Name: plant growth and agrobacterium-mediated floral-dip transformation of the extremophyte schrenkiella parvula
Uploaded: 2019-01-07T14:00:00.000+00:00
Duration: 6 min 32 s
Description: Watch this Scientific Journal Video about Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula at JoVE.com

This work was supported by a National Science Foundation award MCB 1616827.

1. Plant Growth
<ol>
	<li>Seed sterilization (optional)
	<ol>
		<li>Prepare 50% bleach in double-distilled water (ddH2O) with 1 or 2 drops of a non-ionic detergent (see Table of Materials) in a 50 mL tube. Invert the tube several times to mix the solution. 
		NOTE: It is preferable to conduct seed sterilization in a laminar flow cabinet with a UV sterilized surface for 15 min.</li>
		<li>Add the bleach solution to ~100&#8211;200 S. parvula seeds in a 1.5 mL tube. Mix thoroughly and let the tube sit for 5 min.</li>
		<li>Remove the bleach from the tube and add 70% ethanol. Wash the seeds by pipetting several times and then remove the ethanol solution immediately.</li>
		<li>Wash the seeds in sterilized water to remove excess bleach and ethanol, then remove the water. Repeat this step 5 to 6 times.</li>
	</ol>
	</li>
	<li>Seed stratification
	<ol>
		<li>Immerse the seeds in sterilized water, and store for 5 to 7 days at 4 &#176;C. Alternatively, sow dried unsterilized seeds directly on wet soil, and place the soil tray for 5 to 7 days at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Growing plants in preparation of transformation
	<ol>
		<li>Fill the soil mix (see Table of Materials) into 7 x 6 cm2 pots, soak the pots in water, and spray water from the top to ensure a uniformly wet growth medium. Add 5&#8211; fertilizer beads (see Table of Materials) on the soil surface of each pot. 
		NOTE: As far as we have experienced, S. parvula grows well on any soil mix where A. thaliana can grow.</li>
		<li>Using a wet toothpick, transfer 20~25 seeds per pot on the soil surface. 
		NOTE: A convenient practice is to put a batch of 4&#8211;5 seeds in the four corners and the center of the pot (Figure 1, Day 15, left panel).</li>
		<li>Cover the pot tray with a clear dome to keep the seeds under high humidity during germination.</li>
		<li>Keep the plant trays in a growth chamber with a light intensity set at 130 &#181;mol m&#8722;2 s&#8722;1 light, 22&#8211;24 &#176;C temperature, and 14 h per day/10 h per night cycle. Remove the domes after 7 - 10 days following germination. Add water from the bottom of the tray to keep soil moistened uniformly at a desirable level.</li>
		<li>Weed out extra seedlings and leave only 4&#8211;5 healthy seedlings per pot well separated from each other (Figure 1, Day 15, right panel).</li>
		<li>Gently water the plants every two days and fertilize with 0.2x Hoagland&#39;s solution16 once every two weeks. 
		NOTE: Keeping the soil moisture at a uniform level is key to growing S. parvula consistently and healthily.</li>
		<li>Continue to grow the plants for 8&#8211;10 weeks until multiple inflorescences produce 100&#8211;150 floral buds per plant (Figure 1, Day 60&#8211;80). On the day planned for the floral-dip based transformation (step 4.5), remove all mature and developing siliques from the plants.</li>
	</ol>
	</li>
</ol>
2. Cloning the Gene/Genomic Element of Interest into a Vector for Plant Transformation
<ol>
	<li>Amplify the target DNA fragment using polymerase chain reaction (PCR)17 and isolate the PCR product using a gel extraction kit (see Table of Materials) according to the kit protocol or any other appropriate method to purify DNA using agarose gel electrophoresis17,18. Verify the sequence of the isolated PCR product through Sanger sequencing19.</li>
	<li>Clone the desired PCR product into the cloning vector and transform the cloned construct into the competent E. coli cells using a topoisomerase-based cloning kit (see Table of Materials) following manufacturer&#39;s guidelines.</li>
	<li>Spread 50 &#181;L of transformed products on Luria-Bertani20 (LB) agar bacterial growth media (Table 1) with appropriate antibiotics, e.g., 50 &#181;g/ mL Spectinomycin (see Table of Materials), and incubate at 37 &#176;C overnight.</li>
	<li>The following day, select 5&#8211;10 single colonies, inoculate into liquid LB medium with appropriate antibiotics, and incubate with gentle shaking at 37 &#176;C overnight.</li>
	<li>Isolate plasmids using a plasmid isolation kit (see Table of Materials) and verify through Sanger sequencing19 whether the target sequence amplified in 2.1 is properly cloned.</li>
	<li>Transfer the cloned and verified PCR product to a destination vector for plant transformation compatible with recombination-based cloning (see Table of Materials), using a recombinase enzyme mix kit (see Table of Materials), following the kit manufacturer&#39;s instruction. Repeat from step 2.3 to step 2.5 to isolate and verify clones harboring proper plasmid constructs.</li>
</ol>
3. Transforming the Vector Construct for Plant Transformation into Agrobacterium tumefaciens
<ol>
	<li>Transform the plasmid of the vector construct from 2.6 into the A. tumefaciens&#160;strain GV3101:pMP90RK21, which harbors a Rifampicin resistance gene for chromosomal background selection. Use appropriate antibiotics, e.g. Gentamycin or Kanamycin (see Table of Materials), for the selection of plant transformation construct (Ti plasmid). A brief protocol for A. tumefaciens transformation via electroporation is included in section 3.2.</li>
	<li>A. tumefaciens transformation by electroporation
	<ol>
		<li>Thaw the A. tumefaciens competent cells22 on ice. Mix 0.1&#8211;1 &#181;g of the plasmid prepared from 2.6, dissolved in 1&#8211;2 &#181;L of ddH2O, with competent cells on ice. Transfer the mixture into an electroporation cuvette (see Table of Materials).</li>
		<li>Perform electroporation on the mixture of plasmids and competent cells from 3.2.1, using an electroporator (see Table of Materials) following the manufacturer&#39;s guidelines. 
		NOTE: Clean the surface of the cuvette before starting the electroporation.</li>
		<li>Transfer the reaction mixture from the cuvette to a microcentrifuge tube that contains 1.5 mL of liquid LB and mix well with pipetting and incubate for 1 h at 28 &#176;C with gentle shaking.</li>
	</ol>
	</li>
	<li>Inoculate the transformed A. tumefaciens from section 3.2 on LB plates containing appropriate selection antibiotics (e.g. Kanamycin 25 &#181;g/ mL, Spectinomycin 50 &#181;g/ mL, Gentamycin 25 &#181;g/ mL, and Rifampicin 50 &#181;g/ mL) and incubate at 28 &#176;C for 3 days.</li>
</ol>
4. Agrobacterium-mediated Transformation of S. parvula
<ol>
	<li>Inoculate the single transformed colonies from plates into 10 mL of LB liquid media containing antibiotics (the same as in 3.3) in a sterile 50 mL conical tube (see Table of Materials). Incubate for 24 h in a shaking incubator (see Table of Materials) at 250 r.p.m. at 28 &#176;C.</li>
	<li>Transfer the bacterial solution from 3.4.1 to a sterile 250 mL flask, add 40 mL of LB liquid media with appropriate antibiotics, and incubate 12 h until the optical density at 600 nm wavelength (OD600) reaches around 2.0.</li>
	<li>Centrifuge the A. tumefaciens&#160;cultureat 3,100 x g for 10 min. Remove the supernatant and re-suspend the bacterial culture in 40 mL of A. tumefaciens&#160;infiltration solution (Table 1).</li>
	<li>Dilute the resuspended A. tumefaciens with infiltration solution to a final OD600 of 0.8. Add 25 &#181;L of surfactant solution (Table 1) to 50 mL of diluted A. tumefaciens solution and mix by inverting several times.</li>
	<li>Dip the inflorescence of the plants in the A. tumefaciens solution prepared in the section 4.4 for 20 s. Use a fresh bacterial solution after dipping inflorescence from six pots. Make sure all flowers are in contact with the solution. Pipet bacterial solutions directly onto flowers located in the lower part of the inflorescence if they cannot be dipped into the solution. 
	NOTE: For the first-round transformation, make sure to remove all mature and developing siliques using a sharp scalpel or small scissors. Do not remove siliques if performing transformation for the second time.</li>
</ol>
5. Post-transformation Plant Care and the Second Transformation
<ol>
	<li>Place the floral-dipped plants horizontally in clean trays with domes to cover the plants and place in a dark growth room for 1&#8211;2 days. 
	NOTE: Keeping the flowers under high-humidity is important at this stage (Figure 1, Plants after transformation).</li>
	<li>Return the plants to an upright position and transfer the plants to a growth room with a 14 h per day/10 h per night cycle, 130 &#181;mol m-2 s-1 light intensity and 22 to 24 &#176;C temperature.</li>
	<li>Monitor the dipped inflorescences in the following week. If a significant number of flowers abort (Figure 2), repeat the floral dip (step 4) after about 4 weeks or after a large number of flowers have newly developed. 
	NOTE: Unlike the preparation step for the first transformation (step 1.3.7), do not remove pre-existing or developing siliques (Figure 2) before the second round of transformation.</li>
	<li>Grow the plants until seeds mature and harvest seeds at ~21 weeks.</li>
	<li>Dry seeds for 2&#8211;3 weeks at room temperature in an airtight container with filled with desiccants (see Table of Materials).</li>
</ol>
6. Selection of Positive Transformants
<ol>
	<li>Plant the T1 seeds as described for wild type seeds in steps 1.2 to 1.3.</li>
	<li>Grow the plants until the first 2&#160;true leaves develop, approximately 10&#8211;14 days after germination.</li>
	<li>Perform the first selection for herbicide resistance (Figure 3A and 3B) as detailed below.
	<ol>
		<li>Dilute the glufosinate-ammonium (11.3%) herbicide (or BASTA) (Table 1) to 1:1,000 (v/v). Spray diluted BASTA solution on the seedlings and cover the plants with domes overnight.</li>
		<li>Repeat BASTA spraying 2&#8211;3 times every 5&#8211;7 days.</li>
	</ol>
	</li>
	<li>Perform the second selection using a BASTA-drop test as detailed below.
	<ol>
		<li>Identify plants that survive after being sprayed 3&#8211;4 times with BASTA solution. Grow the plants for another 2&#8211;3 weeks until 3&#8211;5 leaves develop a relatively large surface area.</li>
		<li>Select the largest mature leaf per plant, rub the surface of the leaf gently with a finger to remove the wax layer, and place a drop of the diluted BASTA solution (from step 6.3.1). 
		NOTE: Mark the location of the leaf applied with the BASTA drop by placing a paper tape on the nearest stem.</li>
		<li>Monitor the leaves applied with the BASTA drop for signs of wilting for up to one week. Select the plants with leaves unaffected by the BASTA drops. 
		NOTE: Leaves from most false-positive plants start to wilt within two days, while leaves from true-positives are intact even after the drop of BASTA solution dries up (Figure 3C).</li>
	</ol>
	</li>
	<li>Confirm positive transformants using genomic PCR.
	<ol>
		<li>Collect 2&#8211;3 leaves from the surviving plants at step 6.4.5.</li>
		<li>Extract genomic DNA from the leaves using the CTAB method23 or any other appropriate DNA extraction method.</li>
		<li>Perform PCR using extracted genomic DNA samples from target plants, wild-type plants (as negative controls), and the plasmid construct from the step 3.1 (as a positive control). Use an appropriate pair of PCR primers specific to the selective marker gene, e.g., for BASTA-resistant gene (bar), TCAGCAGGTGGGTGTAGA (forward) and GTCAACCACTACATCGAGACAA (reverse).
		<ol>
			<li>For the example PCR primers targeting the bar gene, use the following PCR conditions: the initial denaturation step at 98 &#176;C for 30 s; followed by 30 cycles of denaturing at 98 &#176;C for 30 s, annealing at 59 &#176;C for 30 s, and extending at 72 &#176;C for 30 s; and the final extension at 72 &#176;C for 5 min. 
			NOTE: To ensure the insertion of the entire T-DNA, we recommend also performing genomic PCR using a PCR primer from the selective marker gene and another PCR primer specific to the target sequence cloned to the plant transformation vector at the step</li>
		</ol>
		</li>
		<li>Confirm the presence of the expected size of the amplified bar PCR product by agarose gel electrophoresis17 for the target samples (Figure 4A) as well as by sequencing the isolated PCR product19 using the same procedure as in step 2.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Dassanayake, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+extremophile+crucifer+Thellungiella+parvula.">The genome of the extremophile crucifer Thellungiella parvula.</a> Nature Genetics. 43 (9), 913-918 (2011).</li><li>Oh, D. -. H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Life+at+the+extreme:+lessons+from+the+genome.">Life at the extreme: lessons from the genome.</a> Genome Biology. 13 (3), 241 (2012).</li><li>Whited, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Next+Top+Models.">The Next Top Models.</a> Cell. 163 (1), 18-20 (2015).</li><li>Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+scope+of+things+to+come:+New+paradigms+in+biotechnology.">The scope of things to come: New paradigms in biotechnology.</a> Plant Biotechnology and Agriculture: Prospects for the 21st Century. , 19-34 (2009).</li><li>Dittami, S. M., Tonon, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomes+of+extremophile+crucifers:+New+platforms+for+comparative+genomics+and+beyond.">Genomes of extremophile crucifers: New platforms for comparative genomics and beyond.</a> Genome Biology. 13 (8), 166 (2012).</li><li>Amtmann, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Learning+from+evolution:+Thellungiella+generates+new+knowledge+on+essential+and+critical+components+of+abiotic+stress+tolerance+in+plants.">Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants.</a> Molecular Plant. 2 (1), 3-12 (2009).</li><li>Oh, D. -. H., Hong, H., Lee, S. Y., Yun, D. -. J., Bohnert, H. J., Dassanayake, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+structures+and+transcriptomes+signify+niche+adaptation+for+the+multiple-ion-tolerant+extremophyte+Schrenkiella+parvula.">Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula.</a> Plant Physiology. 164 (4), 2123-2138 (2014).</li><li>Orsini, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparative+study+of+salt+tolerance+parameters+in+11+wild+relatives+of+Arabidopsis+thaliana.">A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana.</a> Journal of Experimental Botany. 61 (13), 3787-3798 (2010).</li><li>Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+alternative+electron+sinks+and+antioxidant+defence+in+chloroplasts+of+the+extreme+halophyte+Eutrema+parvulum+(Thellungiella+parvula)+under+salinity.">Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity.</a> Annals of Botany. 115 (3), 449-463 (2015).</li><li>Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cuticular+waxes+on+Arabidopsis+thaliana+close+relatives+Thellungiella+halophila+and+Thellungiella+parvula.">Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula.</a> International Journal of Plant Sciences. 163 (2), 309-315 (2002).</li><li>Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+roles+for+SOS1+in+the+convergent+evolution+of+salt+tolerance+in+Eutrema+salsugineum+and+Schrenkiella+parvula.">Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula.</a> Molecular Biology and Evolution. 31 (8), 2094-2107 (2014).</li><li>Clough, S. J., Bent, A. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Floral+dip:+A+simplified+method+for+Agrobacterium-mediated+transformation+of+Arabidopsis+thaliana.">Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.</a> Plant Journal. 16 (6), 735-743 (1998).</li><li>Koornneef, M., Meinke, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Arabidopsis+as+a+model+plant.">The development of Arabidopsis as a model plant.</a> Plant Journal. 61 (6), 909-921 (2010).</li><li>Bai, J., Wu, F., Mao, Y., He, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+planta+transformation+of+Brassica+rapa+and+B.+napus+via+vernalization-infiltration+methods.">In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods.</a> Protocol Exchange. 10, 1028 (2013).</li><li>Sparrow, P. A. C., Goldsack, C. M. P., &#216;stergaard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+technology+in+the+Brassicaceae.">Transformation technology in the Brassicaceae.</a> Genetics and Genomics of the Brassicaceae. , 505-525 (2011).</li><li>Hoagland, D. R., Arnon, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+water-culture+method+for+growing+plants+without+soil.">The water-culture method for growing plants without soil.</a> California Agricultural Experiment Station Circular. 347 (347), 1-32 (1950).</li><li>Saiki, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239 (4839), 487-491 (1988).</li><li>Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Quick,+cost-free+method+of+purification+of+dna+fragments+from+agarose+gel.">A Quick, cost-free method of purification of dna fragments from agarose gel.</a> Journal of Cancer. 3, 93-95 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).</li><li>Bertani, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+Lysogenesis+I.+The+mode+of+phage+liberation+by+lysogenic+Eschericia+coli.">Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli.</a> Journal of Bacteriolgy. 62 (3), 293-300 (1951).</li><li>Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+vectors+for+gene+tagging+and+expression+studies.">Specialized vectors for gene tagging and expression studies.</a> Plant Molecular Biology Manual. , 53-74 (1994).</li><li>Weigel, D., Glazebrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Agrobacterium+using+electroporation.">Transformation of Agrobacterium using electroporation.</a> Cold Spring Harbor Protocols. 2006 (30), (2006).</li><li>Murray, M. G., Thompson, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+isolation+of+high+molecular+weight+plant+DNA.">Rapid isolation of high molecular weight plant DNA.</a> Nucleic Acids Research. 8 (19), 4321-4326 (1980).</li><li>Inan, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt+cress.+a+halophyte+and+cryophyte+Arabidopsis+relative+model+system+and+its+applicability+to+molecular+genetic+analyses+of+growth+and+development+of+extremophiles.">Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles.</a> Plant Physiol. 135 (3), 1718-1737 (2004).</li><li>Ghedira, R., De Buck, S., Nolf, J., Depicker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+efficiency+of+Arabidopsis+thaliana+floral+dip+transformation+is+determined+not+only+by+the+Agrobacterium+strain+used+but+also+by+the+physiology+and+the+ecotype+of+the+dipped+plant.">The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant.</a> Molecular Plant-Microbe Interactions. 26 (7), 823-832 (2013).</li><li>Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Brassica+napus+with+the+method+of+floral-dip.">Transformation of Brassica napus with the method of floral-dip.</a> Biotechnology: Genomics and Its Applications. , 45-49 (2005).</li><li>Li, J., Tan, X., Zhu, F., Guo, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+simple+method+for+Brassica+napus+floral-dip+transformation+and+selection+of+transgenic+plantlets.">A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets.</a> International Journal of Biology. 2 (1), 127 (2010).</li><li>Li, H. Q., Xu, J., Chen, L., Li, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+an+efficient+Agrobacterium+tumefaciens-mediated+leaf+disc+transformation+of+Thellungiella+halophila.">Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila.</a> Plant Cell Reports. 26 (10), 1785-1789 (2007).</li><li>Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Traffic+lines:+New+tools+for+genetic+analysis+in+Arabidopsis+thaliana.">Traffic lines: New tools for genetic analysis in Arabidopsis thaliana.</a> Genetics. 200 (1), 35-45 (2015).</li></ol>

The authors have nothing to disclose.

The physiological state of the plant significantly influences the efficiency of transformation25. The use of healthy and vigorous plants for transformation is a key requirement for successful transformation in S. parvula. Water or light stressed plants will have fewer flowers compared to the healthy plants ideal for transformation (Figure 1, center panel). S. parvula can grow at a light intensity less than 130 &#181;mol m-2 s-1, but the plants tend to be frailer; such plants would lead to more aborted flowers following floral-dip. S. parvula tends to abort Agrobacterium-dipped flowers at a higher rate than A. thaliana. Therefore, every step taken to minimize aborted flowers when dipped in the A. tumefaciens&#160;infiltration solution contributes to a higher transformation efficiency. We recommend a light period no longer than 14 h per day. Often, transformation of A. thaliana is performed on plants grown in a long-day condition (e.g. 18 h light and 6 h dark) or even under continuous light. However, we found such practices result in less resilient S. parvula plants and lead to a low transformation efficiency.
Flower buds are continuously produced on the inflorescence axes of S. parvula (Figure 2, white arrows). Therefore, allowing transformation of new flowers would significantly increase the chance of getting positive transformants. A second floral-dip (step 5.3) is not essential, but strongly suggested. However, this step is relatively time consuming compared to A. thaliana floral dipping, because S. parvula produces multiple inflorescence axes.
Wild-type S. parvula is sensitive to BASTA, although the initial screen for positive transformants with BASTA spray (step 6.3) will leave 5&#8211;8 surviving plants out of 100 seeds germinated (Figure 3A and 3B). Most of this (&#62;80%) will be false positives. This is largely due to the narrow leaf shape and the leaf angle of S. parvula, which do not provide sufficient leaf surface in an appropriate orientation to retain the BASTA solution for a sufficient duration to observe a phenotype. Additionally, due to the high wax content of the adaxial leaf surface of S. parvula10, it tends to create a more impervious surface for BASTA. Therefore, the second screening for positive transformants using a BASTA drop on individual leaves (step 6.4, Figure 3C) is an essential step to avoid PCR testing on hundreds of false positives (step 6.5).
The current protocol was tested with the A. tumefaciens strain GV3101 carrying the pMP90RK plasmid. The efficiency of transformation may be improved with other A. tumefaciens strains, including strains ABI, LMG20, and C58C1 Rifr, with the pMP90 virulence plasmid reported to increase transformation efficiency in A. thaliana25. Brassica and Eutrema species are taxonomically more closely related to S. parvula compared to A. thaliana1. Therefore, the A. tumefaciens strain LBA4404 that was successfully used to transform Brassica napus and the strain EHA105 that has been used successfully to transform Eutrema salsugineum may offer a higher transformation efficiency than the reported efficiency of the strain currently used26,27,28.
Reducing the time and labor required by a transformation protocol is another significant factor in improving the transformation efficiency. Placing individual BASTA drops on leaves and monitoring the leaf for a week on multiple plants (step 6.4) are tedious. A future effort to increase the transformation efficiency could search for appropriate alternative selectable marker genes29.
The availability of an established transformation protocol will greatly advance our ability to identify genes and novel mechanisms that allow extremophyte model plants to survive multiple abiotic stresses2,4. Novel genetic variation in S. parvula will provide a broader pool of genetic variation that cannot be mined from the collective allelic variation identified as stress-responsive genes in the relatively stress-sensitive model, A. thaliana pan-genome5,6. Therefore, our floral-dip based A. tumefaciens mediated transformation protocol developed for S. parvula will fill a gap for the need for such tools to perform functional genomic experiments in an extremophyte model closely related to A. thaliana.

In this protocol, we describe the growth and establishment of stable transgenic lines for the extremophyte model Schrenkiella parvula. The availability of an efficient transformation system is a hallmark of any versatile genetic model. Plants that thrive in extreme environments, referred to as extremophytes, provide a critical resource for understanding plant adaptations to environmental stresses. Schrenkiella parvula (formerly Thellungiella parvula and Eutrema parvulum) is one such extremophyte model, with expanding genomic resources1,2,3,4,5. However, transformation protocols have not yet been reported for S. parvula in published studies.
The genome of S. parvula is the first published extremophyte genome in Brassicaceae (mustard-cabbage family) and shows an extensive overall genome synteny with the non-extremophyte model, Arabidopsis thaliana1. Thus, comparative studies between A. thaliana and S. parvula could benefit from the wealth of genetic studies performed on A. thaliana to make informative hypotheses on how the S. parvula genome has evolved and regulated differently to cope with extreme environmental stresses5,6,7. S. parvula is one of the most salt-tolerant species (based on soil NaCl LD50) among known wild relatives of A. thaliana8. In addition to the NaCl tolerance, S. parvula survives and completes its life cycle in the presence of multiple salt ions at high concentrations toxic to most plants7. In response to the abiotic stresses prevalent in its natural habitat, it has evolved various traits, among which several have been studied at the biochemical or physiological level 8,9,10,11.
Since 2010, there have been over 400 peer-reveiwed publications that used S. parvula as a target species or used it in a comparison with other plant genomes. However, a clear bottleneck could be identified with a closer look of what type of studies have been conducted. The majority of these reports discuss the potential use of S. parvula in future studies or use it in comparative genomic or phylogenomic studies. Due to the lack of a proof-of-concept transformation protocol established for S. parvula, it has not been used in functional genomic studies, despite having one of the highest quality plant genomes available to date (&#62;5 Mb contig N50) assembled and annotated into chromosome-level pseudomolecules1.
The Agrobacterium-mediated floral-dip transformation method has become the most broadly used method to create trasngenic lines in A. thaliana, and the development of a reproducible system of transformation was a critical factor in its success as a genetic model12,13. However, not all Brassicaceae species have been shown to be successfully transformed using the floral-dip method developed for A. thaliana. Specially, the Brassicaceae Lineage II species that include S. parvula has been recalcitrant to floral-dip based transformation methods14,15.
The indeterminate flowering growth habit of S. parvula, combined with its narrow leaf morphology has made it challenging to adopt the standard Agrobacterium-mediated floral-dip transformation method. In this study, we report the modified protocol we have developed for reproducible transformation of S. parvula.

<table><tbody><tr><td>Agar</td><td>VWR International, Radnor, PA</td><td>90000-762</td><td>Bacto Agar Soldifying Agent, BD Diagnostics</td></tr><tr><td>B5 vitamins</td><td>Sigma-Aldrich, St. Louis, MO</td><td>G1019</td><td>Gamborg&amp;rsquo;s Vitamin Solution</td></tr><tr><td>Desiccant</td><td>W A Hammond Drierite, Xenia, OH</td><td>22005</td><td>Indicating DRIERITE 6 mesh</td></tr><tr><td>Destination vector for plant transformation</td><td>TAIR</td><td>Vector:6531113857</td><td>pKGWFS7</td></tr><tr><td>Electroporation cuvette</td><td>USA Scientific</td><td>9104-5050</td><td>Electroporation cuvette, round cap, 0.2 cm gap</td></tr><tr><td>Electroporator</td><td>BIO-RAD Laboratories, Hercules, CA</td><td>1652100</td><td>MicroPulser Electroporator</td></tr><tr><td>Fertilizer beads</td><td>Osmocote Garden, Marysville, OH</td><td>N/A</td><td>Osmocote Smart-Release Plant Food&amp;nbsp;Flower &amp;amp; Vegetable</td></tr><tr><td>Gel extraction kit</td><td>iNtRON Biotechnology, Boston, MA</td><td>17289</td><td>MEGAquick-spin Total fragment DNA purification kit</td></tr><tr><td>Gentamicin</td><td>Sigma-Aldrich, St. Louis, MO</td><td>G1914-5G</td><td>Gentamicin sulfate</td></tr><tr><td>Glufosinate-ammonium (11.3%) herbicide (BASTA)</td><td>Bayer environmental science, Montvale, NJ</td><td>N/A</td><td>FINALE herbicide</td></tr><tr><td>Kanamycin</td><td>VWR International, Radnor, PA</td><td>200004-444</td><td>Kanamycin monosulfate</td></tr><tr><td>MES</td><td>Bioworld, Dublin, OH</td><td>41320024-2</td><td>MES, Free Acid</td></tr><tr><td>MS salt</td><td>MP Biomedicals, Santa Anna, CA</td><td>092621822</td><td>Hoagland&#039;s modified basal salt mixture</td></tr><tr><td>N6-benzylaminopurine (BA)&amp;nbsp;</td><td>Sigma-Aldrich, St. Louis, MO</td><td>B3274</td><td>6-Benzylaminopurine solution</td></tr><tr><td>NaCl</td><td>Sigma-Alrich</td><td>S7653</td><td>Sodium chloride</td></tr><tr><td>Non-ionic detergent</td><td>Sigma-Aldrich, St. Louis, MO</td><td>9005-64-5</td><td>TWEEN 20&amp;nbsp;</td></tr><tr><td>Plasmid isolation kit</td><td>Zymo Research, Irvine, CA</td><td>D4036</td><td>Zyppy Plasmid Kits</td></tr><tr><td>Recombinase enzyme mix kit</td><td>Life Technology</td><td>11791-020</td><td>Gateway LR Clonase II Enzyme mix</td></tr><tr><td>Rifampicin</td><td>Sigma-Aldrich, St. Louis, MO</td><td>R3501-1G</td><td>Rifampicin, powder, 
&amp;#8805; 97% (HPLC)</td></tr><tr><td>Shaking incubator</td><td>ThermoFisher Scientific, Waltham, MA</td><td>SHKE4450</td><td>MaxQ 4450 Benchtop Orbital Shakers</td></tr><tr><td>Soil mix</td><td>Sun Gro</td><td>SUN239223328CFLP</td><td>Sun Gro Metro-Mix 360 Grower Mix</td></tr><tr><td>Spectinomycin</td><td>VWR International, Radnor, PA</td><td>IC15206705</td><td></td></tr><tr><td>Sterile 50 mL conical tubes</td><td>USA Scientific, Ocala, FL</td><td>1500-1811</td><td>50 mL conical screw cap tubes, copolymer, racks, sterile</td></tr><tr><td>Sucrose</td><td>VWR International, Radnor, PA</td><td>57-50-1</td><td>Sucrose, ACS</td></tr><tr><td>Surfactant solution</td><td>Lehle seeds, Round Rock, TX</td><td>VIS-02</td><td>Silwet L-77</td></tr><tr><td>Topoisomerase-based cloning kit</td><td>Life Technologies, Carlsbad, CA</td><td>K240020</td><td>pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent &lt;em&gt;E. coli&lt;/em&gt;</td></tr><tr><td>Tryptone</td><td>VWR International, Radnor, PA</td><td>90000-282</td><td>BD Bacto Tryptone, BD Biosciences</td></tr><tr><td>Yeast Extract</td><td>VWR International, Radnor, PA</td><td>90000-722&amp;nbsp;</td><td>BD Bacto Yeast Extract, BD Biosciences</td></tr></tbody></table>

plant growth and agrobacterium-mediated floral-dip transformation of the extremophyte schrenkiella parvula

Schrenkiella parvula is an extremophyte adapted to various abiotic stresses, including multiple ion toxicity stresses. Despite high-quality genomic resources available to study how plants adapt to environmental stresses, its value as a functional genomics model and tool has been limited by the lack of a feasible transformation system. In this protocol, we report how to generate stable transgenic S. parvula lines using an Agrobacterium-mediated floral-dip method. We modified the transformation protocol used for A. thaliana to account for unique traits of S. parvula, such as an indeterminate flowering habit and a high epicuticular wax content on leaves. Briefly, S. parvula seeds were stratified at 4 &#176;C for five days before planting. Plants were grown at a photoperiod of a 14 h light and 10 h dark and a 130 &#181;mol m-2s-1 light intensity, at 22 &#176;C to 24 &#176;C. Eight to nine week-old plants with multiple inflorescences were selected for transformation. These inflorescences were dipped in an infiltration solution of Agrobacterium tumefaciens GV3101 carrying the pMP90RK plasmid. We performed two rounds of flower dipping with an interval of three to four weeks to increase the transformation efficiency. The T1 seeds were collected and dried for four weeks in a container with desiccants before germination to screen for candidate transformed lines. Resistance to BASTA was used to screen T1 plants. We sprayed the BASTA solution three times with an interval of three days starting at two week-old plants to reduce false positives. A BASTA drop test was performed on surviving individual plants to identify true positive transformants. The transformation efficiency was 0.033%, yielding 3&#8211;4 transgenic plants per 10,000 T1 seeds propagated.

We developed a transformation protocol that enables harvesting of T0 seeds within 150 days, using a floral-dip method modified from that for A. thaliana. Figure 1 shows a summary of the timeline and S. parvula plants that represent the optimal stage for executing the transformation through floral-dip. We selected S. parvula plants with 70 &#8211;80 flowers in multiple inflorescences at 60&#8211;80 days after germination as the target stage for transformation. A small number of pre-existing open or fertilized flowers and siliques at this stage were removed before the infiltration of A. tumefaciens by the floral-dip method. Infection with A. tumefaciens resulted in abortion of some flowers (Figure 2, bracket (a)). Siliques fully developed after the floral-dip are likely to contain transformed seeds (Figure 2, bracket (b)). Even after transformation, S. parvula continued to develop new inflorescences and flowers as long as the plants were kept healthy (Figure 2, white arrows). Due to this indeterminate flowering habit, a second round of transformation can be performed if the plant does not show signs of stress or senescence. Figure 2A and 2B show examples of S. parvula plants after the first and second round of transformation, respectively, 25 days apart from each other. In the second transformation, existing siliques should not be removed because they may contain transgenic seeds. Also, the A. tumefaciens can be applied by pipetting the infiltration solution (Table 1) onto newly emerging flower clusters, instead of dipping the entire shoot into the solution, to minimize the damage to siliques from the first transformation.
The transformation efficiency is 0.033%, yielding 3&#8211;4 transgenic plants per 10,000 T1 seeds propagated using the current protocol. This estimate is based on ~50,000 T1 seeds tested during ten independent transformation attempts. While the efficiency is lower than that of the Arabidopsis thaliana, it is comparable to the transformation of another extremophyte plant Eutrema salsugenium24 and some of the Arabidopsis thaliana ecotypes25. The transformation efficiency may be further optimized by using alternative Agrobacterium strains and modifications of surfactant and infiltration solutions. The multiple BASTA spray and drop tests (steps 6.3 and 6.4) will be critical to identify true positive transformants and reduce the number of samples tested using the PCR confirmation in step 6.5 (Figure 4A). Further confirmation of transformation can be checked with a reporter gene expression, if the cloned sequence includes a reporter gene (Figure 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58544/58544fig1.jpg" /> 
Figure 1: Timeline of S. parvula transformation. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58544/58544fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58544/58544fig2.jpg" /> 
Figure 2: S. parvula plants after transformation by floral-dip. Plants were photographed 10 days after the first floral-dip at Day 60 (A) and 25 days after the second round of floral-dip at Day 85 (B). Infiltration with Agrobacterium may abort silique development of flowers as shown in brackets a. Siliques fully developed after floral-dip are likely to contain transformed seeds (brackets b). White arrows indicate flowers and inflorescences newly emerged after each transformation. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58544/58544fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58544/58544fig3.jpg" /> 
Figure 3: Selection of S. parvula transformants based on BASTA resistance. (A) T1 seedlings before the BASTA spray.&#160;(B) Red circle indicates a candidate transformant surviving the first-round selection by the BASTA spray. (C) The second-round selection by BASTA drop test. An example of false positives (top panel) and true transgenic plants (lower panel) are shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58544/58544fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58544/58544fig4.jpg" /> 
Figure 4: Confirmation of S. parvula transformation. (A) PCR amplification of bar gene from genomic DNAs extracted from S. parvula plants. Lane 1 and 13: size markers; Lane 2: negative control; Lane 3-5: wild-type S. parvula ; Lane 6-10: transgenic S. parvula candidates; Lane 11, 12: vector control. Lanes 7, 8, and 9 exemplify positive transformants. (B) Example of GUS reporter gene expression in a positive S. parvula transformant. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58544/58544fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Media / Solution</td>
			<td>Reagent</td>
			<td>Amount</td>
		</tr>
		<tr>
			<td>Luria-Bertani (LB) bacterial growth media</td>
			<td>NaCl 
			Tryptone 
			Yeast Extract 
			Agar (for plates) 
			ddH2O</td>
			<td>10 g 
			10 g 
			5 g 
			20 g 
			955 mL</td>
		</tr>
		<tr>
			<td>Agrobacterium infiltration solution</td>
			<td>MS salt (1/4x) 
			B5 vitamins (1x) 
			Sucrose (5%w/v) 
			MES 
			N6-benzylaminopurine (BA) 
			Silwet L-77 (0.05%v/v) 
			pH</td>
			<td>2.16 g 
			1 mL 
			50 g 
			0.5 g 
			10 &#181;L 
			500 &#956;L 
			5.7</td>
		</tr>
	</tbody>
</table>
Table 1: Composition of bacterial growth media and Agrobacterium infiltration solution.

Watch this Scientific Journal Video about Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula at JoVE.com

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Agrobacterium-mediated transformation using a floral-dip method can be successfully employed to create stable transgenic lines of the extremophyte model Schrenkiella parvula. We present a protocol modified from that for Arabidopsis thaliana, considering different growth habits and physiological characteristics of the extremophyte.

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Schrenkiella parvula is an extremophyte adapted to various abiotic stresses, including multiple ion toxicity stresses. Despite high-quality genomic ...

plant-growth-agrobacterium-mediated-floral-dip-transformation

Nanyang Technological University

Research

JoVE Journal

Genetics

13.0K Views.  Louisiana State University. Agrobacterium-mediated transformation using a floral-dip method can be successfully employed to create stable transgenic lines of the extremophyte model Schrenkiella parvula. We present a protocol modified from that for Arabidopsis thaliana, considering different growth habits and physiological characteristics of the extremophyte.

Video: Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Generating Transgenic Plants with Single-copy Insertions Using BIBAC-GW Binary Vector

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the transgene, as multi-copy integrations are often subjected to gene silencing. The Gateway-compatible binary vector based on bacterial artificial chromosomes (pBIBAC-GW), like other pBIBAC derivatives, allows the insertion of single-copy transgenes with high efficiency. As an improvement to the original pBIBAC, a Gateway cassette has been cloned into pBIBAC-GW, so that the sequences of interest can now be easily incorporated into the vector transfer DNA (T-DNA) by Gateway cloning. Commonly, the transformation with pBIBAC-GW results in an efficiency of 0.2&#8211;0.5%, whereby half of the transgenics carry an intact single-copy integration of the T-DNA. The pBIBAC-GW vectors are available with resistance to Glufosinate-ammonium or DsRed fluorescence in seed coats for selection in plants, and with resistance to kanamycin as a selection in bacteria. Here, a series of protocols is presented that guide the reader through the process of generating transgenic plants using pBIBAC-GW: starting from recombining the sequences of interest into the pBIBAC-GW vector of choice, to plant transformation with Agrobacterium, selection of the transgenics, and testing the plants for intactness and copy number of the inserts using DNA blotting. Attention is given to designing a DNA blotting strategy to recognize single- and multi-copy integrations at single and multiple loci.

Using a pBIBAC-GW binary vector makes generating transgenic plants with intact single-copy insertions, an easy process. Here, a series of protocols is presented that guide the reader through the process of generating transgenic Arabidopsis plants, and testing the plants for intactness and copy number of the inserts.

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the ...

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into the plant&#39;s genome. Here, we present two transformation systems to genetically modify potato (Solanum tuberosum) plants. In A. tumefaciens transformation, leaves are infected, the transformed cells are selected and a new complete transformed plant is regenerated using phytohormones in 18 weeks. In A. rhizogenes transformation, stems are infected by injecting the bacteria with a needle, the new emerged transformed hairy roots are detected using a red fluorescent marker and the non-transformed roots are removed. In 5-6 weeks, the resulting plant is a composite of a wild type shoot with fully developed transformed hairy roots. To increase the biomass, the transformed hairy roots can be excised and self-propagated. We applied both Agrobacterium-mediated transformation methods to obtain roots expressing the GUS reporter gene driven by a suberin biosynthetic gene promoter. The GUS staining procedure is provided and allows the cell localization of the promoter induction. In both methods, the transformed potato roots showed GUS staining in the suberized endodermis and exodermis, and additionally, in A. rhizogenes transformed roots the GUS activity was also detected in the emergence of lateral roots. These results suggest that A. rhizogenes can be a fast alternative tool to study the genes that are expressed&#160;in roots.

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Here, we present two protocols to transform potato plants. The Agrobacterium tumefaciens transformation leads to a complete transgenic plant while the Agrobacterium rhizogenes produces transgenic hairy roots in a wild type shoot that can be self-propagated. We then detect promoter activity by GUS staining in the transformed roots.

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into ...

Environment

Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

Information about the spatiotemporal subcellular localization(s) of a protein is critical to understand its physiological functions in cells. Fluorescent proteins and generation of fluorescent fusion proteins have been wildly used as an effective tool to directly visualize the protein localization and dynamics in cells. It is especially useful to compare them with well-known organelle markers after co-expression with the protein of interest. Nevertheless, classical approaches for protein co-expression in plants usually involve multiple independent expression plasmids, and therefore have drawbacks that include low co-expression efficiency, expression-level variation, and high time expenditure in genetic crossing and screening. In this study, we describe a robust and novel method for co-expression of multiple chimeric fluorescent proteins in plants. It overcomes the limitations of the conventional methods by using a single expression vector that is composed of multiple semi-independent expressing cassettes. Each protein expression cassette contains its own functional protein expression elements, and therefore it can be flexibly adjusted to meet diverse expression demand. Also, it is easy and convenient to perform the assembly and manipulation of DNA fragments in the expression plasmid by using an optimized one-step reaction without additional digestion and ligation steps. Furthermore, it is fully compatible with current fluorescent protein derived bio-imaging technologies and applications, such as FRET and BiFC. As a validation of the method, we employed this new system to co-express fluorescently fused vacuolar sorting receptor and secretory carrier membrane proteins. The results show that their perspective subcellular localizations are the same as in previous studies by both transient expression and genetic transformation in plants.

We have developed a novel method for co-expressing multiple chimeric fluorescent fusion proteins in plants to overcome the difficulties of conventional methods. It takes advantage of using a single expression plasmid that contains multiple functionally independent protein expressing cassettes to achieve protein co-expression.

Information about the spatiotemporal subcellular localization(s) of a protein is critical to understand its physiological functions in cells. Fluorescent ...

Chemistry

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

Floral-dip Transformation of Arabidopsis thaliana to Examine pTSO2::&beta;-glucuronidase Reporter Gene Expression

The ability to introduce foreign genes into an organism is the foundation for modern biology and biotechnology. In the model flowering plant Arabidopsis thaliana, the floral-dip transformation method1-2 has replaced all previous methods because of its simplicity, efficiency, and low cost. Specifically, shoots of young flowering Arabidopsis plants are dipped in a solution of Agrobacterium tumefaciens carrying specific plasmid constructs. After dipping, the plants are returned to normal growth and yield seeds, a small percentage of which are transformed with the foreign gene and can be selected for on medium containing antibiotics. This floral-dip method significantly facilitated Arabidopsis research and contributed greatly to our understanding of plant gene function. In this study, we use the floral-dip method to transform a reporter gene, &beta;-glucuronidase (GUS), under the control of TSO2 promoter. TSO2, coding for the Ribonucleotide Reductase (RNR) small subunit3, is a cell cycle regulated gene essential for dNDP biosynthesis in the S-phase of the cell cycle. Examination of GUS expression in transgenic Arabidopsis seedlings shows that TSO2 is expressed in actively dividing tissues. The reported experimental method and materials can be easily adapted not only for research but also for education at high school and college levels.

Floral-dip Transformation of Arabidopsis thaliana to Examine pTSO2::&#946;-glucuronidase Reporter Gene Expression

This article illustrates the floral-dip method of Agrobacterium tumefaciens -mediated transformation of Arabidopsis thaliana. By introducing a cell-cycle regulated promoter-reporter, pTSO2::&beta;-glucuronidase (GUS), into Arabidopsis, we illustrates how one detects GUS reporter expression in transgenic seedlings.

The ability to introduce foreign genes into an organism is the foundation for modern biology and biotechnology. In the model flowering plant Arabidopsis ...

Biology

Stable Gene Integration in Chlorella vulgaris Using Agrobacterium tumefaciens

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

Author Spotlight: Optimized Transformation Protocol for Chlorella vulgaris Using Agrobacterium tumefaciens 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

Bioengineering

Floral-Dip Transformation of Flax (Linum usitatissimum) to Generate Transgenic Progenies with a High Transformation Rate

Agrobacterium-mediated plant transformation via floral-dip is a widely used technique in the field of plant transformation and has been reported to be successful for many plant species. However, flax (Linum usitatissimum) transformation by floral-dip has not been reported. The goal of this protocol is to establish that Agrobacterium and the floral-dip method can be used to generate transgenic flax. We show that this technique is simple, inexpensive, efficient, and more importantly, gives a higher transformation rate than the current available methods of flax transformation.
In summary, inflorescences of flax were dipped in a solution of Agrobacterium carrying a binary vector plasmid (T-DNA fragment plus the Linum Insertion Sequence, LIS-1) for 1 - 2 min. The plants were laid flat on their side for 24 hr. Then, plants were maintained under normal growth conditions until the next treatment. The process of dipping was repeated 2 - 3 times, with approximately 10 - 14 day intervals between dipping. The T1 seeds were collected and germinated on soil. After approximately two weeks, treated progenies were tested by direct PCR; 2 - 3 leaves were used per plant plus the appropriate T-DNA primers. Positive transformants were selected and grown to maturity. The transformation rate was unexpectedly high, with 50 - 60% of the seeds from treated plants being positive transformants. This is a higher transformation rate than those reported for Arabidopsis thaliana and other plant species, using floral-dip transformation. It is also the highest, which has been reported so far, for flax transformation using other methods for transformation.

Floral-Dip Transformation of Flax Linum usitatissimum to Generate Transgenic Progenies with a High Transformation Rate

Here, we present a protocol to transform flax using Agrobacterium-mediated plant transformation via floral-dip. This protocol is simple to perform and inexpensive, yet yields a higher transformation rate than the current available methods for flax transformation.

Agrobacterium-mediated plant transformation via floral-dip is a widely used technique in the field of plant transformation and has been reported to be ...

Split Green Fluorescent Protein System to Visualize Effectors Delivered from Bacteria During Infection

Bacteria, one of the most important causative agents of various plant diseases, secrete a set of effector proteins into the host plant cell to subvert the plant immune system. During infection cytoplasmic effectors are delivered to the host cytosol via a type III secretion system (T3SS). After delivery into the plant cell, the effector(s) targets the specific compartment(s) to modulate host cell processes for survival and replication of the pathogen. Although there has been some research on the subcellular localization of effector proteins in the host cells to understand their function in pathogenicity by using fluorescent proteins, investigation of the dynamics of effectors directly injected from bacteria has been challenging due to the incompatibility between the T3SS and fluorescent proteins.
Here, we describe our recent method of an optimized split superfolder green fluorescent protein system (sfGFPOPT) to visualize the localization of effectors delivered via the bacterial T3SS in the host cell. The sfGFP11 (11th &#946;-strand of sfGFP)-tagged effector secreted through the T3SS can be assembled with a specific organelle targeted sfGFP1-10OPT (1-10th &#946;-strand of sfGFP) leading to fluorescence emission at the site. This protocol provides a procedure to visualize the reconstituted sfGFP fluorescence signal with an effector protein from Pseudomonas syringae in a particular organelle in the Arabidopsis and Nicotiana benthamiana plants.

Fluorescent protein-based approaches to monitor effectors secreted by bacteria into host cells are challenging. This is due to the incompatibility between fluorescent proteins and the type-III secretion system. Here, an optimized split superfolder GFP system is used for visualization of effectors secreted by bacteria into the host plant cell.

Bacteria, one of the most important causative agents of various plant diseases, secrete a set of effector proteins into the host plant cell to subvert the ...

Agrobacterium tumefaciens-Mediated Genetic Transformation of Narrowleaf Plantain

Species in the genus Plantago have several unique traits that have led to them being adapted as model plants in various fields of study. However, the lack of a genetic manipulation system prevents in-depth investigation of gene function, limiting the versatility of this genus as a model. Here, a transformation protocol is presented for Plantago lanceolata, the most commonly studied Plantago species. Using Agrobacterium tumefaciens-mediated transformation, 3 week-old roots of aseptically grown P. lanceolata plants were infected with bacteria, incubated for 2-3 days, and then transferred to a shoot induction medium with appropriate antibiotic selection. Shoots typically emerged from the medium after 1 month, and roots developed 1-4 weeks after the shoots were transferred to the root induction medium. The plants were then acclimated to a soil environment and tested for the presence of a transgene using the &#946;-glucuronidase (GUS) reporter assay. The transformation efficiency of the current method is ~20%, with two transgenic plants emerging per 10 root tissues transformed. Establishing a transformation protocol for narrowleaf plantain will facilitate the adoption of this plant as a new model species in various areas.

Agrobacterium tumefaciens-Mediated Genetic Transformation of Narrowleaf Plantain

Because of its versatile application as a model species in various fields of study, there is a need for a genetic transformation toolkit in narrowleaf plantain (Plantago lanceolata). Here, using Agrobacterium tumefaciens-mediated transformation, a protocol is presented that results in stable transgenic lines with a transformation efficiency of 20%.

Species in the genus Plantago have several unique traits that have led to them being adapted as model plants in various fields of study. However, the lack ...

Agrobacterium-Mediated Hairy Root Induction and Regeneration in Plants

Hairy Root Transformation and Regeneration in Arabidopsis thaliana and Brassica napus

Hairy root transformation represents a versatile tool for plant biotechnology in various species. Infection by an Agrobacterium strain carrying a Root-inducing (Ri) plasmid induces the formation of hairy roots at the wounding site after the transfer of T-DNA from the Ri plasmid into the plant genome. The protocol describes in detail the procedure of the injection-based hairy root induction in Brassica napus DH12075 and Arabidopsis thaliana Col-0. The hairy roots may be used to analyze a transgene of interest or processed for the generation of transgenic plants. Regeneration medium containing cytokinin 6-benzylaminopurine (5 mg/L) and auxin 1-naphthaleneacetic acid (8 mg/L) successfully elicits shoot formation in both species. The protocol covers the genotyping and selection of regenerants and T1 plants to obtain plants carrying a transgene of interest and free of T-DNA from the Ri plasmid. An alternative process leading to the formation of a composite plant is also depicted. In this case, hairy roots are kept on the shoot (instead of the natural roots), which enables the study of a transgene in hairy root cultures in the context of the whole plant.

Author Spotlight: Optimizing Hairy Root-Based Transformation Protocols for Enhanced Efficiency in Brassicaceae

The protocol describes hairy root induction using Arabidopsis primary inflorescence stems and Brassica napus hypocotyls. The hairy roots can be cultured and used as explants to regenerate transgenic plants.

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

Summary

Explore More Videos

Chapters in this video

Generating Transgenic Plants with Single-copy Insertions Using BIBAC-GW Binary Vector

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Floral-dip Transformation of Arabidopsis thaliana to Examine pTSO2::β-glucuronidase Reporter Gene Expression

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Floral-Dip Transformation of Flax (Linum usitatissimum) to Generate Transgenic Progenies with a High Transformation Rate

Split Green Fluorescent Protein System to Visualize Effectors Delivered from Bacteria During Infection

Agrobacterium tumefaciens-Mediated Genetic Transformation of Narrowleaf Plantain

Hairy Root Transformation and Regeneration in Arabidopsis thaliana and Brassica napus