid and Specific Metabolic Labelling of RNA In Vivo with 4-Thiouracil (Ers4tU)

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Probing RNA Structure with Dimethyl Sulfate Mutational Profiling with Sequencing In Vitro and in Cells

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization