This work was supported by an Israel Science Foundation grant 514415 (to J.S.) and a BSF-NSF (MCB) grant 2016707 (to J.S.). Support from a Siegfried and Irma Ullman Professorial Chair (to J.S.) is also acknowledged.

1. Probe Design
NOTE: This protocol uses commercially available oligonucleotide probes already tagged with fluorophores. The probes consist of a set of specific sequences complementary to a target mRNA, each probe being conjugated to a single fluorescent molecule. Alternatively, it is possible to attach fluorescent markers to probes, as described elsewhere5,16.
<ol>
	<li>Design smFISH probes using&#160;the Probe Designer16 algorithm developed by Arjun Raj (van Oudenaarden Lab, Massachusetts Institute of Technology); sequences of smFISH probes used in this manuscript are listed in the table of materials. 
	NOTE: The minimum number of probes in a set for a detectable signal is ~30. The precise number may vary according to the gene of interest, particularly if very short transcripts are measured.</li>
	<li>Choose a dye that fits the optical setup (see table of materials). 
	NOTE: The Cy3 dye or an optically equivalent dye with a low susceptibility to photo-bleaching is highly recommended. A candidate for dual labeling is Cy5 or an optically equivalent dye (see table of materials). Suitable dyes for STORM imaging of labeled mRNA are characterized by their capacity for multiple cycles of fluorescence emission. Some smFISH dyes can be used for STORM imaging (see table of materials). To image two (or more) transcripts corresponding to different genes in the same cell, one should choose oligonucleotide probes conjugated to dyes whose spectra have little or no overlap.</li>
</ol>
2. Reagent Preparation
NOTE: It is important to keep the samples RNAse-free by using RNase-free consumables such as filtered pipette tips and tubes, and to keep any working environment clean. In order to avoid degradation of the target transcripts, all reagents used following cell fixation must be nuclease-free (see table of materials) or diethylpyrocarbonate (DEPC)-treated and sterilized.
<ol>
	<li>Buffers for smFISH
	<ol>
		<li>Prepare RNase-free 1x&#160;PBS (phosphate buffered saline, solution with a phosphate buffer concentration of 0.01 M and a sodium chloride concentration of 0.154 M, (pH 7.4)). Dilute RNase-free 10x PBS (see table of materials) in nuclease-free water (see table of materials) at a 1:10 v/v ratio.
		<ol>
			<li>Alternatively prepare DEPC-treated 1x PBS.</li>
		</ol>
		</li>
		<li>Prepare RNase-free 2x SSC (saline-sodium citrate buffer, 0.3 M NaCl in 0.03 M sodium citrate, (pH 7.0)). Dilute RNase-free 20x SSC (see table of materials) in nuclease-free water at a 1:10 v/v ratio.
		<ol>
			<li>Alternatively, prepare DEPC-treated 2x SSC.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Oligonucleotide probe stock solution.
	<ol>
		<li>Re-dissolve the dried oligonucleotide probe blend in 200 &#181;L of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to create a probe stock of 25 &#181;M. Mix well by pipetting up and down, and then vortex and centrifuge briefly.</li>
		<li>To avoid freeze and thaw of the stock solution tube, make several aliquots of the stock solution, corresponding to the amount expected to be used in a single experimental run. Store the stock solution at -20 &#176;C or below and protect from light. 
		NOTE: A probe set of 5 nmol can provide up to 250 hybridization reactions.</li>
	</ol>
	</li>
	<li>Hybridization buffer (following Skinner et al.7 ):
	<ol>
		<li>Add 5 mL nuclease-free water to a 50 mL polypropylene conical-bottom tube. Add 1 g of dextran sulfate to the water and dissolve it by vigorous vortexing. Mix the contents in an orbital shaker until bubbles disappear (~30 min).</li>
		<li>Add to the solution 3,530 &#181;L of deionized formamide, 10 mg of E. coli tRNA, 1mL of 20x&#160;SSC, 100 &#181;L of 200 mM vanadyl-ribonucleoside complex and 40 &#181;L of 50 mg/mL BSA. Bring the final volume to 10 mL by addition of DEPC-treated water or nuclease-free water, and vortex the solution until it is homogenous. 
		NOTE: To avoid freeze and thaw of the solution, make several aliquots of the stock solution, corresponding to the amount expected to be used in a single experimental run. Store the stock solution at -20 &#176;C. Be sure to let the formamide warm to room temperature before opening the bottle. To reduce the background, it is suggested to calibrate the optimal formamide concentration (10 - 40% v/v ratio). 
		Caution: WARNING! Formamide is highly toxic and a known teratogen. Avoid contact with the eyes or skin, inhalation or ingestion. Handle it under a fume hood while wearing a lab coat and protective gloves.</li>
		<li>Sterilize the solution by passing it through a 0.22-&#181;m filter. Keep in aliquots and store at -20 &#176;C up to one year.</li>
	</ol>
	</li>
	<li>Prepare Fixation buffer (4.6% formaldehyde in 1x PBS) by adding 37% formaldehyde (v/v) to 1x PBS (see 2.1.1) at a 1:8 v/v ratio and vortex. 
	CAUTION: WARNING! Formaldehyde is highly toxic and a known carcinogen. Handle it under a fume hood while wearing a lab coat and protective gloves.</li>
	<li>Prepare wash buffer for smFISH (20% formamide in 2x SSC) by adding deionized formamide to 2x SSC (see 2.1.2) to a 1:4 v/v ratio and vortex.</li>
	<li>Prepare imaging buffer for smFISH by adding 5 mM cysteamine and oxygen scavengers (7 &#181;M glucose oxidase, 56 nM catalase, and 10% glucose (w/v)) to wash buffer (20% formamide in 2x SSC)</li>
	<li>Buffers for STORM
	<ol>
		<li>Prepare Buffer A by adding 50 mM Tris-HCl and 10 mM NaCl to nuclease-free water. 
		NOTE: Store at RT for years.</li>
		<li>Prepare Buffer B by adding 50 mM Tris-HCl, 10 mM NaCl, and 10% w/v glucose to nuclease-free water. 
		NOTE: Store at 4 &#176;C for up to a year.</li>
		<li>Prepare MEA buffer by dissolving 77 mg cysteamine in 1 mL of buffer A (makes a 1 M solution). 
		NOTE: It can be stored at 4 &#176;C for 1 month.</li>
		<li>Prepare Gloxy buffer by adding 8,440 AU (arbitrary units) glucose oxidase and 70,200 AU catalase to 1 mL buffer A. 
		NOTE: Makes 50x stock solution, it can be stored at 4 &#176;C for 1 month.</li>
		<li>Prepare imaging buffer for STORM by adding 50 mM of MEA buffer and 1x Gloxy buffer to buffer B. 
		NOTE: The imaging buffer for STORM is composed of 5 mM cysteamine, oxygen scavengers (7 &#181;M glucose oxidase and 56 nM catalase) in 50 mM Tris with 10 mM NaCl, and 10% glucose at pH 8.0. Prepare just before imaging, it can be stored and used at RT for approximately 2 h.</li>
	</ol>
	</li>
</ol>
3. Sample Fixation
<ol>
	<li>Grow bacterial cells (e.g., E. coli MG1655) in growth media of choice (e.g., LB medium) overnight inan orbital shaker at 260 rpm and 37 &#176;C. 
	NOTE: To determine the background due to non-specific binding of the probes, measurements in a strain in which the gene of interest has been deleted should be conducted, following the same procedures (see &#916;galk in Figure 1 and&#160;&#916;sodB in Figure 2).</li>
	<li>Dilute the overnight culture 1:100 in fresh medium and measure its optical density (OD600) in a spectrophotometer every ~1 h, up to a value of 0.2 - 0.4; a 4 mL culture should be sufficient. 
	NOTE: If the chosen microscope does not have phase contrast or differential interference contrast capabilities, E. coli outer membranes can be labeled with 2 &#956;M lipophilic fluorescent marker (see table of materials), which should be added to the bacterial suspension 20 min prior to fixation17. Fixation and further treatment are accomplished as described below. Care must be taken to choose a fluorescent marker having a different emission spectrum, to minimize the spectral overlap with the labeled-probe set.</li>
	<li>Pellet cells by centrifugation for 5 min at 4,500 g at 4 &#176;C. Remove the supernatant from all tubes.</li>
	<li>Add 1 mL of 1x PBS to each tube and resuspend the pellet to minimize cell-to-cell aggregation. Then add 4 mL of fixation buffer and vortex gently.</li>
	<li>Incubate samples in an orbital shaker at 260 rpm for 30 min at 24 &#176;C.</li>
	<li>Pellet cells by centrifugation for 10 min, 1,000 g, 4 &#176;C. Remove supernatant. Add 1 mL 1x PBS.</li>
	<li>Transfer suspensions to 1.8 &#181;L conical-bottom micro-centrifuge tubes (see table of materials) and repeat step 3.6 twice.</li>
</ol>
4. Sample Permeabilization
<ol>
	<li>Remove supernatant very carefully. Use small volume pipettes, if necessary, to remove all the liquid outside the pellet.</li>
	<li>Resuspend in 300 &#181;L DEPC-treated water or nuclease-free water. Add 350 &#181;L high grade absolute ethanol (99%) and mix gently by inverting the tube. Add another 350 &#181;L of ethanol and mix again, to reach a final ethanol concentration of 70% (v/v ratio). 
	CAUTION: WARNING! Ethanol is flammable.</li>
	<li>Rotate the sample with a tube rotator at 20 rpm for 1 h at room temperature (RT), or at 4 &#176;C overnight. Samples may be stored at 4 &#176;C&#160; up to one week.</li>
</ol>
5. Hybridization
<ol>
	<li>Pellet cells by centrifugation for 7 min, 750 x g, 4 &#176;C. Remove supernatant.</li>
	<li>Add 1 mL 20% wash buffer to the samples and leave standing for several minutes, or pipette to dissolve the pellet completely.</li>
	<li>Pellet cells by centrifugation for 7 min, at 750 x g, 4 &#176;C.</li>
	<li>Remove the supernatant very gently by pipetting. Use small-volume pipettes if necessary to remove all the liquid outside the pellet.</li>
	<li>Add the oligonucleotide probe set stock solution to the hybridization buffer aliquot so that the final oligonucleotide concentration is 250 nM; vortex vigorously. 
	NOTE: One can label two or more different target mRNAs at once in the same cell. Add probe sets of both targets to the hybridization buffer. Care must be taken to choose dyes having different emission spectra to minimize the spectral overlap (e.g., Cy3 and Cy5). Make sure that samples intended for STORM imaging are hybridized with an oligonucleotide probe set conjugated with a suitable dye for STORM (e.g., in table of materials).</li>
	<li>Suspend samples (see step 5.4) in 50 &#181;L hybridization buffer that contains the oligonucleotide probes, while avoiding the generation of bubbles (the solution is quite viscous).</li>
	<li>Leave samples overnight on a hot block at 30 &#176;C in dark. 
	NOTE: Following this, samples may be stored for up to 6 months at 4 &#176;C.</li>
</ol>
6. Washing
<ol>
	<li>Use one new microcentrifuge tube for each sample to image. Add 1 mL wash buffer.</li>
	<li>Add 10-15 &#181;L from the hybridized samples to the new tube that contains the wash buffer and mix/vortex.</li>
	<li>Pellet cells by centrifugation for 7 min, 750 x g at 4 &#176;C. Remove supernatant. 
	NOTE: To reduce background, incubate for 1 h at 30 &#176;C.</li>
	<li>Wash twice more (resuspend in 1 mL wash buffer, centrifuge and remove pellet).</li>
	<li>Resuspend in 25 &#181;L wash buffer. 
	NOTE: In order to reduce photo-bleaching one can add to the wash buffer an oxygen scavenging system (2.6) to improve dye stability in single-molecule fluorescence experiments6.</li>
</ol>
7. Preparation of Samples for Imaging
NOTE: Cells need to be immobilized in order to allow proper imaging under a fluorescence and phase-contrast microscope. The following methods can be used to prepare samples in which different fields of view can be imaged at different focal planes.
<ol>
	<li>Agarose gel preparation
	<ol>
		<li>Add 150 mg agarose to 10 mL 2x SSC buffer. Do not add 2x SSC to agarose, or else it will not dissolve properly.</li>
		<li>Microwave for 10-15 s each time until large bubbles begin to form. Set aside to cool for a few minutes.</li>
		<li>Place a separating silicone frame on the slide so that the slide&#39;s center remains exposed.</li>
		<li>Place a 10 mm wide (1-2 mm thick) rigid ring in the center of the slide and deposit a small amount of gel in it, for sealing. Wait a few minutes for it to harden.</li>
		<li>Add more gel until a high dome shape is formed. Wait 10 min for it to harden, and remove the ring (using fine tweezers or any other method).</li>
		<li>Deposit ~10 &#956;L of washed bacterial cells (see 6.5) on the gel and seal with a #0 coverslip slide.</li>
	</ol>
	</li>
	<li>Chamber sample preparation for smFISH
	<ol>
		<li>Alternatively (to step 7.1) prepare samples for imaging by immobilizing the washed bacterial cells (see 6.5) on poly-D-lysine-coated glass bottom disposable plastic petri dishes.</li>
		<li>Incubate the samples in the dark, at room temperature, overnight before visualization to allow adhesion of the cells to the surface. Before visualization wash once with wash buffer (.5); keep the sample wet with wash buffer(2.5) or imaging buffer for smFISH (2.6).</li>
	</ol>
	</li>
	<li>Chamber Sample Preparation for STORM
	<ol>
		<li>Prepare samples for STORM for imaging on poly-D-lysine-coated glass bottom disposable plastic petri dishes.</li>
		<li>Incubate the samples in the dark, at RT, overnight. Before visualization wash once with wash buffer for smFISH (2.5); and add imaging buffer for STORM (2.7.5).</li>
	</ol>
	</li>
</ol>
8. Transcript Visualization
<ol>
	<li>Image cells with a wide-field fluorescence microscope equipped with a motorized stage (see table of materials). 
	NOTE: For STORM modification, use cells labeled with a dye capable of multiple cycles of fluorescence emission. Image the sample using 3D super-resolution imaging system (e.g., see table of materials).</li>
	<li>Use (recommended) a 60-100x N.A &#62;1.3 oil immersion phase contrast objective lens with a strong light source, such as a mercury or metal-halide lamp; LED-based light sources are also recommended.</li>
	<li>Use a standard cooled CCD camera, ideally optimized for low-light level imaging rather than speed (we use a camera with 16 &#181;m pixel size) (see table of materials). 
	NOTE: The use of a cooled EMCCD (electron multiplying charge coupled device) camera CCD camera is necessary to reduce thermal noise that prevents detection, particularly of single molecules.</li>
	<li>Use filter sets appropriate for the fluorophores chosen.</li>
	<li>To determine properly cell boundaries, acquire images of different fields of view in each sample either with phase contrast optics, or by labeling fluorescently the outer cell membrane. Acquire images at different focal planes (z-stack) for all channels (usually 13 slices separated by 250 nm are taken). 
	NOTE: The motorized stage of the microscope and the filter sets should be controlled by commercial (see table of materials) or in-house software that can capture a stack of images in sequence.</li>
</ol>
9. Data Analysis
<ol>
	<li>Convert the image stacks to a suitable format for data analysis.</li>
	<li>Estimate the copy number of the target mRNA from the total intensity of fluorescent foci in the cell, rather than from counting discrete &#39;spots&#39; as in other currently available protocols.</li>
	<li>Carry out image analysis with open-source software18 or with a custom-built program. For details of data imaging and analysis see Skinner et al.7</li>
</ol>

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

The authors have nothing to disclose.

We have measured in our laboratory the transcript number of different genes in E. coli cells using the smFISH method2. In brief, this procedure consists of the following steps: cell fixation, permeabilization of membranes to allow for probe penetration, probe hybridization, and sample imaging using a standard fluorescence microscope. This procedure is based on previously published ones with some modifications6,7,16. It has been previously reported that smFISH requires that the number of oligonucleotide probes lie in the range 48-72, in order to achieve a signal lying well above the background7. We have shown that this number may be actually smaller20, depending on the gene sequence of interest, the optical setup, and the specific experimental conditions.
Each probe should be 17-22 nucleotides long, with an inter-probe separation of at least two nucleotides and a GC content of ~45%, in order to reduce the effects of non-specific, off-target binding. Some probes may fail to bind a target, and the overall efficiency of binding can be optimized by modifications of experimental procedures such as the conditions of fixation and hybridization21. An important factor that must be taken into account is the choice of fluorophores. It is highly recommended to label the probes with a dye with low susceptibility to photo-bleaching. Photo-bleaching minimization can be achieved by optimization of exposure times, illumination sources, and integration times of image acquisition, and by the addition of an oxygen scavenging system.
The extent of non-specific binding events should be assessed by carrying out smFISH experiments with cells from strains in which target genes are deleted, for example from the Keio collection19. If the background signal is high, the number and duration of washing steps should be increased, or cells should be incubated in wash buffer at 30 &#176;C for 1 h and then washed twice. Furthermore, to reduce the background, it is suggested to optimize the formamide concentration (10-40% v/v ratio) in the hybridization and the wash buffers. Increasing the formamide concentration reduces nonspecific binding, but may also reduce the binding of probes to the target mRNA. During the hybridization step, it is important to remove the supernatant entirely; a dilute hybridization buffer may lead to decreased labeling efficiency. In addition, target RNAs must be sufficiently long in order to obtain a well-localized spot above background. Recent improvements in signal to-noise ratios and binding specificity through backbone modification of the probes now make it possible to detect shorter RNA fragments, such as eukaryotic microRNAs or bacterial small non-coding RNAs2,10. We recommend that the mean copy number obtained by smFISH should be validated with quantitative PCR7,16.
We have shown in this manuscript that this method can be modified with minor changes to study the localization of transcripts in E. coli with higher optical resolution using stochastic optical reconstruction microscopy (STORM)11.
In summary, smFISH is a versatile method for RNA illumination that allows the direct measurement of the cell-cell variability in transcript number and the localization of target transcripts in the cell, in both eukaryotes and prokaryotes. It provides quantitative information about basic processes of gene expression and can be easily implemented for STORM imaging.

Stochasticity is a fundamental and unavoidable aspect of gene expression and gives rise to cell-cell heterogeneity1, both at the level of transcripts and proteins2,3. Quantifying the variability between cells under well-defined conditions offers a unique window into the basic processes that underlie gene expression and its regulation. One important source of cell-cell heterogeneity in bacteria takes place at the transcriptional level. Transcript numbers vary not only due to the stochasticity of transcription, but also to post-transcriptional processes such as regulation by small RNAs and RNAases2. One way of directly accessing this heterogeneity in a quantitative fashion is by fluorescently tagging individual transcripts of a given gene in smFISH. This methodology allows the detection and subcellular localization of particular RNA molecules in fixed, individual bacterial cells4. mRNAs are hybridized with a set of fluorescently-labeled ~20 base-long oligonucleotides that are designed to bind selectively to transcripts of interest5,6. Multiple labeling ensures detection above background fluorescence, and individual mRNA molecules appear as diffraction-limited spots under a fluorescence microscope7 (see Figure 1). There are other approaches for labeling mRNA molecules, in which the complementary oligomer probes carry conjugated haptens (e.g., biotin or digoxigenin) that are detected using secondary fluorescently-labeled reporter techniques8.
There are other methods that provide quantitative information about transcripts, in addition to smFISH. Some, such as the Northern blot or quantitative PCR, probe the bulk and thus can measure neither the number of mRNA copies nor their position in individual cells. Therefore these methods are not suitable to quantify cell-to-cell variability. A recent image-based technique that allows for the quantification of both the copy number of RNAs within cells as well as their intracellular location, called multiplexed error-robust fluorescence in situ hybridization (MERFISH) has been developed. MERFISH is based on the assignment of a unique barcode consisting of a defined combination from a fixed number of fluorescently-labeled oligonucleotide probes. These barcodes are read out in sequential rounds of smFISH measurements, with photobleaching following each round of hybridization, thereby increasing throughput by two orders of magnitude9,10. This technique necessitates an automated fluid handling system and the proper design of the probe set.
The combination of multiple fluorescence labeling of individual transcripts, together with novel super-resolution techniques such as stochastic optical reconstruction microscopy (STORM)11, enables a ten-fold increase in resolution in the subcellular localization of transcripts. In STORM, a suitable combination of fluorescent probes and imaging buffer allows for multiple cycles of fluorescence emission per probe molecule (blinking). STORM may also be used to image the E. coli transcriptome and observe genome-wide spatial organization of RNA, by labeling simultaneously all the transcripts of interest12.
All the single-cell methods reviewed above are based on imaging transcripts in fixed cells. Hence, they do not provide any information regarding the kinetic properties of transcripts within cells. To follow transcripts in live cells13, mRNAs can be labeled by the fusion of the gene of interest to an array of binding sites. These latter are then recognized by an RNA-binding protein, such as the bacteriophage MS2 coat protein, which is fused to a fluorescent protein such as the green fluorescent protein (GFP)10,14,15.
Here we describe a method for labeling individual mRNAs with a set of fluorescently-labeled DNA probes, for use in smFISH experiments, in particular in E. coli. Furthermore, we show that the same labeling scheme may be used for STORM measurements with minor modifications.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Dextran sulfate sodium salt</td>
			<td >Sigma-Aldrich</td>
			<td >D8906</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pure Ethanol, 99.5%, ACS reagent, absolute</td>
			<td >Mallinckrodt Baker - Avantor</td>
			<td >8025.25</td>
			<td ></td>
		</tr>
		<tr >
			<td >Diethylpyrocarbonate (DEPC)</td>
			<td >Sigma-Aldrich</td>
			<td >D5758</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 20X SSC</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9763</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 10X PBS</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9625</td>
			<td ></td>
		</tr>
		<tr >
			<td >TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td>
			<td >Sigma-Aldrich</td>
			<td >93283</td>
			<td ></td>
		</tr>
		<tr >
			<td >nuclease-free water</td>
			<td >Thermo Fisher Scientific</td>
			<td >10977035</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formaldehyde solution for molecular biology, 36.5-38% in water</td>
			<td >Sigma-Aldrich</td>
			<td >F8775</td>
			<td ></td>
		</tr>
		<tr >
			<td >Deionized formamide, nuclease free</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM9342</td>
			<td ></td>
		</tr>
		<tr >
			<td >E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td>
			<td >Sigma-Aldrich</td>
			<td >R1753-500UN</td>
			<td ></td>
		</tr>
		<tr >
			<td >UltraPure BSA (50mg/ml)</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM2616</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vanadyl-ribonucleoside complex,VRC, 200 mM</td>
			<td >New England Biolab</td>
			<td >S1402S</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-L-Lysine</td>
			<td>Sigma</td>
			<td >P4707</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cysteamine and oxygen</td>
			<td >Sigma-Aldrich</td>
			<td >30070</td>
			<td ></td>
		</tr>
		<tr >
			<td >Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td>
			<td >Sigma-Aldrich</td>
			<td >G2133</td>
			<td ></td>
		</tr>
		<tr >
			<td >Catalase</td>
			<td >Sigma-Aldrich</td>
			<td >C40</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-glucose</td>
			<td >Sigma-Aldrich</td>
			<td >G8270</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-fucose</td>
			<td >Sigma-Aldrich</td>
			<td >F8150</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vybrant DiO Cell-Labeling Solution</td>
			<td >Life Technologies</td>
			<td >V2286</td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose,low melting reagent</td>
			<td >Sigma-Aldrich</td>
			<td >A9414</td>
			<td ></td>
		</tr>
		<tr >
			<td >Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td>
			<td >Grace Bio-Labs</td>
			<td >JTR24R-A2-2.0 666208</td>
			<td ></td>
		</tr>
		<tr >
			<td >poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td>
			<td >MatTek Corporation</td>
			<td >P35GC-1.5-14-C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Super life nitrile powder free examination gloves</td>
			<td >Supermax</td>
			<td >TC-N-9889</td>
			<td ></td>
		</tr>
		<tr >
			<td >Brand sterilization incubator tape</td>
			<td >Sigma-Aldrich</td>
			<td >BR61750</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge tubes (1.8 ml)</td>
			<td >Axygen - Corning Life Sciences</td>
			<td >MCT-175C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Falcon round-bottom polypropylene tubes (14 ml)</td>
			<td >BD Biosciences</td>
			<td >352059</td>
			<td ></td>
		</tr>
		<tr >
			<td >Conical-bottom centrifuge polypropylene tubes (50 ml)</td>
			<td >Corning</td>
			<td >430828</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 5 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4051</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 10 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4488</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 25 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4251</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spectrophotometer cuvettes</td>
			<td >Sarstedt</td>
			<td >67.742</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 0.2 - 20 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT20</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 10 - 200 &#956;l</td>
			<td >Axigene/corning</td>
			<td >TF-200</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT1000</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td>Sorenson</td>
			<td >14200</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe disposile 10 mL needle G-21</td>
			<td>Becton Dickinson, Biosciences</td>
			<td >BD-309643</td>
			<td ></td>
		</tr>
		<tr >
			<td >Minisart 0.2 um Syringe Filter</td>
			<td >Sartorius</td>
			<td >16534 K</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nikon instruments microscope type A immersion oil A, 8cc</td>
			<td >Nikon</td>
			<td >MXA20233</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope slides 76 x26, 3&#34;x1&#34;x1mm</td>
			<td >Thermo Fisher Scientific</td>
			<td >421-004ET</td>
			<td ></td>
		</tr>
		<tr >
			<td >#0 coverslip slide 24x60</td>
			<td >Thermo Fisher Scientific/Menzel</td>
			<td >BNBB024060A0</td>
			<td ></td>
		</tr>
		<tr >
			<td >Orbital shaker</td>
			<td >M.R.C</td>
			<td >TOU-50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Hot block</td>
			<td >M.R.C</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Vortex</td>
			<td >Fried Electric Company</td>
			<td >G-560-E</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge</td>
			<td >Eppendorf</td>
			<td >5427R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Centrifuge</td>
			<td >Eppendorf</td>
			<td >5810R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Portable Pipet-Aid XP2, Pipette Controller</td>
			<td >Drummond Scientific Company</td>
			<td >4-000-501-I</td>
			<td ></td>
		</tr>
		<tr >
			<td >OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td>
			<td >Midsci</td>
			<td >OD600-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >iXon X3 EMCCD camera</td>
			<td >Andor</td>
			<td >DU-897E-CS0-#BV</td>
			<td > </td>
		</tr>
		<tr >
			<td >Eclipse Ti microscope</td>
			<td >Nikon</td>
			<td >MEA53100</td>
			<td > </td>
		</tr>
		<tr >
			<td >CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td>
			<td >Nikon</td>
			<td >MRD31905</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td>
			<td >Nikon</td>
			<td >49005</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td>
			<td >Nikon</td>
			<td >49009</td>
			<td > </td>
		</tr>
		<tr >
			<td >Nis-elements AR auto reaserch software</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td > </td>
		</tr>
		<tr >
			<td >STORM microscope</td>
			<td >Vutara</td>
			<td >SR-200</td>
			<td > </td>
		</tr>
		<tr >
			<td >NA 1.2 water immersion objective </td>
			<td >Olympus</td>
			<td > </td>
			<td > </td>
		</tr>
		<tr >
			<td >SRX image acquisition and analysis software</td>
			<td >Vutara</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Evolve 512 EMCCD camera</td>
			<td >Photometrics</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with CAL Fluor&#174; Red 590 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for galK mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with Quaser Fluor&#174; Red 670 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for sodB mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
	</tbody>
</table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH allows the measurement of cell-to-cell variability in mRNA copy number of genes of interest, as well as the subcellular location of the transcripts. The main steps involved are fixation of the bacterial cell culture, permeabilization of cell membranes, and hybridization of the target transcripts with sets of commercially available short fluorescently-labeled oligonucleotide probes. smFISH can allow the imaging of the transcripts of multiple genes in the same cell, with limitations imposed by the spectral overlap between different fluorescent markers. Following completion of the protocol illustrated below, cells can be readily imaged using a microscope coupled with a camera suitable for low-intensity fluorescence. These images, together with cell contours obtained from segmentation of phase contrast frames, or from cell membrane staining, allow the calculation of the mRNA copy number distribution of a sample of cells using open-source or custom-written software. The labeling method described here can also be applied to image transcripts with stochastic optical reconstruction microscopy (STORM).

We carried out smFISH measurements of galK and sodB transcripts in E. coli cells. The transcripts were hybridized with a set of specific sequences complementary to the target sequence, each probe being conjugated to a single fluorescent molecule (see table of materials). Fluorescence and phase contrast images of MG1655 wild-type E. coli strain (WT) or a JW0740 (Keio collection)19 galK-deleted strain (&#916;galK) were exposed to 2 mM D-fucose are shown in Figure 1A and 1B. Cells were fixed at least 3 h after exposure to D-fucose. The panels in Figure 1A (top) show one frame out of 13, corresponding to the height at which cell contours are in focus, representing the level of galK induction in response to variable extracellular D-fucose concentrations. Spots within cells in the fluorescence images correspond to either single or few galk transcripts, and the determination of the transcript number in each cell is carried out by quantifying localized fluorescence. Numerous spots are seen in most cells, when 2 mM D-fucose is added to the bacterial culture, whereas a few spots are seen in the absence of extracellular D-fucose. In the &#916;galK strain no spots are observed over the background as anticipated. Surface labeling with lipophilic fluorescent marker is shown in Figure 1B (bottom).
In addition, we imaged the sodB transcripts in E. coli bacterial culture grown in LB medium in the logarithmic growth phase. Fluorescence and phase contrast images of smFISH in WT or a JW1648 (Keio collection)19 sodB-deleted strain (&#916;sodB) are shown in Figure 2A. The panels in Figure 2A (top) show one frame out of 13, corresponding to the height at which cell contours are in focus, representing the level of sodB. In the &#916;sodB strain, no spots are observed over the background, as anticipated.
The same cultures were imaged by STORM (top) and the perimeters of the cells were determined with surface labeling using a lipophilic fluorescent marker to illustrate the localization of sodB within the cells. Staining the membrane allows accurate positioning of transcripts in the cell (Figure 2B). The &#916;sodB strain was taken as the background signal and to determine the minimal cluster size (see Figure 2B). The mean transcript number of smFISH2 and STORM is comparable.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56600/56600fig1.jpg" /> 
Figure 1: Effects of D-fucose on galK transcripts visualized using smFISH. (A) Top: smFISH images of fluorescence of galK mRNA in individual E. coli cells. An MG1655 wild-type strain (WT) or a JW0740 (Keio collection) galK-deleted strain (&#916;galK)19 were grown with or without 2 mM D-fucose. The galK transcripts were hybridized to complementary probes conjugated with a dye optically equivalent to Cy3 (see table of materials). Bottom: same fields of view in phase-contrast. (B) WT cells were grown with or without 2 mM D-fucose as above and labeled with 2 &#956;M of a lipophilic membrane dye (see table of materials) for 20 min prior to fixation. Top: fluorescence images of galK mRNA using smFISH. Images were taken with a microscope controlled by a commercial software using a 100&#215; N.A 1.45 oil immersion phase contrast objective lens (see table of materials) and an EMCCD camera (see table of materials). The filters used were as described in the table of materials. A phase contrast image was acquired followed by a z-stack of 13 slices and 250 nm spacing of fluorescent images with 2 s integration time for each slice. Middle: same fields of view with phase-contrast imaging. Bottom: cells labeled with lipophilic fluorescent markers, with appropriate filters described in the Materials Table. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56600/56600fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56600/56600fig2.jpg" /> 
Figure 2: Imaging of sodB transcripts labeled with the same probe set in smFISH and STORM. (A) Top: smFISH images of fluorescence of sodB mRNA in individual E. coli cells. An MG1655 wild-type strain (WT) or a JW1648 (Keio collection) sodB-deleted strain (&#916;sodB)19 were grown in LB medium. The sodB transcripts were hybridized to complementary probes conjugated with a dye optically equivalent to Cy5 (see table of materials). Bottom: same fields of view in phase-contrast. (B) Overlay of fluorescent molecules (individual colored dots) localized by STORM (670 nm emission) and a snapshot of cell membranes in the same field of view. The cells were labeled with a lipophilic dye, excited with an argon laser at 488 nm at 1% of maximal power (0.05 kW/cm2) with an emission peak at 510 nm and imaged with the appropriate filter (see table of materials). WT and sodB cells were grown as described above and labeled with a 2 &#956;M lipophilic membrane dye (see table of materials) for 20 min prior to fixation. Super-resolution images were recorded with a commercial microscope (see table of materials). Transcripts labelled with a dye optically equivalent to Cy5 were localized using an excitation laser at 647 nm in an imaging buffer for STORM. Images were recorded using a 60x, NA 1.2 water immersion objective (see table of materials) and an EMCCD camera (see table of materials) with gain set at 50, frame rate at 50 Hz, and maximal power of 647 and 405 nm lasers set at 5 and 0.05 kW/cm2, respectively. The total number of frames acquired was 8,000. Data was analysed using commercial software (see Materials Table). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56600/56600fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

method-for-labeling-transcripts-individual-escherichia-coli-cells-for

Nanyang Technological University

Research

JoVE Journal

Biology

8.1K Views.  Weizmann Institute of Science. This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

Video: Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Pyrosequencing: A Simple Method for Accurate Genotyping

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a tremendous amount of data available comes an explosion of genotyping methods. Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. It also has the ability to identify tri-allelic, indels, short-repeat polymorphisms, along with determining allele percentages for methylation or pooled sample assessment. In addition, there is a standardized control sequence that provides internal quality control. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.


Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a ...

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying  gene expression in brain, neural tube, somite and heart primordia formation. This video demonstrates the different steps in 2-color whole mount in situ hybridization; First, the embryo is dissected from the egg and fixed in paraformaldehyde. Second, the embryo is processed for prehybridization. The embryo is then hybridized with two different probes, one coupled to DIG, and one coupled to FITC.  Following overnight hybridization, the embryo is incubated with DIG coupled antibody. Color reaction for DIG substrate is performed, and the region of interest appears blue. The embryo is then incubated with FITC coupled antibody. The embryo is processed for color reaction with FITC, and the region of interest appears red. Finally, the embryo is fixed and processed for phtograph and sectioning. A troubleshooting guide is also presented.

This video demonstrates 2-color whole mount in situ hybridization, a method by which the spatial and temporal expression pattern of 2 different genes can be visualized in young chick embryos. This method was originally introduced by David Wilkinson, Domingos Henrique, Phil Ingham and David Ish -Horowicz.

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Viruses that infect cells elicit specific changes to normal cell functions which serve to divert energy and resources for viral replication. Many aspects of host cell function are commandeered by viruses, usually by the expression of viral gene products that recruit host cell proteins and machineries. Moreover, viruses engineer specific membrane organelles or tag on to mobile vesicles and motor proteins to target regions of the cell (during de novo infection, viruses co-opt molecular motor proteins to target the nucleus; later, during virus assembly, they will hijack cellular machineries that will help in the assembly of viruses). Less is understood on how viruses, in particular those with RNA genomes, coordinate the intracellular trafficking of both protein and RNA components and how they achieve assembly of infectious particles at specific loci in the cell. The study of RNA localization began in earlier work. Developing lower eukaryotic embryos and neuronal cells provided important biological information, and also underscored the importance of RNA localization in the programming of gene expression cascades. The study in other organisms and cell systems has yielded similar important information. Viruses are obligate parasites and must utilise their host cells to replicate. Thus, it is critical to understand how RNA viruses direct their RNA genomes from the nucleus, through the nuclear pore, through the cytoplasm and on to one of its final destinations, into progeny virus particles 1.
FISH serves as a useful tool to identify changes in steady-state localization of viral RNA. When combined with immunofluorescence (IF) analysis 22, FISH/IF co-analyses will provide information on the co-localization of proteins with the viral RNA3. This analysis therefore provides a good starting point to test for RNA-protein interactions by other biochemical or biophysical tests 4,5, since co-localization by itself is not enough evidence to be certain of an interaction. In studying viral RNA localization using a method like this, abundant information has been gained on both viral and cellular RNA trafficking events 6. For instance, HIV-1 produces RNA in the nucleus of infected cells but the RNA is only translated in the cytoplasm. When one key viral protein is missing (Rev) 7, FISH of the viral RNA has revealed that the block to viral replication is due to the retention of the HIV-1 genomic RNA in the nucleus 8. 
Here, we present the method for visual analysis of viral genomic RNA in situ. The method makes use of a labelled RNA probe. This probe is designed to be complementary to the viral genomic RNA. During the in vitro synthesis of the antisense RNA probe, the ribonucleotide that is modified with digoxigenin (DIG) is included in an in vitro transcription reaction. Once the probe has hybridized to the target mRNA in cells, subsequent antibody labelling steps (Figure 1) will reveal the localization of the mRNA as well as proteins of interest when performing FISH/IF.

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

A fluorescence in situ hybridization (FISH) method was developed to visually detect viral genomic RNA using fluorescence microscopy. A probe is made with specificity to the viral RNA that can then be identified using a combination of hybridization and immunofluorescence techniques. This technique offers the advantage of identifying the localization of the viral RNA or DNA at steady-state, providing information on the control of intracellular virus trafficking events.

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA probes. This protocol, originally developed by Kloosterman and colleagues for broad use with Exiqon miRNA probes1, has been modified to overcome challenges inherent in miRNA analysis in kidney tissues. These include issues such as structure identification and hard to remove residual probe and antibody. Use of relatively thin, 5 mm thick, tissue sections allowed for clear visualization of kidney structures, while a strong probe signal was retained in cells. Additionally, probe concentration and incubation conditions were optimized to facilitate visualization of microRNA expression with low background and nonspecific signal. Here, the optimized protocol is described, covering the initial tissue collection and preparation through the mounting of slides at the end of the procedure. The basic components of this protocol can be altered for application to other tissues and cell culture models.

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

This article describes an in situ hybridization protocol optimized for colormetric detection of microRNA expression in formalin fixed kidney sections.

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...