Najmeh Nikpour and Fiona Alum provided suggestions and edited this manuscript. Department of Biochemistry at McGill University supported HM and VM with the CIHR Training Initiative in Chemical Biology. This work was supported by Canadian Institute of Health Research (CIHR) grant 119464 (to R. S.).

The protocol below describes the procedure for performing the fluorescence-based RNA editing assay. The assay can be performed in a single PCR tube, 96-well, or 384-well plates depending on the scope of the experiment. Subsequently the fluorescence signal can be read on a suitable real time PCR detection system. The assay here is described in the context of 384-well plates.
1. Culturing T. brucei Cells
<ol>
	<li>Prepare a growth medium for T. brucei procyclic form cells. For 1 L of medium:
	<ol>
		<li>Dissolve 25.4 g SDM-79 powder in 800 ml miliQ water.</li>
		<li>Add 2 g of NaHCO3 and pH to 7.3 with 10 M NaOH.</li>
		<li>Add nanopure water to a final volume of 900 ml, filter sterilize.</li>
		<li>Add Fetal Bovine Serum (FBS), penicillin-streptomycin solution and hemin (2.5 mg/ml) to final concentrations of 10% (v/v), 100 U/ml and 7.5 mg/L respectively.</li>
	</ol>
	</li>
	<li>Grow 300 ml of T. brucei 1.7A wild type (procyclic form) cells at 28 &#176;C, shaking at 70 rpm to a density of 1.5 x 107 cells/ml. NOTE: This should produce 3 ml of active editosome with ~0.5 mg of total protein, sufficient for 600 editing reactions.</li>
	<li>Harvest the cells by centrifugation at 6,000 x g for 10 min at 4 &#176;C.</li>
	<li>Wash the pellet with 50 ml of chilled PBSG buffer (10 mM Na2HPO4, 10 mM NaH2PO4, 145 mM NaCl, and 6 mM glucose), and spin down the cells again by centrifugation at 10,000 x g for 10 min at 4 &#176;C.</li>
</ol>
2. Isolation of Crude Mitochondria
NOTE: All the steps should be performed on ice or at 4 &#176;C to preserve editosome activity.
<ol>
	<li>Resuspend the harvested cells in 30 ml of DTE buffer (1 mM Tris-HCl pH 8.0 and 1 mM EDTA). Use a 40 ml sterile Dounce homogenizer (pre-chilled) to disrupt the cell membrane by stroking up and down at least 10 times on ice.</li>
	<li>Immediately add 4.3 ml of 60% sucrose (w/v; i.e. 1.75 M) to the homogenate to a final concentration of 0.25 M. Centrifuge at 15,800 x g for 10 min at 4 &#176;C, to preferentially bring down mitochondria.</li>
	<li>Resuspend the mitochondrial pellet in 4.6 ml of STM buffer (20 mM Tris-HCl pH 8.0, 250 mM sucrose and 2 mM MgCl2). Add 13.8 &#956;l of 0.1 M CaCl2 and 4 &#956;l of RNase-free DNase I to final concentrations of 0.3 mM and 9 U/ml, respectively. Incubate the mixture for 1 hr on ice.</li>
	<li>Add 4.6 ml of STE buffer (20 mM Tris-HCl pH 8.0, 250 mM sucrose and 2 mM EDTA) to inactivate the DNase I. Centrifuge at 15,800 x g for 10 min at 4 &#176;C.</li>
	<li>Resuspend the pellet in 400 &#956;l of lysis buffer (10 mM Tris-HCl pH 7.2, 10 mM MgCl2, 100 mM KCl, 1 &#181;g/ml pepstatin, 1 mM DTT, and 1x complete EDTA-free protease inhibitor) and transfer to a microfuge tube.</li>
	<li>Add 10% Triton X-100 to a final concentration of 1% and incubate the lysate for 15 min at 4 &#176;C on a tube rotator.</li>
	<li>Clear the mitochondrial lysate by centrifuging twice at 17,000 x g for 15 min at 4&#160;&#176;C; retaining the cleared supernatant each time.</li>
</ol>
3. Editosome Purification
<ol>
	<li>Pour a 10 ml 10%-30% (v/v) linear glycerol gradient (Table 1) in an ultracentrifuge tube using 2x HHE gradient buffer (40 mM HEPES pH 7.9, 20 mM Mg(OAc)2, 100 mM KCl, and 2 mM EDTA) and a gradient maker by following the instruction manual.</li>
	<li>Carefully remove 500 &#956;l of solution from the top of the glycerol gradient and gently load 500 &#956;l of the cleared mitochondrial lysate. Spin at 178,000 x g for 6 hr at 4 &#176;C using an ultracentrifuge.</li>
	<li>Collect 500 &#181;l fractions sequentially from the top to the bottom of the gradient at 4 &#176;C. Then snap freeze the fractions using liquid nitrogen and store at -80 &#176;C until usage.</li>
</ol>
4. RNA Preparation
<ol>
	<li>Anneal the respective DNA template containing sequence complementary to T7 promoter sequence (Table 2) with a T7 promoter oligonucleotide (5&#8217;-TAATACGACTCACTATAGGG-3&#8217;) in a 1:1 molar ratio by heating at 90 &#176;C for 3 min and cooling at RT for at least 10 min.</li>
	<li>Transcribe RNA using an in vitro transcription kit by following the instruction manual.</li>
	<li>Stop the transcription reaction by adding equal volume of 7 M urea dye (7 M urea, 0.05% Xylene Cynol, and 0.05% Bromophenol blue). Run on a filter sterilized 9% denaturing polyacrylamide gel (9% acrylamide, 7 M urea, 1x TBE) .</li>
	<li>Use the ultraviolet (UV) shadowing with a shortwave UV lamp to locate and excise respective RNA. Place the excised gel piece in a microfuge tube and add 400 &#181;l of gel elution buffer (20 mM Tris-HCl pH 7.5, 250 mM NaOAc, 1 mM EDTA and 0.25% SDS). Elute overnight at RT on a tube rotator.</li>
	<li>Precipitate the eluted RNA by adding 1 ml of cold 100% ethanol and incubating either at -80 &#176;C for 30 min or -20 &#176;C overnight.</li>
	<li>Centrifuge at 16,000 x g for 30 min at 4 &#176;C, to pellet down the RNA.</li>
	<li>Wash the pellet with 1 ml of 75% ethanol. Centrifuge at 16,000 x g for 20 min at 4 &#176;C.</li>
	<li>Resuspend the RNA pellet appropriately in RNase free water to achieve the desired concentrations, as shown in Table 2.</li>
</ol>
5. Fluorescence-based RNA Editing Assay
<ol>
	<li>For a single reaction, combine 1 pmol (1 &#181;l) of preA6Rbz and 2.5 pmol (1 &#181;l) of gA6Rbz (1:2.5 molar ratio) in a microfuge tube, incubate at 70 &#186;C for 3 min and let it sit at RT for at least 10 min.</li>
	<li>Meanwhile prepare a master mix using Table 3, without the preA6Rbz and gA6Rbz, for the editing reaction containing 1x HHE buffer (25 mM HEPES pH 7.9, 10 mM Mg(OAc)2, 50 mM KCl and 10 mM EDTA), 1 mM ATP, 5 mM CaCl2, 16 ng/&#181;l of Torula yeast RNA, 0.1% Triton X-100, and the purified editosome.</li>
	<li>Add annealed preA6Rbz and gA6Rbz to complete the master mix.</li>
	<li>Dispense 18 &#181;l of the master mix (Table 3) into wells containing either 2 &#181;l of RNase-free water (wells with no compounds) or 2 &#181;l of 200 &#181;M chemical compounds and include control samples in the plate according to Figure 5.</li>
	<li>Seal the plate with a plate sealer and spin the plate down, to remove any air bubbles. Incubate at 28 &#176;C for 4 hr.</li>
	<li>Add 25 pmol (2 &#181;l) of gA6Rbz competitor to each well. Place a fresh sealer, spin the plate down and place it on a real-time PCR machine. Program the following experiment: 
	Step 1: 85 &#176;C for 5 min; Step 2: 24 &#176;C for 10 min; Step 3: Stop.</li>
	<li>Add 15 pmol (1 &#181;l) of FRET substrate to each well to a final volume of 23 &#181;l. Seal the plate with a fresh sealer. Quickly spin the plate and place it back on the real-time PCR machine.</li>
	<li>Program a new experiment with the following steps: 
	Step 1: 37 &#176;C for 1 min; Step 2: Read; Step 3: Go to Step 1, 40 times; Step 4: Stop.</li>
	<li>Setup the plate by selecting all the wells that require reading and choose the FAM filter. Input volume as 23 &#956;l and start the run.</li>
	<li>Calculate the slope of the values obtained from each well/sample to obtain a kinetic measurement by plotting the slopes on a bar graph for analysis. NOTE: A kinetic read improves the signal-to-noise ratio between the sample and the background; as the background sample would have a slope close to zero. An end point reading has higher background noise.</li>
</ol>

<ol>
	<li>Benne, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=transcript+of+the+frameshifted+coxII+gene+from+trypanosome+mitochondria+contains+four+nucleotides+that+are+not+encoded+in+the+DNA.">transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA.</a> Cell. 46, 819-826 (1986).</li><li>Hajduk, S., Ochsenreiter, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+kinetoplastids.">RNA editing in kinetoplastids.</a> RNA biology. 7, 229-236 (2010).</li><li>Aphasizhev, R., Aphasizheva, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+insertion/deletion+editing+in+trypanosomes:+a+playground+for+RNA-guided+information+transfer.">Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer.</a> Wiley interdisciplinary reviews RNA. 2, 669-685 (2011).</li><li>Seiwert, S. D., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing:+transfer+of+genetic+information+from+gRNA+to+precursor+mRNA+in+vitro.">RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro.</a> Science. 266, 114-117 (1994).</li><li>Weng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guide+RNA-binding+complex+from+mitochondria+of+trypanosomatids.">Guide RNA-binding complex from mitochondria of trypanosomatids.</a> Molecular. 32, 198-209 (2008).</li><li>Hashimi, H., Zikova, A., Panigrahi, A. K., Stuart, K. D., Lukes, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TbRGG1,+an+essential+protein+involved+in+kinetoplastid+RNA+metabolism+that+is+associated+with+a+novel+multiprotein+complex.">TbRGG1, an essential protein involved in kinetoplastid RNA metabolism that is associated with a novel multiprotein complex.</a> RNA. 14, 970-980 (2008).</li><li>Ammerman, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+trypanosome+RNA+editing+accessory+complex,+MRB1.">Architecture of the trypanosome RNA editing accessory complex, MRB1.</a> Nucleic Acids Res. 40, 5637-5650 (2012).</li><li>Huang, C. E., O'Hearn, S. F., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+and+function+of+the+RNA+editing+complex+in+Trypanosoma+brucei+requires+band+III+protein.">Assembly and function of the RNA editing complex in Trypanosoma brucei requires band III protein.</a> Molecular and cellular biology. 22, 3194-3203 (2002).</li><li>Carnes, J., Trotter, J. R., Peltan, A., Fleck, M., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+Trypanosoma+brucei+requires+three+different+editosomes.">RNA editing in Trypanosoma brucei requires three different editosomes.</a> Molecular and cellular biology. 28, 122-130 (2008).</li><li>Hearn, S. F., Huang, C. E., Hemann, M., Zhelonkina, A., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+brucei+RNA+editing+complex:+band+II+is+structurally+critical+and+maintains+band+V+ligase,+which+is+nonessential.">Trypanosoma brucei RNA editing complex: band II is structurally critical and maintains band V ligase, which is nonessential.</a> Molecular and cellular biology. 23, 7909-7919 (2003).</li><li>Schnaufer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+ligase+essential+for+RNA+editing+and+survival+of+the+bloodstream+form+of+Trypanosoma+brucei.">An RNA ligase essential for RNA editing and survival of the bloodstream form of Trypanosoma brucei.</a> Science. 291, 2159-2162 (2001).</li><li>Tarun, S. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KREPA6+is+an+RNA-binding+protein+essential+for+editosome+integrity+and+survival+of+Trypanosoma+brucei.">KREPA6 is an RNA-binding protein essential for editosome integrity and survival of Trypanosoma brucei.</a> RNA. 14, 347-358 (2008).</li><li>Croft, S. L., Barrett, M. P., Urbina, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemotherapy+of+trypanosomiases+and+leishmaniasis.">Chemotherapy of trypanosomiases and leishmaniasis.</a> Trends in parasitology. 21, 508-512 (2005).</li><li>Denise, H., Barrett, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uptake+and+mode+of+action+of+drugs+used+against+sleeping+sickness.">Uptake and mode of action of drugs used against sleeping sickness.</a> Biochemical pharmacology. 61, 1-5 (2001).</li><li>Seiwert, S. D., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+visualization+of+uridylate+deletion+in+vitro+suggests+a+mechanism+for+kinetoplastid+RNA+editing.">Direct visualization of uridylate deletion in vitro suggests a mechanism for kinetoplastid RNA editing.</a> Cell. 84, 831-841 (1996).</li><li>Igo, R. P., Palazzo, S. S., Burgess, M. L., Panigrahi, A. K., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridylate+addition+and+RNA+ligation+contribute+to+the+specificity+of+kinetoplastid+insertion+RNA+editing.">Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing.</a> Molecular and cellular biology. 20, 8447-8457 (2000).</li><li>Igo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+uridylate-specific+exoribonuclease+activity+in+Trypanosoma+brucei+RNA+editing.">Role of uridylate-specific exoribonuclease activity in Trypanosoma brucei RNA editing.</a> Eukaryotic cell. 1, 112-118 (2002).</li><li>Wang, B., Salavati, R., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hammerhead+ribozyme+substrate+and+reporter+for+in+vitro+kinetoplastid+RNA+editing.">A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing.</a> RNA. 8, 548-554 (2002).</li><li>Moshiri, H., Salavati, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+reporter+substrate+for+monitoring+RNA+editing+in+trypanosomatid+pathogens.">A fluorescence-based reporter substrate for monitoring RNA editing in trypanosomatid pathogens.</a> Nucleic Acids Res. 38, e138 (2010).</li><li>Jenne, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+identification+and+characterization+of+hammerhead-ribozyme+inhibitors+using+fluorescence-based+technology.">Rapid identification and characterization of hammerhead-ribozyme inhibitors using fluorescence-based technology.</a> Nature. 19, 56-61 (2001).</li><li>Hartig, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein-dependent+ribozymes+report+molecular+interactions+in+real+time.">Protein-dependent ribozymes report molecular interactions in real time.</a> Nature. 20, 717-722 (2002).</li><li>Famulok, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+aptamers+and+aptazymes+as+probes+for+screening+approaches.">Allosteric aptamers and aptazymes as probes for screening approaches.</a> Current opinion in molecular therapeutics. 7, 137-143 (2005).</li><li>Teng, B., Burant, C. F., Davidson, N. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+an+apolipoprotein+B+messenger+RNA+editing+protein.">Molecular cloning of an apolipoprotein B messenger RNA editing protein.</a> Science. 260, 1816-1819 (1993).</li><li>Jurica, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Searching+for+a+wrench+to+throw+into+the+splicing+machine.">Searching for a wrench to throw into the splicing machine.</a> Nature chemical biology. 4, 3-6 (2008).</li><li>Spahn, C., Prescott, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Throwing+a+spanner+in+the+works:+antibiotics+and+the+translation+apparatus.">Throwing a spanner in the works: antibiotics and the translation apparatus.</a> Journal of molecular medicine. 74, 423-439 (1996).</li></ol>

The authors have nothing to disclose.

A novel high-throughput screening method to identify inhibitors against the RNA editing complex of Trypanosomes was presented, providing a new tool for drug discovery to counter diseases caused by trypanosomatids. FRET-based ribozyme assay has been extensively used for different purposes20-22; however, we have utilized the capacity of FRET-based ribozyme assay for in vitro monitoring of RNA editing activity19. This assay could potentially be adapted to other types of RNA editing in eukaryotes, such as nucleotide substitution editing of nucleus-encoded RNAs of mammals23.
The novelty of this assay is not in establishing FRET-based ribozyme assays per se, but in developing a method that incorporates this technique into an RNA editing assay that is amenable to high-throughput screening of chemicals against editosome. The ribozyme assay-based method has several advantages over other screens and assays currently utilized for this purpose. Specifically, the technique offers a sensitive and reproducible &#8220;mix-and-measure&#8221; assay relying on a fluorescent substrate as opposed to a radiolabeled one, thereby making it fit for high-throughput screening19. Real-time monitoring of a fluorescence signal after addition of the substrate instead of a simple end-point signal makes it possible to more accurately determine IC50 values of assayed compounds19. Furthermore, it permits testing of the inhibitory effects of compounds on the whole-editosome complex as opposed to individual recombinant proteins. Given the dynamic nature of interactions within protein complexes, it can be suggested that this method allows identification of inhibitors against editosome proteins in a more biologically representative setting24. In addition, targeting the whole-editosome complex provides an opportunity to potentially arrest the progression of RNA editing at various transient steps that have not been previously identified. Thus, the technique will allow gaining a better perspective as to interactions and activities that are crucial to the process of RNA editing. This approach has been found to be successful in the past as exemplified by the elucidation of prokaryotic ribosome complex assembly and function utilizing antibiotics, such as viomycin and erythromycin, acting as inhibitors of the complex24,25.
To ensure the successful completion of the method, certain adjustments in protocols may be necessary. First, selection of the proper glycerol gradient mitochondrial extract fraction is crucial. Here, fractions 7 through 11, corresponding to the ~20S region of the gradient, showed the highest editing activity, with fraction 9 exhibiting maximum activity. Although this fraction was selected for all of the tests presented, it is essential to test all fractions beforehand in order to assess in which fraction the editing activity peaks. Second, to validate fraction selection, it is critical to perform preliminary tests to assess the signal-to-noise ratio by calculating the Z&#8217;-factor value. If proper mitochondrial extract glycerol gradient fractionation has been completed, a Z&#8217;-value of 0.6 can be achieved. Next, it is recommended to re-evaluate the reaction volume of mitochondrial extract necessary to achieve maximal editing activity via titration19.
An important limitation of the technique presented in this paper concerns the laborious and time-consuming process of mitochondrial extract glycerol gradient fractionation by which the editosome complex is purified19. Despite these disadvantages, this technique is preferentially suggested to obtain crude editosome fractions given its low cost versus yield potential, thereby qualifying it for application to high-throughput screening. In contrast, other methods such as TAP-tag purification, which are able to give more purified editosome fractions, are advisable for low to medium throughput assays such as in the case of secondary assays. Moreover, in order to ensure specific inhibitory effect of compounds, it is necessary to include controls to test them against the activity of ribozyme (A6Rbz) in the absence of the editosome. It should be noted that previous studies have highlighted that this method may be ineffective at calculating IC50 values for dye-like compounds due to the possible interference at high compound concentrations19.
To further increase the sensitivity of the HTS technique presented, developing a similar fluorescence-based assay involving pre-cleaved pre-edited ribozyme is beneficial. This would allow bypassing the rate-limiting endonucleolytic cleavage step catalyzed by endonucleases in the editosome complex. Another advantage of this modified assay would be the application as a secondary screening tool to monitor the effect of the inhibitors identified through the primary screen on ExoUase, TUTase and ligation catalytic activities. The currently proposed assay is limited to the detection of inhibitors against the deletion type of RNA editing. Therefore, another avenue to explore would be the modification of the presented assay to enable monitoring of compound effects on the insertion type of RNA editing.

The process of RNA editing, a post-transcriptional mRNA modification, was first discovered in trypanosomatids1. Since then, substantial work has been conducted in studying the mechanism behind RNA editing in Trypanosoma brucei2,3. In a series of enzymatic reactions, the editosome, a core complex of about 20 proteins, creates mature mitochondrial mRNAs for multiple components of the energy generating oxidative phosphorylation system. The order of catalytic events is endonucleolytic cleavage, uridylate (U) addition or deletion, and ligation, as dictated by guide RNAs (gRNAs)4.
In addition to the core editosome complex proteins, a number of accessory factors have also been identified5-7. These proteins are mostly seen grouped in independent complexes. However, the order of protein assembly in the core editosome complex and the interaction patterns of the core complex with the accessory complexes are yet to be determined. Targeting the RNA editing process in trypanosomatids may provide chemical dissectors that aid in studying the assembly and function of the editosome complex. Furthermore, functional studies on several editosome proteins have shown essentiality across different life stages, indicating their potential as drug targets8-12. Therefore, the found inhibitors of the editosome may also act as lead compounds against trypanosomatids. This is timely, as drugs currently available against diseases caused by trypanosomatid are toxic, inefficient and expensive13,14.
An efficient and convenient in vitro assay is necessary to explore the chemical universe for specific inhibitors that block RNA editing. Three assays have been developed and used to monitor editosome activities: (a) full round in vitro RNA editing assay15, (b) pre-cleaved in vitro RNA editing assay16,17, and (c) hammerhead ribozyme (HHR)-based assay18. The first two assays rely on direct visualization of the edited product (ATPase 6 mRNA) with the help of radioactivity. The HHR-based assay uses a modified version of the ATPase 6 mRNA that is modeled to behave as a ribozyme upon editing. The functional ribozyme then specifically cleaves a radiolabeled RNA substrate, serving as a reporter. Recently, Moshiri et al. developed a &#8216;mix and measure&#8217; HHR-based in vitro reporter assay to monitor RNA editing where the radiolabeled RNA substrate is replaced with a fluorescence resonance energy transfer (FRET) substrate19. The principle advantages of this assay are: (a) it is a rapid and convenient mix and measure type of assay, as the production of active ribozyme and substrate cleavage occur simultaneously in the same tube in low volume (i.e. 20 &#956;l), (b) it avoids the use of radioactively labeled materials, (c) sensitivity that is afforded by fluorescence instrumentation in a micro-titer plate format, and (d) a high signal to noise ratio. Using this assay, the effect of known RNA editing ligase inhibitors against purified editosome was confirmed19. This experiment validated the assay for rapid identification of RNA editing inhibitors, primarily against whole editosomes from T. brucei.
Figure 1 is a detailed step-by-step schematic of the fluorescence-based in vitro RNA editing assay. This protocol can either be used for monitoring RNA editing in vitro or easily be adapted for screening compound libraries of various scales.

<table border="0" cellpadding="0" cellspacing="0" width="979">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Name of Material/ Equipment</td>
			<td style="width:203px;">Company</td>
			<td style="width:139px;">Catalog Number</td>
			<td style="width:248px;">Comments/Description</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SDM-79 Medium</td>
			<td>Gibco by life technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Fetal Bovine Serum</td>
			<td>life technologies</td>
			<td style="width:139px;">12483-020</td>
			<td>heat inactivation at 550C for 1 h</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Hemin, minimum 80%</td>
			<td style="width:203px;">Sigma</td>
			<td style="width:139px;">H5533-10G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Penicillin-Streptomycin Sollution</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">MT-30-002-CI</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Dnase 1 recombinant, Rnase Free&#160;</td>
			<td style="width:203px;">Roche</td>
			<td style="width:139px;">4716728001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">T7 RiboMax Express Large&#160; scale RNA&#160; production system</td>
			<td style="width:203px;">Promega</td>
			<td style="width:139px;">P1320</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Kimble Kontes Dounce Tissue Grinders&#160;&#160;</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">K885300-0040&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Gradient Master, ver 5.25&#160;</td>
			<td style="width:203px;">Biocomp</td>
			<td style="width:139px;">107-201M</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Ultra Clear Tube, 13.2ML</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">344059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Optima L-100XP&#160; Ultracentrifuge&#160;</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">392052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">SW 41 Ti ROTOR</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">331336</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">MicroSeal &#39;B&#39; Seal, Seals</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">MSB1001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">CFX 384 Touch Real-Time PCR Detection System</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">185-5484</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Acryl/Bis solution (19: 1), 40% (w/v)</td>
			<td style="width:203px;">Bio Basic</td>
			<td style="width:139px;">A0006-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Urea, Molecular biology grade, 1Kg</td>
			<td style="width:203px;">life technologies</td>
			<td style="width:139px;">AM9902</td>
			<td style="width:248px;"></td>
		</tr>
	</tbody>
</table>

rna catalyst as a reporter for screening drugs against rna editing in trypanosomes

Substantial progress has been made in determining the mechanism of mitochondrial RNA editing in trypanosomes. Similarly, considerable progress has been made in identifying the components of the editosome complex that catalyze RNA editing. However, it is still not clear how those proteins work together. Chemical compounds obtained from a high-throughput screen against the editosome may block or affect one or more steps in the editing cycle. Therefore, the identification of new chemical compounds will generate valuable molecular probes for dissecting the editosome function and assembly. In previous studies, in vitro editing assays were carried out using radio-labeled RNA. These assays are time consuming, inefficient and unsuitable for high-throughput purposes. Here, a homogenous fluorescence-based &#8220;mix and measure&#8221; hammerhead ribozyme in vitro reporter assay to monitor RNA editing, is presented. Only as a consequence of RNA editing of the hammerhead ribozyme a fluorescence resonance energy transfer (FRET) oligoribonucleotide substrate undergoes cleavage. This in turn results in separation of the fluorophore from the quencher thereby producing a signal. In contrast, when the editosome function is inhibited, the fluorescence signal will be quenched. This is a highly sensitive and simple assay that should be generally applicable to monitor in vitro RNA editing or high throughput screening of chemicals that can inhibit the editosome function.

To demonstrate the necessary steps required for setting up a large-scale screen, Figures 2-5 are representative control experiments related to the quality of the assay. These are essential control experiments for a consistent assay over several days of screening or for comparison of different screens.
Assessing the Fluorescence Signal-to-noise Ratio
To ensure the stability and quality of the &#64258;uorescein-labeled oligoribonucleotide substrate in a large-scale setup, Z&#8217;-factor, defined as the difference between the assay background and the maximum signal was calculated using the active ribozyme molecule (A6Rbz). Assays with Z&#8217;-factor &#62;0.5 are considered acceptable for high-throughput screen. Figure 2 shows representative data using the FRET substrate labeled with 5&#8217; fluorescein (FAM; emitter) and 3&#8217; N,N&#8217;-tetramethylrhodamine (TAMRA; quencher) (A6Rbz_F/T). This substrate produced a Z&#8217;-factor of 0.64 when calculated using 72 replicates in the presence and absence of A6Rbz.
In this assay an alternative substrate using Iowa Black dark quencher (A6Rbz_F/Ib) can yield a better signal-to-noise ratio compared to TAMRA. This is because Iowa Black, unlike TAMRA, emits absorbed energy as heat and not light. The Z&#8217;-factor obtained using the FAM/Iowa Black (F/Ib)-labeled substrate was 0.68. The improvement in the Z&#8217;-factor for the F/Ib-labeled substrate over TAMRA-labeled substrate is because of its relatively lower background. These representative results show that both substrates are viable options for use in a high-throughput screen.
Determining the Editing Activities of Glycerol Gradient Fractions
To determine and select the most active editosome fractions for experiments, the glycerol gradient fractions were tested for in vitro editing using the fluorescence-based assay (Step V). These data show (Figure 3) fractions 7-12 as the most active fractions (&#8805;50% editing activity; with the most active fraction as 100%). These fractions can be combined when more editosome is required.
Calculating the Z&#8217;-factor when the Editosome Fractions were Combined
To determine the effect of combinig the editosome fraction, the Z&#8217;-factor value of 0.6 was calculated when the most active fractions (F8+F9+F10) were used as the source of editosome. To calculate the Z&#8217;-factor 72 replicates were tested in the presence and absence of the editosome (Figure 4). The F/Ib substrate was used in this experiment. These data show that based on the Z&#8217;-factor, combining the glycerol gradient fractions have minimal effect on the quality of the assay.
Representative Control Experiment for the Assay
Representative data comparing different control samples were used to analyze the variables in the assay. As shown in Figure 5, reactions missing any RNA editing components (reactions 1-4) do not cleave the substrate. Cleavage of the substrate as measured by the fluorescence and relative editing activity is only observed in the presence of all components of the editing reactions in the absence of an inhibitor (reaction 5) or in the presence of all editing components and an inactive compound (reaction 6). In contrast, an inhibitory compound can block RNA editing and is used as a positive control (reaction 7). Here, Mordant black (MrB) and C53 compounds were used as the positive and negative controls, respectively.
<img alt="Figure 1" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig1highres.jpg" width="500" /> 
Figure 1. Hammerhead ribozyme-based in vitro RNA editing assay. A) Step-by-step schematic representation of the fluorescence-based in vitro editing assay: (a) Hybridization of the pre-edited hammerhead ribozyme (pre-edited A6Rbz) with its guide RNA (gA6Rbz). (b) Recognition and interaction of the RNA duplex by the purified editosome complex. (c) Deletion RNA editing catalyzed by the editosome. (d) Dissociation of the edited A6Rbz from the editosome and gA6Rbz by heating at 85 &#176;C and addition of guide RNA competitor (gA6Rbz_comp). (e) Hybridization of the FRET substrate with the active A6 hammerhead ribozyme (active A6Rbz). (f) Detection of FAM signals following cleavage of the FRET substrate by the active ribozyme. B) The pre-edited hammerhead ribozyme (pre-edited A6Rbz) is shown in association with gA6Rbz that specifies the deletion of three Us (double-headed arrow) from the editing site (ES). As a result of RNA editing in the presence of functional editosome the inactive ribozyme is edited into its active form (edited A6Rbz) that can now cleave the FRET substrate (cleavage site indicated by an arrow). The conserved 5&#8242;-CUGA-3&#8242; of the edited A6Rbz in the catalytic core essential for ribozyme activity (edited site) is highlighted (This figure has been modified from Moshiri19). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51712/51712fig1highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig2highres.jpg" width="500" /> 
Figure 2. Signal-to-noise ratio comparison between FRET substrates harboring different quenchers. Ribozyme (A6Rbz) activity using FAM/TAMRA (F/T) and FAM/Iowa Black FQ (F/Ib) substrates. The y-axis represents fluorescence arbitrary unit (FAU) per minute.
<img alt="Figure 3" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig3highres.jpg" width="500" /> 
Figure 3. RNA editing activity of select fractions obtained from glycerol gradient centrifugation of the mitochondrial lysate. Fraction #9 (F9) has the highest activity. The y-axis represents relative editing activity in percentage, considering F9 as 100%.
<img alt="Figure 4" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig4highres.jpg" width="500" /> 
Figure 4. Z&#8217;-factor calculation using the most active fractions (F8+F9+F10) as the editosome source. Experimental variation was obtained from 72 replicates of each type of reaction. Z&#8217;-factor was calculated as 0.6. The y-axis represents relative editing activity.
<img alt="Figure 5" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig5highres.jpg" width="500" /> 
Figure 5. Representative experiment for the fluorescence-based RNA editing assay. Reactions were performed in a final volume of 20 &#181;l per well and CFX384 TouchTM real-time PCR detection system was used for measuring the fluorescence signal. The graph presents various controls in addition to a complete editing reaction that contains all components for the assay (#5). The fluorescence was measured in the presence of FRET substrate alone (#1) to assess the integrity of the substrate. Sample #2 was performed in the absence of the editosome to monitor any ribozyme activity prior to editing. To assess the effect of denatured editosome on the substrate, the fluorescence was measured in the presence of the editosome and FRET substrate only (#3). To test the guide-directed editing specificity, a sample in the absence of gA6Rbz was used (#4). A non-inhibitory (C53, #6) and an inhibitory compound (MrB, #7) were used to test the effect on the editing assay. While RNA editing is inhibited significantly by MrB, C53 has negligible effect. The error bars correspond to an experimental variation (standard deviation) between 10 replicates. The y-axis represents relative editing activity in percentage, considering the complete reaction (#5) as 100%.
<table border="0" cellpadding="0" cellspacing="0" width="614">
	<tbody>
		<tr>
			<td></td>
			<td>10%</td>
			<td>30%</td>
		</tr>
		<tr>
			<td>2x HHE gradient buffer</td>
			<td>5 ml</td>
			<td>5 ml</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>1 ml</td>
			<td>3 ml</td>
		</tr>
		<tr>
			<td>DEPC H2O</td>
			<td>4 ml</td>
			<td>2 ml</td>
		</tr>
		<tr>
			<td>1 M DTT</td>
			<td>10 &#181;l</td>
			<td>10 &#181;l</td>
		</tr>
	</tbody>
</table>
Table 1. 10% &#38; 30% Glycerol Solution (10ml each).
<table border="0" cellpadding="0" cellspacing="0" width="600">
	<tbody>
		<tr>
			<td colspan="2">Pre-edited A6 Ribozyme (preA6Rbz)</td>
		</tr>
		<tr>
			<td>preA6Rbz DNA template</td>
			<td>5&#8217;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCA TCAAAAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTT CCCCCTATAGTGAGTCGTATTA-3&#8217;</td>
		</tr>
		<tr>
			<td>preA6Rbz RNA</td>
			<td>5&#8217;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUUUUGAUGAGUCCGUGAGGACGAAACAAUAGA UCAAAUGU-3&#8217;</td>
		</tr>
		<tr>
			<td>RNA stock conc.</td>
			<td>1 &#956;M</td>
		</tr>
		<tr>
			<td colspan="2">Guide A6 Ribozyme (gA6Rbz)</td>
		</tr>
		<tr>
			<td>gA6RBz DNA template</td>
			<td>5&#8242;-AAAAAAAAAAAAAAAAATAATTATCATATCACTGT CAAGGGAAAGTTGTGAGGGTGATGAGTCCGTGTATATCCCC CTATAGTGAGTCGTATTA-3&#8242;</td>
		</tr>
		<tr>
			<td>gA6Rbz RNA</td>
			<td>5&#8242;-GGGAUAUACACGGACUCAUCACCCUCACAACUU UCCCUUGACAGUGAUAUGAUAAUUAUUUUUUUUUUUUUUUUU-3&#8217;</td>
		</tr>
		<tr>
			<td>RNA stock conc.</td>
			<td>2.5 &#956;M</td>
		</tr>
		<tr>
			<td colspan="2">Guide A6 Ribozyme Competitor (gA6RBz_comp)</td>
		</tr>
		<tr>
			<td>gA6Rbz_comp DNA template</td>
			<td>5&#8242;-GGATATACACGGACTCATCACCCTCACAACTTTC CCTTGACAGTGATATGATAATTATTTTTTTTTTTTTTTTTCCCTAT AGTGAGTCGTATTA-3&#8242;</td>
		</tr>
		<tr>
			<td>gA6Rbz_comp RNA</td>
			<td>5&#8217;-AAAAAAAAAAAAAAAAAUAAUUAUCAUAUCACUG UCAAGGGAAGUUGUGAGGGUGAUGAGUCCGUGUAUAUCC-3&#8217;</td>
		</tr>
		<tr>
			<td>RNA stock conc.</td>
			<td>12.5 &#956;M</td>
		</tr>
		<tr>
			<td colspan="2">Active A6 Ribozyme (A6RBz)</td>
		</tr>
		<tr>
			<td>A6Rbz DNA template</td>
			<td>5&#8242;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCAT CAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTTCCCC CTATAGTGAGTCGTATTA-3&#8242;</td>
		</tr>
		<tr>
			<td>A6Rbz RNA</td>
			<td>5&#8217;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUGAUGAGUCCGUGAGGACGAAACAAUAGAUCA AAUGU-3&#8217;</td>
		</tr>
		<tr>
			<td>RNA stock conc.</td>
			<td>1 &#956;M</td>
		</tr>
		<tr>
			<td colspan="2">FRET substrate</td>
		</tr>
		<tr>
			<td>TAMRA quencher</td>
			<td>5&#8217;-FAM-GAUCUAUUGUCUCACA-TAMRA-3&#39; (Eurogentec)</td>
		</tr>
		<tr>
			<td>Iowa Black quencher</td>
			<td>5&#8217;-FAM- GAUCUAUUGUCUCACA-Iowa Black-3&#39; (IDT)</td>
		</tr>
		<tr>
			<td>RNA stock conc.</td>
			<td>15 &#956;M (for both)</td>
		</tr>
	</tbody>
</table>
Table 2. DNA Templates and RNA Substrates.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Composition</td>
			<td>Editing reaction (&#956;l)</td>
		</tr>
		<tr>
			<td>10x HHE</td>
			<td>1.5</td>
		</tr>
		<tr>
			<td>0.1 M CaCl2</td>
			<td>1</td>
		</tr>
		<tr>
			<td>100 mM ATP</td>
			<td>0.2</td>
		</tr>
		<tr>
			<td>10% Tritonx-100</td>
			<td>0.2</td>
		</tr>
		<tr>
			<td>500 ng/&#956;l Torula Yeast RNA&#160;</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Editosome</td>
			<td>5</td>
		</tr>
		<tr>
			<td>RNase free H2O</td>
			<td>7.1</td>
		</tr>
		<tr>
			<td>1 &#956;M preA6Rbz</td>
			<td>1</td>
		</tr>
		<tr>
			<td>2.5 &#956;M gA6Rbz</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>18</td>
		</tr>
	</tbody>
</table>
Table 3. Reaction Composition and Master Mix.

Watch this Scientific Journal Video about RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes at JoVE.com

RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Substantial progress has been made in determining the mechanism of mitochondrial RNA editing in trypanosomes. Similarly, considerable progress has been ...

rna-catalyst-as-reporter-for-screening-drugs-against-rna-editing

Nanyang Technological University

Research

JoVE Journal

Biology

8.4K Views.  McGill University. A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Video: RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

Visualizing RNA Localization in Xenopus Oocytes

RNA localization is a conserved mechanism of establishing cell polarity. Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to spatially restrict gene expression of Vg1 protein. Tight control of Vg1 distribution in this manner is required for proper germ layer specification in the developing embryo. RNA sequence elements in the 3' UTR of the mRNA, the Vg1 localization element (VLE) are required and sufficient to direct transport. To study the recognition and transport of Vg1 mRNA in vivo, we have developed an imaging technique that allows extensive analysis of trans-factor directed transport mechanisms via a simple visual readout. 
To visualize RNA localization, we synthesize fluorescently labeled VLE RNA and microinject this transcript into individual oocytes. After oocyte culture to allow transport of the injected RNA, oocytes are fixed and dehydrated prior to imaging by confocal microscopy. Visualization of mRNA localization patterns provides a readout for monitoring the complete pathway of RNA transport and for identifying roles in directing RNA transport for cis-acting elements within the transcript and trans-acting factors that bind to the VLE (Lewis et al., 2008, Messitt et al., 2008). We have extended this technique through co-localization with additional RNAs and proteins (Gagnon and Mowry, 2009, Messitt et al., 2008), and in combination with disruption of motor proteins and the cytoskeleton (Messitt et al., 2008) to probe mechanisms underlying mRNA localization.

Visualizing RNA Localization in Xenopus Oocytes

Visualization of in vivo RNA transport is accomplished by microinjection of fluorescently labeled RNA transcripts into Xenopus oocytes, followed by confocal microscopy.

RNA localization is a conserved mechanism of establishing cell polarity.  Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to ...

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Electroantennographic Bioassay as a Screening Tool for Host Plant Volatiles

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host plant.1,2 When a host plant is an important agronomic commodity feeding damage by insect pests can inflict serious economic losses to growers. Accordingly, kairomones can be used as attractants to lure or confuse these insects and, thus, offer an environmentally friendly alternative to pesticides for insect control.3 Unfortunately, plants can emit a vast number volatiles with varying compositions and ratios of emissions dependent upon the phenology of the commodity or the time of day. This makes identification of biologically active components or blends of volatile components an arduous process. To help identify the bioactive components of host plant volatile emissions we employ the laboratory-based screening bioassay electroantennography (EAG). EAG is an effective tool to evaluate and record electrophysiologically the olfactory responses of an insect via their antennal receptors. The EAG screening process can help reduce the number of volatiles tested to identify promising bioactive components. However, EAG bioassays only provide information about activation of receptors. It does not provide information about the type of insect behavior the compound elicits; which could be as an attractant, repellent or other type of behavioral response. Volatiles eliciting a significant response by EAG, relative to an appropriate positive control, are typically taken on to further testing of behavioral responses of the insect pest. The experimental design presented will detail the methodology employed to screen almond-based host plant volatiles4,5 by measurement of the electrophysiological antennal responses of an adult insect pest navel orangeworm (Amyelois transitella) to single components and simple blends of components via EAG bioassay. The method utilizes two excised antennae placed across a "fork" electrode holder. The protocol demonstrated here presents a rapid, high-throughput standardized method for screening volatiles. Each volatile is at a set, constant amount as to standardize the stimulus level and thus allow antennal responses to be indicative of the relative chemoreceptivity. The negative control helps eliminate the electrophysiological response to both residual solvent and mechanical force of the puff. The positive control (in this instance acetophenone) is a single compound that has elicited a consistent response from male and female navel orangeworm (NOW) moth. An additional semiochemical standard that provides consistent response and is used for bioassay studies with the male NOW moth is (Z,Z)-11,13-hexdecadienal, an aldehyde component from the female-produced sex pheromone.6-8

A method to rapidly screen host plant volatiles by measurement of the electrophysiological response of adult navel orangeworm (Amyelois transitella) antennae to single components and blends via electroantennographic analysis is demonstrated.

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity and functionality of the gut community will provide insight into the effects of gut microbiota on mosquito life traits. Metagenomic RNA-Seq has become an important tool to analyze transcriptomes from various microbes present in a microbial community. Messenger RNA usually comprises only 1-3% of total RNA, while rRNA constitutes approximately 90%. It is challenging to enrich messenger RNA from a metagenomic microbial RNA sample because most prokaryotic mRNA species lack stable poly(A) tails. This prevents oligo d(T) mediated mRNA isolation. Here, we describe a protocol that employs sample derived rRNA capture probes to remove rRNA from a metagenomic total RNA sample. To begin, both mosquito and microbial small and large subunit rRNA fragments are amplified from a metagenomic community DNA sample. Then, the community specific biotinylated antisense ribosomal RNA probes are synthesized in vitro using T7 RNA polymerase. The biotinylated rRNA probes are hybridized to the total RNA. The hybrids are captured by streptavidin-coated beads and removed from the total RNA. This subtraction-based protocol efficiently removes both mosquito and microbial rRNA from the total RNA sample. The mRNA enriched sample is further processed for RNA amplification and RNA-Seq.

A ribosomal RNA (rRNA) depletion protocol was developed to enrich messenger RNA (mRNA) for RNA-seq of the mosquito gut metatranscriptome. Sample specific rRNA probes, which were used to remove rRNA via subtraction, were created from the mosquito and its gut microbes. Performance of the protocol can result in the removal of approximately 90-99% of rRNA.

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity ...

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

Marine elasmobranchs are valued animal models for biomedical and genomic studies as they are the most primitive vertebrates to have adaptive immunity and have unique mechanisms for osmoregulation 1-3. As the most primitive living jawed-vertebrates with paired appendages, elasmobranchs are an evolutionarily important model, especially for studies in evolution and development. Marine elasmobranchs have also been used to study aquatic toxicology and stress physiology in relationship to climate change 4. Thus, development and adaptation of methodologies is needed to facilitate and expand the use of these primitive vertebrates to multiple biological disciplines. Here I present the successful adaptation of RNA whole mount in situ hybridization and histological techniques to study gene expression and cell histology in elasmobranchs.
Monitoring gene expression is a hallmark tool of developmental biologists, and is widely used to investigate developmental processes 5. RNA whole mount in situ hybridization allows for the visualization and localization of specific gene transcripts in tissues of the developing embryo. The expression pattern of a gene's message can provide insight into what developmental processes and cell fate decisions a gene may control. By comparing the expression pattern of a gene at different developmental stages, insight can be gained into how the role of a gene changes during development.
While whole mount in situ's provides a means to localize gene expression to tissue, histological techniques allow for the identification of differentiated cell types and tissues. Histological stains have varied functions. General stains are used to highlight cell morphology, for example hematoxylin and eosin for general staining of nuclei and cytoplasm, respectively. Other stains can highlight specific cell types. For example, the alcian blue stain reported in this paper is a widely used cationic stain to identify mucosaccharides. Staining of the digestive tract with alcian blue can identify the distribution of goblet cells that produce mucosaccharides. Variations in mucosaccharide constituents on short peptides distinguish goblet cells by function within the digestive tract 6. By using RNA whole mount in situ's and histochemical methods concurrently, cell fate decisions can be linked to gene-specific expression.
Although RNA in situ's and histochemistry are widely used by researchers, their adaptation and use in marine elasmobranchs have met limited and varied success. Here I present protocols developed for elasmobranchs and used on a regular basis in my laboratory. Although further modification of the RNA in situ's hybridization method may be needed to adapt to different species, the protocols described here provide a strong starting point for researchers wanting to adapt the use of marine elasmobranchs to their scientific inquiries.

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

By combining methods for RNA whole mount in situ hybridization and histology, gene expression can be linked with cell fate decisions in the developing embryo. These methods have been adapted to marine elasmobranchs and facilitate the use of these animals as model organisms for biomedical, toxicology and comparative studies.

Marine  elasmobranchs are valued animal models for biomedical and genomic studies as  they are the most primitive vertebrates to have adaptive immunity ...

A Chemical Screening Procedure for Glucocorticoid Signaling with a Zebrafish Larva Luciferase Reporter System

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids can lead to severe side effects. Test systems are needed to search for novel compounds influencing glucocorticoid signaling in vivo or to determine unwanted effects of compounds on the glucocorticoid signaling pathway. We have established a transgenic zebrafish assay which allows the measurement of glucocorticoid signaling activity in vivo and in real-time, the GRIZLY assay (Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY). The luciferase-based assay detects effects on glucocorticoid signaling with high sensitivity and specificity, including effects by compounds that require metabolization or affect endogenous glucocorticoid production. We present here a detailed protocol for conducting chemical screens with this assay. We describe data acquisition, normalization, and analysis, placing a focus on quality control and data visualization. The assay provides a simple, time-resolved, and quantitative readout. It can be operated as a stand-alone platform, but is also easily integrated into high-throughput screening workflows. It furthermore allows for many applications beyond chemical screening, such as environmental monitoring of endocrine disruptors or stress research.

We describe the procedure and data analysis of a chemical screening system for glucocorticoid stress hormone signaling using zebrafish larvae: the Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY (GRIZLY) assay. The assay sensitively and specifically detects effects on glucocorticoid signaling by compounds that require metabolization or affect endogenous glucocorticoid production.

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids ...

A Method for Screening and Validation of Resistant Mutations Against Kinase Inhibitors

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the potential of targeting the kinase in cancers by effectively treating the CML patients. This observation revolutionized drug development to target the oncogenic kinases implicated in various other malignancies, such as, EGFR, B-RAF, KIT and PDGFRs. However, one major drawback of anti-kinase therapies is the emergence of drug resistance mutations rendering the target to have reduced or lost affinity for the drug. Understanding the mechanisms employed by resistant variants not only helps in developing the next generation inhibitors but also gives impetus to clinical management using personalized medicine. We reported a retroviral vector based screening strategy to identify the spectrum of resistance conferring mutations in BCR/ABL, which has helped in developing the next generation BCR/ABL inhibitors. Using Ruxolitinib and JAK2 as a drug target pair, here we describe in vitro screening methods that utilizes the mouse BAF3 cells expressing the random mutation library of JAK2 kinase.

Emergence of genetic resistance against kinase inhibitor therapy poses significant challenge for effective cancer therapy. Identification and characterization of resistant mutations against a newly developed drug helps in better clinical management and next generation drug design. Here, we describe our protocol for in vitro screening and validation of resistant mutations.

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the ...

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression regulation at posttranscriptional levels by affecting the stability and translational efficiency of target mRNAs. RNA pull-down technique has been widely used to study RNA-protein interaction, which is necessary to elucidate the mechanism underlying RBPs&#39; as well as long non-coding RNAs&#39; (lncRNAs) function. However, the high lipid abundance in adipocytes poses a technical challenge in conducting this experiment. Here a detailed RNA pull-down protocol is optimized for primary adipocyte culture. An RNA fragment from androgen receptor&#39;s (AR) 3&#39; untranslated region (3&#39;UTR) containing an adenylate-uridylate-rich elementwas used as an example to demonstrate how to retrieve its RBP partner, HuR protein, from adipocyte lystate. The method described here can be applied to detect the interactions between RBPs and noncoding RNAs, as well as between RBPs and coding RNAs.

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

An RNA pull-down protocol is optimized here for detection of interactions between RNA-binding proteins (RBPs) and noncoding as well as coding RNAs. An RNA fragment from androgen receptor (AR) was used as an example to demonstrate how to retrieve its RBP from lystate of primary brown adipocytes.

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression ...