Teknik yardım sağlamak için uyarıcı tartışmalar ve Üyeler Zhan laboratuarında sağlamak için Zhang laboratuarında üye teşekkür. Bu araştırma hibe NSFC, Çin ' in M.O.S.T. üzerinden 973 programının (için E.E.Z. ve C.Z.) 2012CB837700 31500860 (C.Z. için) ve Pekin Belediye hükümetten fon tarafından desteklenmiştir. E.E.Z. Çinliler "İşe alım programı küresel gençlik uzmanlar" tarafından desteklendi.

Bu iletişim kuralı tüm prosedürleri ile onayı kurumsal hayvan bakım ve kullanım Komitesi (IACUC), Ulusal Biyolojik Bilimler Enstitüsü, Pekin, Çin'in devlet düzenlemelerine uygun olarak yapılmıştır.
1. Cry1 floresan muhabir inşaatı
Not: önceki sirkadiyen çalışmalarda bioluminescence sistem2,12kullanarak,13 ritmik dLuc ifade ikna etmek için sirkadiyen bir organizatörü bir hale luciferase (dLuc) ile sigorta. Bir floresan muhabir geliştirmek için bozulma luciferase ritmik dVenus ifade ikna etmek için istikrarsızlığın floresans protein ile (dVenus) değiştirildi. P (Cry1) nesil-dVenüs muhabir aşağıda açıklanmıştır, hangi yapı şu anda Addgene için teslim ediliyor ve yakında akademik kullanıma açık olacak.
<ol><li>İşlevsel fare Cry1 organizatörü (+328 Cry1 gen, transkripsiyon başlangıç sitesi ''-'' 1 belirlenmiş-1208 bp bölgesine) yükseltmek. PCR enzim (KOD Plus Neo) kullanın, astar F1 ve R1 (bkz. Tablo 2), fare genom Cry1 organizatörü DNA parçası yükseltmek için bir şablon ve üreticinin PCR protokolü gibi.</li>
	<li>İntron 336 Cry114sirkadiyen saat fonksiyonu için önemli olan Cry1 gen yükseltmek. PCR enzim astar F2 ve R2, fare genom bir şablon ve intron 336 DNA parçası yükseltmek için üreticinin PCR protokolü olarak kullanın.</li>
	<li>Venüsyükseltmek. PCR enzim astar F3 ve R3, pVENUS-N1 plazmid bir şablon ve Venüs DNA parçası yükseltmek için üreticinin PCR protokolü olarak kullanın.</li>
	<li>NLS-D2 DNA parçası yükseltmek. PCR enzim astar F4 ve R4, pcDNA3.3-d2eGFP plazmid NLS-D2 DNA parçası yükseltmek için üreticinin PCR Protokolü ve bir şablon olarak kullanın.</li>
	<li>DNA parçası 1 exon 1 sentez.</li>
	<li>DNA parçası 2 intron 336 ve Venüs DNA parçası arasındaki bağlayıcı olarak sentez.</li>
	<li>PAAV-EF1a-çift floxed-hChR2 (H134R) kesme - mCherry - WPRE-HGHpA vektör plazmid MluI ve EcoRI enzimleri ile. Jel ekstraksiyon kiti daha büyük DNA parçası arındırmak için kullanın. Üreticinin iletişim kuralını kullanırlar.</li>
	<li>Gibson derleme mix ve onun standart protokolü kullanarak, birlikte pAAV-P (Cry1)-intron336-Venus-NLS-D2-WPRE-HGHpA muhabir üretmek için DNA parçalarının hepsini topla. Üreticinin iletişim kuralını kullanırlar.</li>
</ol>2. virüs Adeno ilişkili15 imalatı
<ol><li>Aşağıdaki plazmid DNA stokları hazırlamak: 31.25 µg, pRV1, pH21 31.25 µg, pFdelta6 125 µg ve pAAV-p (Cry1) - intron336 - 62.5 µg Venüs-NLS - D2-WPRE-HGHpA.</li>
	<li>293T hücre beş 15 cm yemekleri hazırlamak ve hücreleri % 90 birleşmesi olana kadar bekle.</li>
	<li>Plazmid transfection reaktif protokol sonrası 297T hücrelere transfect. Her yemek için kullanın pRV1 6.25 µg, pH21, pFdelta6, 25 µg, pAAV-p (Cry1) 12.5 µg 6.25 µg-intron336-Venus-NLS-D2-WPRE-HGHpA ve 120 µL transfection reaktif.</li>
	<li>72 h transfection sonra bir pipet silah kullanarak her plaka hücrelerden ayırmak; hücreleri iki 50 mL tüpler içine hasat.</li>
	<li>Hücreleri 800 x g 10 dk de cips ve süpernatant atın. Hücreleri fosfat tamponlu tuz (PBS) 20 mL her tüpün içine yerleştirerek yıkayın; hücreleri 800 x g 10 dk de cips ve süpernatant atın.</li>
	<li>Granül 150 mM NaCl ve 20 mM Tris çözüm, pH 8.0 resuspend; çözüm/tüp 25 mL kullanın. Taze hazırlanmış % 10 sodyum deoxycholate (içinde dH2O) 1,25 mL her tüp için ekleyin. Benzonase nükleaz mL başına 50 adet son bir konsantrasyon ekleyin ve iyice karıştırın. 1s için 37 ° C'de kuluçkaya.</li>
	<li>Hücresel enkaz 3000 x g 15dk için de centrifuging tarafından kaldırın. Daha fazla tüm enkaz 0,45 mikron şırınga filtreden karışımı iterek kaldırıldığından emin olmak; Bu adımı heparin sütunlarının engelleme engellemeye yardımcı olur.</li>
	<li>Peristaltik pompa kullanarak heparin sütunlarını ayarlama; 1 mL/dk, yok hava kabarcıkları sütunlara tanıtıldı sağlanması için akış hızı ayarlayın.</li>
	<li>Bir 150 mM NaCl, 20 mM Tris çözüm, pH 8,0 10 mL içeren sütunlar equilibrate. Her sütun için virüs içeren çözüm ekleyin. Bir 100 mm NaCl, 20 mM Tris çözüm, pH 8.0 20 mL sütunlarla yıkayın. Sonra 5 mL şırınga kullanarak, ardından 1 mL 300 mm NaCl ve 20 mM Tris çözüm, pH 8.0 sütunlar 1 mL 200 mm NaCl ve 20 mM Tris çözüm pH 8.0, ile yıkayın.</li>
	<li>450 mM NaCl, 20 mM Tris çözüm, faz 8.0, 4 mL tarafından takip 3 mL 400 mM NaCl, 20 mM Tris çözüm, faz 8.0, virüs elute için bir 5 mL şırınga kullanın ve son olarak 3 mL 500 mm NaCl tarafından , 20 mM Tris çözüm, faz 8.0. Ayıklanan malzemeleri toplamak.</li>
	<li>Rekombinant adeno ilişkili virüs (rAAV) konsantrasyon için çıkarılan malzemeler, bir anda 4 mL santrifüj filtre cihazları 100.000 moleküler ağırlığı kesme yüklemek. Her 4-mL örnek akış yoluyla atarak oda sıcaklığında 5 min için 2000 x g, santrifüj kapasitesi.</li>
	<li>Tüm çıkarılan malzemeler santrifüj filtre cihazları çalıştırdığınız zaman PBS 4 mL ekleyin ve karışımı yaklaşık 250 μL santrifüj kapasitesi. RAAVs Kaldır (viral titresi-meli var olmak hakkında 2-8 x 1012 viral parçacıkların mL başına) santrifüj filtre cihazları, aliquot ve-80 ° C kadar kullanım mağazasında. Bu aşamada, virüs için birkaç ay depolanabilir.</li>
</ol>3. rAAV enjeksiyon ve yetişkin fare SCN (sahne) içine Optik Fiber ekleme
<ol><li>Sirkadiyen floresans muhabir taşıyan rAAVs enjeksiyon SCN içine<ol>
<li>5 µL rAAV yük (virüs titresi ilgili 2-8 x 1012 virüs parçacıkları mL başına) mikro şırınga içine.</li>
		<li>Bir yetişkin fare (2 için 5-aylık, C57BL/6 arka plan) tedavisiydi (80 mg/kg) ile mayi enjeksiyon yolu ile anestezi. Yeterli bir ayak parmağı-çimdik yanıt eksikliği ile anestezi derinliği için kontrol edin.</li>
		<li>Kürk fare başından kaldırın ve sonra fareyi stereotaksik aparatı monte için makas kullanın. Yolu ile dolaşan sıcak su battaniye ya da başka bir ısıtma cihazı imzalat hayvanlar için bir ısı kaynağı sağlar. Not: Alternatif olarak, kürk kaldırmak için depilatory krem veya elektrikli saç kesme makineleri kullanın.</li>
		<li>Cerrahi sitesi uygun dezenfeksiyon ajanlar ile temizleyin. Örneğin, bu arasında steril su ya da alkol ve iyot, betadin veya klorheksidin scrubs alternatif olarak sulandırmak. En az 3 kere tekrar edin. Cerrahi sitesi asmak.</li>
		<li>Bir kesik kafa derisi içinde yapmak ve kafatası maruz makas kullanın.</li>
		<li>Bregma ve lambda aynı yatay düzlemde çoğu stereotaksik aparatı ayarlayın; bregma iki sathını aynı yatay düzlemde olun.</li>
		<li>Kullanım bir steril pamuklu çubukla H2O2/h2O beyin kapaklarini zarar için %4 oranında batırılmış. O zaman bir temiz, steril pamuklu çubukla temizleyin ve kafatası yüzeyini kuru için kullanın.</li>
		<li>Mikro bir matkap kullanarak, bir delik yaklaşık 1 mm çap 0,46 mm arka ve 0,25 mm bregma için yanal olun.</li>
		<li>
Fi Temiz pamuk steril bez fizyolojik serum çözüm ile kemik parçaları beynin maruz yüzeyinden temizlemek için kullanın.</li>
		<li>Beyin, mikro şırınga ucu 0,46 mm arka olduğunu kontrol ettikten ve kafatası yüzeyinden 0,25 mm lateral bregma ve 5.7 mm derin bir mikro şırınga takın.</li>
		<li>500 enjekte rAAV (50 nL min-1) mikro şırınga rAAV tam difüzyon sağlamak için enjeksiyon sonra 10 dk için yerinde bırakarak SCN (sahne), içine nL.</li>
		<li>Yavaş yavaş mikro şırınga geri alıyorum.</li>
	</ol>
</li>
	<li>Fiber optik sahne alanı'na ekleyin.<ol>
<li>Bir fiber optik bıçak kullanarak, bir lif 17 mm uzunluğu, optik fiber her iki tarafında düzgün olduğundan emin kesti.</li>
		<li>Optik lif seramik yüksük yerleştirin ve fiber optik ve seramik hakla yüzeylerin floş sağlama optik fiber ile metil etil keton peroksit (AB tutkal), seramik hakla için düzeltin.</li>
		<li>Soğuk sterilant çözüm veya etilen oksit varlığımla temiz.</li>
		<li>Sonra rAAV enjeksiyon (adım 3.1.11), seramik hakla içeren optik fiber SCN (sahne) yerleştirin.</li>
		<li>Seramik hakla ve diş reçine kullanarak kafatası üzerine fiber optik düzeltmek ve kurumasını sağlar.</li>
		<li>Diş reçine yüzey ile arka oje sürün. 3.1.2 için 3.2.5, rAAV denetimi için gerçek enjeksiyon atlama özetlenen yordamları yineleyin.</li>
	</ol>
</li>
	<li>Ameliyat sonrası bakım<ol>
<li>Fareler gibi buprenorfin 2 mg/kg vücut ağırlığı, ameliyat sonrası ağrı kesici sağlamak subkutan, günde iki kez.</li>
		<li>Anesteziden geliyorlar iken fare kurtarma kafese koyun.</li>
		<li>Tek tek bir koşulda 12 h açık/koyu (ışık şiddeti ~ 100 lux kafesin dibinde) gıda/su kullanılabilir ad libitumile ev fareler. Sekiz gün daha fazla deneme önce yeterli kurtarma süresi için izin vermek ve en uygun floresan muhabir ifade sağlamak için ayrılan.</li>
	</ol>
</li>
</ol>4. in vivo floresans sinyal izleme ve veri toplama
<ol><li>Sekiz gün ameliyat sonra bağlanmak fare kafasına fiber floresans sinyal kayıt memurlar ile (Örn., Gene Observer). Arka plan sinyal kurmak için denetim fareler SCN floresans sinyal kontrol edin. Gözlem ve floresan sinyal İzleyicisi'ni kullanarak bu sinyal ölçümü yapmak.</li>
	<li>Deneysel fare floresans sinyalinin kontrol fare aynı operasyonu ile değerlendirin. Bu büyük olasılıkla belgili tanımlık uç optik fiber SCN kaçırdı gösterir gibi olan viral vektör alınan ama hangi yalnızca arka plan sinyal analizi, görüntüler fare hariç. Bu ilk önlemleri sonra fareler floresans sinyal stabilize etmek için izin vermek başka bir 2 hafta için ev onların kafes dönün.</li>
	<li>3 hafta sonra farelerin floresans sinyal kayıt memurlar ile bağlayın. 15 floresans ölçmek s 100 Hz frekansta her 10 min. Bu ölçümler sırasında fareler yiyecek/su kullanılabilir ad libitumile onların kafes içinde serbestçe hareket ediyor. Bir ışık şiddeti ~ 100 lux, kafesin altındaki kullanın ve bir uç arasında 15-20 µW optik fiber lazer güç.</li>
	<li>Tüm kayıtları tamamlanmasından sonra fare ile % 4 paraformaldehyde, sıvı ve kaldırmak ve optik fiber yerleşimini kontrol etmek için beyin dilim. Optik fiber uç doğru SCN implante değil Eğer fareler çözümleme dışı bırakmak.</li>
</ol>5. veri analizi ve sunum
<ol><li>Ölçü floresans sinyal her 10 min 15 s, 100 Hz 1500 veri noktaları verim, bir frekansta. Bu 1500 puan ortalama floresans sinyal vasıl birisi tutkucun zaman nokta çevirir. Zaman içinde birden çok ortalamalar komplo Cry1 transkripsiyon ritmi altında serbestçe fare hareket eden bir denetim ışık koşulunda SCN (sahne) karşılık gelen bir sinyal zaman eğrisi oluşturur.</li>
</ol>

<ol>
	<li>Welsh, D. K., Takahashi, J. S., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suprachiasmatic+nucleus:+cell+autonomy+and+network+properties.">Suprachiasmatic nucleus: cell autonomy and network properties.</a> Annual Review of Physiology. 72, 551-577 (2010).</li><li>Zhang, E. E., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clocks+not+winding+down:+unravelling+circadian+networks.">Clocks not winding down: unravelling circadian networks.</a> Nature Reviews Molecular Cell Biology. 11, 764-776 (2010).</li><li>Takahashi, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+of+the+mammalian+circadian+clock.">Transcriptional architecture of the mammalian circadian clock.</a> Nature Reviews Genetics. 18, 164-179 (2017).</li><li>Yoo, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PERIOD2::LUCIFERASE+real-time+reporting+of+circadian+dynamics+reveals+persistent+circadian+oscillations+in+mouse+peripheral+tissues.">PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues.</a> Proceedings of the National Academy of Sciences U S A. 101, 5339-5346 (2004).</li><li>Davidson, A. J., Castanon-Cervantes, O., Leise, T. L., Molyneux, P. C., Harrington, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+jet+lag+in+the+mouse+suprachiasmatic+nucleus+and+peripheral+circadian+timing+system.">Visualizing jet lag in the mouse suprachiasmatic nucleus and peripheral circadian timing system.</a> European Journal of Neuroscience. 29, 171-180 (2009).</li><li>Savelyev, S. A., Larsson, K. C., Johansson, A. S., Lundkvist, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slice+preparation,+organotypic+tissue+culturing+and+luciferase+recording+of+clock+gene+activity+in+the+suprachiasmatic+nucleus.">Slice preparation, organotypic tissue culturing and luciferase recording of clock gene activity in the suprachiasmatic nucleus.</a> Journal of Visualized Experiments. (48), (2011).</li><li>Yamaguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression:+View+of+a+mouse+clock+gene+ticking.">Gene expression: View of a mouse clock gene ticking.</a> Nature. 409, 684-684 (2001).</li><li>Ono, D., Honma, K. I., Honma, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circadian+and+ultradian+rhythms+of+clock+gene+expression+in+the+suprachiasmatic+nucleus+of+freely+moving+mice.">Circadian and ultradian rhythms of clock gene expression in the suprachiasmatic nucleus of freely moving mice.</a> Science Reports. 5, 12310 (2015).</li><li>Ono, D., Honma, S., Honma, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circadian+PER2::LUC+rhythms+in+the+olfactory+bulb+of+freely+moving+mice+depend+on+the+suprachiasmatic+nucleus+but+not+on+behaviour+rhythms.">Circadian PER2::LUC rhythms in the olfactory bulb of freely moving mice depend on the suprachiasmatic nucleus but not on behaviour rhythms.</a> European Journal of Neuroscience. 42, 3128-3137 (2015).</li><li>Ono, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+Per1+and+Bmal1+circadian+rhythms+in+the+suprachiasmatic+nucleus+in+parallel+with+behavioral+outputs.">Dissociation of Per1 and Bmal1 circadian rhythms in the suprachiasmatic nucleus in parallel with behavioral outputs.</a> Proceedings of the National Academy of Sciences U S A. 114, E3699-E3708 (2017).</li><li>Reppert, S. M., Weaver, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordination+of+circadian+timing+in+mammals.">Coordination of circadian timing in mammals.</a> Nature. 418, 935-941 (2002).</li><li>Liu, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+function+of+REV-ERBalpha+and+beta+and+non-essential+role+for+Bmal1+cycling+in+transcriptional+regulation+of+intracellular+circadian+rhythms.">Redundant function of REV-ERBalpha and beta and non-essential role for Bmal1 cycling in transcriptional regulation of intracellular circadian rhythms.</a> PLoS Genetics. 4, e1000023 (2008).</li><li>Maywood, E. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+core+circadian+feedback+loop+in+suprachiasmatic+nucleus+of+mCry1-luc+transgenic+reporter+mouse.">Analysis of core circadian feedback loop in suprachiasmatic nucleus of mCry1-luc transgenic reporter mouse.</a> Proceedings of the National Academy of Sciences U S A. 110, 9547-9552 (2013).</li><li>Ukai-Tadenuma, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delay+in+feedback+repression+by+cryptochrome+1+is+required+for+circadian+clock+function.">Delay in feedback repression by cryptochrome 1 is required for circadian clock function.</a> Cell. 144, 268-281 (2011).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> Journal of Visualized Experiments. 57, e3348 (2011).</li><li>Yamaguchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mice+genetically+deficient+in+vasopressin+V1a+and+V1b+receptors+are+resistant+to+jet+lag.">Mice genetically deficient in vasopressin V1a and V1b receptors are resistant to jet lag.</a> Science. 342, 85-90 (2013).</li><li>Nagano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+abrupt+shift+in+the+day/night+cycle+causes+desynchrony+in+the+mammalian+circadian+center.">An abrupt shift in the day/night cycle causes desynchrony in the mammalian circadian center.</a> Journal of Neuroscience. 23, 6141-6151 (2003).</li><li>Golombek, D. A., Rosenstein, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiology+of+Circadian+Entrainment.">Physiology of Circadian Entrainment.</a> Physiological Reviews. 90, 1063-1102 (2010).</li><li>Mei, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vivo+recording+of+circadian+rhythms+in+brains+of+freely+moving+mice.">Long-term in vivo recording of circadian rhythms in brains of freely moving mice.</a> Proceedings of the National Academy of Sciences. 115, 4276-4281 (2018).</li></ol>

Yazarlar hiçbir ifşa etmek çıkar çatışması var.

Dilim kültür4,5, RT-PCR16ve in situ hibridizasyon17, hayvanların öldürülmesi gerektiren gibi ex vivo Yöntemler aksine kayıt yöntemi içinde vivo sağlar Müfettişler sirkadiyen gen ekspresyonu yaşayan hayvan çalışmaya. Bu nedenle, bu teknoloji farklı fiziksel tedirginlikler (Örneğin, uykusuzluk, stres, gıda alımı, vb) sinir sirkadiyen saat üzerinde etkisini değerlendirmek için yeteneği sağlar. Vivo bioluminescence7,8,sadece sürekli karanlık koşullarda çalışabilir10 yöntemi aksine kayıt yöntemi floresans in vivo ışık altında uygulanabilir koşullar-a önemli avantajı teknoloji ışık olarak yeniden sürüklenme SCN sirkadiyen saat18sinyalleri. Nispeten sabit, sağlam sirkadiyen ritim bu yöntemi ile tespit edilebilir olsa da, o muhabir teknoloji nicel bilgi sağlamaz ve bu nedenle Gen transkripsiyonu düzeylerini ölçmek için kullanılabilir değil belirtilmelidir ve çeviri.
Bu protokol birçok kritik adımlar vardır. Konsantre rAAV titresi 2-8 x 1012 viral parçacıkların mL başına olarak yüksek olmalıdır; daha düşük viral titreleri loş veya bile belirlenemeyen floresan sinyallerini verirdim. Ne zaman fare Başkanı stereotaksik aparatı fixing, kafatası için güvenli doğru konumlandırma virüs enjeksiyon ve fiber optik implantasyon için yatay olduğundan emin olun. Enjeksiyon virüs yavaş yavaş yapılmalıdır (virüs SCN içinde kalmasını sağlamak için ≤50 nL min-1). Seramik hakla ve fiber optik kafatasında güvenli bir şekilde sabit olmalıdır ve diş reçine cilt ile değil. Seramik hakla ve fiber optik yeterince sabit değildir, onlar yavaş yavaş fare başından ayırmak.
Bu teknik diğer gen gazeteciler dahil etmek için uzatılabilir (Örneğin, Per2, Bmal1, c-Fos, Pomc, vb) düzenleyici ve karşılık gelen intron19değiştirerek. İki ters lox serileri ile bayrak-inton336-Venüs-NLS-D2 kaset geri ve muhabir Cre fare çizgi ile birleştirerek, bu teknoloji belirli nöronların etkinliklerini kaydetmek için kullanılabilir. Örneğin, bu yaklaşım bir VIP-cre fare çizgiyle birleştiren Cry1 transkripsiyon ritimler vazoaktif intestinal polipeptid ifade nöronların SCN kaydı için sağlayacak. Bu yöntem aynı zamanda Ca2 + sirkadiyen ritim beyin ve kaydetmek için bir Ca2 + göstergesi olarak GCaMP6 istihdam edebilirsiniz.

Memelilerde, bütün vücudun sirkadiyen ritim eksojen çevresel değişiklikler (Örneğin, ışık, sıcaklık, stres, vb)1bir kişinin yanıt koordine etmek suprachiasmatic çekirdeği (SCN) yönetir. Çekirdek saat bileşenleri Per1-3, Cry1-2, saatve Bmal1oluşur ve her hücrenin sirkadiyen saat düzenleyen merkezi bir rol oynamaktadır. Transkripsiyon harekete geçirmek, saat/BMAL1, başına ifade ikna etmek için heterodimerdir davranan SCN her hücrede ve CRY. PER / CRY karmaşık sonra 24 saat tam2,3' e alır bir transkripsiyon çeviri geri besleme döngüsü oluşturmak için saat/BMAL1 işlevini engeller.
SCN önceki çalışmaları esas olarak ex vivo SCN dilim kültür Yöntem4,5,6 istihdam ve bu yaklaşım değerli bilgileri sağlamış olması iken, kendi sınırlamaları yeteneğimizi inhibe eksojen uyaranlara (Örneğin, ışık) etkisi kritik bu bölgede ikamet eden hücrelerin yanı sıra diğer beyin çekirdekleri SCN üzerinde etkisi ile ilgili verileri alır. 2001 yılında Hitoshi Okamura'nın grup içinde vivo monitör sirkadiyen saat gen ekspresyonu bioluminescence sisteme serbestçe fare7hareketli SCN (sahne) kullanmak için ilkti. Ken-Ichi Honma'nın grup daha fazla kayıt sistemi SCN (sahne)8',9,10bioluminescence vivo içinde gelişmekte olan son birkaç yıl harcadı. Birlikte, bu çalışmalarda araştırmacılar ile sirkadiyen saat sürekli karanlık veya ışık nabız sonra izleme olanağı sağladı. Ancak, bioluminescence sürekli açık/koyu döngüsü sırasında ışık sirkadiyen saat11, SCN-aracılı sürüklenme için gerekli baskın sinyal olması ile birleştiğinde izlenmesi için izin vermek için çok karanlık olduğu için yoktur bioluminescence kayıt ile ilgili sınırlamalar üstesinden deneysel Yöntem geliştirme için artan talebi. Geçerli raporu fareler serbestçe hareket SCN vivo içinde sirkadiyen saat izlemek için inşa edilmiş bir floresan tabanlı sistem açıklar. Bu kullanımı kolay yöntem sürekli açık/koyu döngüsü sırasında izleme izin verir ve gerçek zamanlı olarak ve yüksek zamansal çözünürlükte SCN sirkadiyen saat genlerin transkripsiyon uzun vadeli gözlenmesi için izin verir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1408px;" width="1408">
	<tbody>
		<tr height="19">
			<td height="19" style="height:19px;width:627px;">KOD Plus Neo</td>
			<td style="width:403px;">TOYOBO</td>
			<td style="width:133px;">KOD-401</td>
			<td style="width:245px;">Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">pVENUS-N1</td>
			<td>addgene</td>
			<td>#61854</td>
			<td>Plasmid</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">pcDNA3.3_d2eGFP</td>
			<td>addgene</td>
			<td>#26821</td>
			<td>Plasmid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:21px;">pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA</td>
			<td>addgene</td>
			<td>#20297</td>
			<td>Plasmid</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">MluI</td>
			<td>Thermo Scientific</td>
			<td>FD0564</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">EcoRI</td>
			<td>Thermo Scientific</td>
			<td>FD0274</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Gibson Assembly Mix</td>
			<td>NEB</td>
			<td>E2611s</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Lipofectamine 2000</td>
			<td>Thermo Scientific</td>
			<td>12566014</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Syringe Filter</td>
			<td>EMD Millipore</td>
			<td>SLHV033RS</td>
			<td>0.45&#160;&#181;m&#160;</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">HiTrap heparin columns</td>
			<td>gelifesciences</td>
			<td>17-0406-01</td>
			<td>1 mL&#160;</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Amicon ultra-4 centrifugal filter</td>
			<td>EMD Millipore</td>
			<td>&#160;UFC810024</td>
			<td>100,000 MWCO</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Benzonase nuclease</td>
			<td>Sigma-Aldrich</td>
			<td>E1014</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Sodium deoxycholate</td>
			<td>Sigma-Aldrich</td>
			<td>D5670</td>
			<td>Make fresh solution for each batch</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">mouse stereotaxic apparatus</td>
			<td>B&#38;E TEKSYSTEMS LTD</td>
			<td>#SR-5M/6M</td>
			<td>Equipment</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">pentobarbital</td>
			<td>SigmaAldrich</td>
			<td>#1507002</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">mouse stereotaxic apparatus</td>
			<td>B&#38;E TEKSYSTEMS LTD</td>
			<td>#SR-5M/6M</td>
			<td>Equipment</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Hydrogen peroxide solution</td>
			<td>SigmaAldrich</td>
			<td>#216763</td>
			<td>Reagent</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Optical Fiber</td>
			<td>Thorlabs</td>
			<td>FT200EMT</td>
			<td>0.39 NA, &#216;200 &#181;m</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">microsyringe pump</td>
			<td>Nanoliter 2000 Injector, WPI</td>
			<td></td>
			<td>Equipment</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">ceramic ferrule</td>
			<td>Shanghai Fiblaser</td>
			<td></td>
			<td>230&#8201;&#956;m I.D., 2.5 mm O.D.</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;">Gene Observer</td>
			<td>BiolinkOptics</td>
			<td></td>
			<td>Equipment</td>
		</tr>
	</tbody>
</table>

in vivo monitoring of circadian clock gene expression in the mouse suprachiasmatic nucleus using fluorescence reporters

Bu teknik aracılı fiber optik floresans kayıtları rekombinant adeno ilişkili virüs dayalı gen gazetecilere kesin teslim ile birleştirir. Bu yeni ve kullanımı kolay vivo içinde floresans izleme sistemi saat gene, Cry1, transkripsiyon ritmine fareler serbestçe hareket suprachiasmatic çekirdeğinde (SCN) kaydetmek için geliştirilmiştir. Bunu yapmak için bir Cry1 transkripsiyon floresans muhabir tasarlanmış ve Adeno ilişkili virüs paketlenmiş. Arıtılmış, konsantre virüs SCN (sahne) o zaman beynin yüzeyine tespit edildi bir optik kablo, ekleme ve ardından fare içine enjekte ettiler. Hayvanlar için ev onların kafes döndü ve bir 1 ay ameliyat sonrası iyileşme döneminde yeterli muhabir ifade emin olmak izin. Floresan sonra serbestçe fareler bir vivo içinde bizim kurum olarak inşa edilmiş sistem izleme yoluyla hareket kaydedildi. Kayıt sistemi içinde vivo için 488 nm lazer ile bir 1 × 4 ışın-kırık ışık eşit güç dört lazer uyarma çıkışları bölünmüş birleştiğinde. Bu kurulum bize aynı anda dört hayvanlardan kaydetmek etkin. Her biri verilmiş floresan sinyallerini bir photomultiplier tüp ve bir veri alma kartı toplanmıştır. Buna ek olarak önceki bioluminescence vivo içinde sirkadiyen saat kayıt tekniği için kayıt sistemi bu floresans in vivo sirkadiyen saat gen ekspresyonu ışık döngüsü sırasında kayıt izin.

Floresans muhabir tasarımı Cry1 Şekil 1Agösterisinde idi. Yaklaşımı kullanarak ayrıntılı 500 yukarıda, nL rAAV-p (Cry1) - intron336 - Venüs-NLS-D2 başarıyla bir yetişkin fare SCN enjekte ettiler ve sağlam Venüs ifade (Şekil 1B, 1 C) sergilenmektedir. Floresan sinyallerini 12 h/12 h açık/koyu (LD) ve karanlık/koyu (DD) koşulları (Şekil 2) altında kaydedilen koşulların her ikisi de sağlam sirkadiyen ritim vermiştir. Son olarak, floresans sinyal uzun ve kısa photoperiod koşulları (Şekil 3) kaydedildi.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56765/56765fig1.jpg"> Şekil 1. Floresans muhabir tasarım ve SCN ifade (A) Cry1floresan muhabir tasarımı. (B) Photomicrograph 8 gün sonra virüs enjeksiyon muhabir ifade gösterilen fare beyin. (B) gösterilen photomicrograph üzerinde kırmızı kutulu alanının (C) büyütme. <a href="/files/ftp_upload/56765/56765fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56765/56765fig2.jpg"> Şekil 2. SCN LD ve DD koşullar altında kayıt floresans in vivo (A)arka plan floresans tespit hiçbir ritmi LD ve DD koşullar altında gösterilen SCN (sahne) içinde. Beyaz ve gri alanlar ışık açma ve ışık kapatma dönemleri, sırasıyla gösterilir. (B) P (Cry1) - intron336 - Venüs-NLS-D2 ifade 7 gün 12-12 LD koşuldaki ve DD koşuldaki 7 gün boyunca. (C) analiz sirkadiyen ritim LD koşulu (~24.4 h); kırmızı çizgi (uygun sonucu sol bölmede gösterilir) sinüs eğrisi yaklaştırılmış uyum gösterir. (D) analiz sirkadiyen ritim DD koşulu (~23.25 h); kırmızı çizgi (uygun sonucu sol bölmede gösterilir) sinüs eğrisi yaklaştırılmış uyum gösterir. <a href="/files/ftp_upload/56765/56765fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56765/56765fig3.jpg"> Şekil 3. Vivo floresans kayıtları SCN altında 20-4 uzun ve 4-20 kısa photoperiod koşulları P (Cry1) - intron336 - floresan kaydı örneği Venus-NLS-D2 ifade SCN (sahne) bir 12-12 LD koşul altında 7 gün içinde bir koşulda 20-4 uzun photoperiod, 12-12 LD koşul altında 3 gün bir DD koşulda 3 gün 7 gün tarafından takip ve sonra 7 gün 4-20 kısa photoperiod koşul altında. Beyaz ve gri alanlar ışık açma ve ışık kapatma dönemleri, sırasıyla gösterilir. <a href="/files/ftp_upload/56765/56765fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
Tablo 1. Belirli reaktifler protokolü için gerekli ( Tablo malzemelerigörmek)
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>astar adı</td>
			<td colspan="3">sıra</td>
		</tr>
<tr>
<td>astar F1</td>
			<td colspan="3">cactaggggttcctgcggccgcACGCGTGTAAAGATGCACATGTG</td>
		</tr>
<tr>
<td>astar R1</td>
			<td colspan="3">TTGTAACCTTGATACTTACCTACTTAGATCGCAGATCTCGTCCGG</td>
		</tr>
<tr>
<td>astar F2</td>
			<td colspan="3">GTTATGACACAGTGTAGAAACTATGGCATAGGACAGATGACTGTG</td>
		</tr>
<tr>
<td>astar R2</td>
			<td colspan="3">CATGGTCTTTGTAGTCCATGGTGGGTACCtCTTGACAGCTCTACC</td>
		</tr>
<tr>
<td>astar F3</td>
			<td colspan="3">ctgtattttcagggcCCTGCAGGtGTGAGCAAGGGCGAGGAGCTG</td>
		</tr>
<tr>
<td>astar R3</td>
			<td colspan="3">TACCTTTCTCTTCTTTTTTGGAGGCTTGTACAGCTCGTCCATGCC</td>
		</tr>
<tr>
<td>astar F4</td>
			<td colspan="3">GCATGGACGAGCTGTACAAGCCTCCAAAAAAGAAGAGAAAGGTAG</td>
		</tr>
<tr>
<td>astar R4</td>
			<td colspan="3">tgatatcgaattcGGATCCCTACACATTGATCCTAGCAGAAGCAC</td>
		</tr>
</tbody></table>Tablo 2. İletişim kuralında kullanılan astar
Tablo 3. DNA dizisi iletişim kuralında kullanılan <a href="/files/ftp_upload/56765/Table3.xlsx">bu dosyayı indirmek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters at JoVE.com

In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

Bu yeni geliştirilmiş floresans tabanlı teknoloji uzun vadeli, suprachiasmatic çekirdeği (SCN) sirkadiyen saat genlerde transkripsiyonu gerçek zamanlı olarak ve yüksek zamansal çözünürlükte fareler serbestçe hareket izleme sağlar.

Vivo Sirkadiyen saat gen ekspresyonu floresans gazetecilere kullanarak fare Suprachiasmatic çekirdeği olarak izlenmesi

This technique combines optical fiber mediated fluorescence recordings with the precise delivery of recombinant adeno-associated virus based gene ...

in-vivo-monitoring-circadian-clock-gene-expression-mouse

Nanyang Technological University

Research

JoVE Journal

Neuroscience

In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

8.2K Görüntüleme.  Peking University. Bu yeni geliştirilmiş floresans tabanlı teknoloji uzun vadeli, suprachiasmatic çekirdeği (SCN) sirkadiyen saat genlerde transkripsiyonu gerçek zamanlı olarak ve yüksek zamansal çözünürlükte fareler serbestçe hareket izleme sağlar.

Video: In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

Slice Preparation, Organotypic Tissue Culturing and Luciferase Recording of Clock Gene Activity in the Suprachiasmatic Nucleus

A central circadian (~24 hr) clock coordinating daily rhythms in physiology and behavior resides in the suprachiasmatic nucleus (SCN) located in the anterior hypothalamus. The clock is directly synchronized by light via the retina and optic nerve. Circadian oscillations are generated by interacting negative feedback loops of a number of so called "clock genes" and their protein products, including the Period (Per) genes. The core clock is also dependent on membrane depolarization, calcium and cAMP 1. The SCN shows daily oscillations in clock gene expression, metabolic activity and spontaneous electrical activity. Remarkably, this endogenous cyclic activity persists in adult tissue slices of the SCN 2-4. In this way, the biological clock can easily be studied in vitro, allowing molecular, electrophysiological and metabolic investigations of the pacemaker function.
The SCN is a small, well-defined bilateral structure located right above the optic chiasm 5. In the rat it contains ~8.000 neurons in each nucleus and has dimensions of approximately 947 &mu;m (length, rostrocaudal axis) x 424 &mu;m (width) x 390 &mu;m (height) 6. To dissect out the SCN it is necessary to cut a brain slice at the specific level of the brain where the SCN can be identified. Here, we describe the dissecting and slicing procedure of the SCN, which is similar for mouse and rat brains. Further, we show how to culture the dissected tissue organotypically on a membrane 7, a technique developed for SCN tissue culture by Yamazaki et al. 8. Finally, we demonstrate how transgenic tissue can be used for measuring expression of clock genes/proteins using dynamic luciferase reporter technology, a method that originally was used for circadian measurements by Geusz et al. 9. We here use SCN tissues from the transgenic knock-in PERIOD2::LUCIFERASE mice produced by Yoo et al. 10. The mice contain a fusion protein of PERIOD (PER) 2 and the firefly enzyme LUCIFERASE. When PER2 is translated in the presence of the substrate for luciferase, i.e. luciferin, the PER2 expression can be monitored as bioluminescence when luciferase catalyzes the oxidation of luciferin. The number of emitted photons positively correlates to the amount of produced PER2 protein, and the bioluminescence rhythms match the PER2 protein rhythm in vivo 10. In this way the cyclic variation in PER2 expression can be continuously monitored real time during many days. The protocol we follow for tissue culturing and real-time bioluminescence recording has been thoroughly described by Yamazaki and Takahashi 11.

The procedure of preparing slices containing the adult mouse hypothalamic suprachiasmatic nucleus (SCN), and a rapid way to culture the SCN tissue in organotypic culture condition, are reported. Further, the measurement of oscillatory clock gene protein expression using dynamic luciferase reporter technology is described.

Dilim hazırlanması, Organotipik Doku ekimi ve suprakiazmatik nükleus Saat Gen Faaliyet Lusiferaz Kayıt

A central circadian (~24 hr) clock coordinating daily rhythms in physiology and behavior resides in the suprachiasmatic nucleus (SCN) located in the ...

Nörobilim

Spinal Cord Electrophysiology II: Extracellular Suction Electrode Fabrication

Development of neural circuitries and locomotion can be studied using neonatal rodent spinal cord central pattern generator (CPG) behavior. We demonstrate a method to fabricate suction electrodes that are used to examine CPG activity, or fictive locomotion, in dissected rodent spinal cords. The rodent spinal cords are placed in artificial cerebrospinal fluid and the ventral roots are drawn into the suction electrode. The electrode is constructed by modifying a commercially available suction electrode. A heavier silver wire is used instead of the standard wire given by the commercially available electrode. The glass tip on the commercial electrode is replaced with a plastic tip for increased durability. We prepare hand drawn electrodes and electrodes made from specific sizes of tubing, allowing consistency and reproducibility. Data is collected using an amplifier and neurogram acquisition software. Recordings are performed on an air table within a Faraday cage to prevent mechanical and electrical interference, respectively.

A demonstration of the fabrication and use of an extracellular suction electrode used to measure electrophysiological recordings of neonatal rodent spinal cords in vitro

Omurilik Elektrofizyoloji II: Ekstrasellüler Emiş Elektrot İmalatı

Development of neural circuitries and locomotion can be studied using neonatal rodent spinal cord central pattern generator (CPG) behavior. We demonstrate ...

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural connectivity form during development. In mice, retinofugal projections are arranged in a topographic manner and form eye-specific layers in the Lateral Geniculate Nucleus (dLGN) of the thalamus and the Superior Colliculus (SC). The development of these precise patterns of retinofugal projections has typically been studied by labeling populations of RGCs with fluorescent dyes and tracers, such as horseradish peroxidase1-4. However, these methods are too coarse to provide insight into developmental changes in individual RGC axonal arbor morphology that are the basis of retinotopic map formation. They also do not allow for the genetic manipulation of RGCs.
Recently, electroporation has become an effective method for providing precise spatial and temporal control for delivery of charged molecules into the retina5-11. Current retinal electroporation protocols do not allow for genetic manipulation and tracing of retinofugal projections of a single or small cluster of RGCs in postnatal mice. It has been argued that postnatal in vivo electroporation is not a viable method for transfecting RGCs since the labeling efficiency is extremely low and hence requires targeting at embryonic ages when RGC progenitors are undergoing differentiation and proliferation6. 
In this video we describe an in vivo electroporation protocol for targeted delivery of genes, shRNA, and fluorescent dextrans to murine RGCs postnatally. This technique provides a cost effective, fast and relatively easy platform for efficient screening of candidate genes involved in several aspects of neural development including axon retraction, branching, lamination, regeneration and synapse formation at various stages of circuit development. In summary we describe here a valuable tool which will provide further insights into the molecular mechanisms underlying sensory map development.

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

We demonstrate an in vivo electroporation protocol for transfecting single or small clusters of retinal ganglion cells (RGCs) and other retinal cell types in postnatal mice over a wide range of ages. The ability to label and genetically manipulate postnatal RGCs in vivo is a powerful tool for developmental studies.

Fare Retina Ganglion Hücreleri Transfeksiyon tarafından In vivo Elektroporasyon

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of the breadth of molecular regulation. Newer approaches such as high-resolution RNA sequencing (RNA-Seq)1 provides new and expansive information about tissue- or state-specific expression such as relative transcript levels, alternative splicing, and micro RNAs2-4. Prospects for employing the RNA-Seq method in comparative whole transcriptome profiling5 within discrete tissues or between phenotypically distinct groups of individuals affords new avenues for elucidating molecular mechanisms involved in both normal and abnormal physiological states. Recently, whole transcriptome profiling has been performed on human brain tissue, identifying gene expression differences associated with disease progression6. However, the use of next-generation sequencing has yet to be more widely integrated into mammalian studies.
Gene expression studies in mouse models have reported distinct profiles within various brain nuclei using laser capture microscopy (LCM) for sample excision7,8. While LCM affords sample collection with single-cell and discrete brain region precision, the relatively low total RNA yields from the LCM approach can be prohibitive to RNA-Seq and other profiling approaches in mouse brain tissues and may require sub-optimal sample amplification steps. Here, a protocol is presented for microdissection and total RNA extraction from discrete mouse brain regions. Set-diameter tissue corers are used to isolate 13 tissues from 750-&mu;m serial coronal sections of an individual mouse brain. Tissue micropunch samples are immediately frozen and archived. Total RNA is obtained from the samples using magnetic bead-enabled total RNA isolation technology. Resulting RNA samples have adequate yield and quality for use in downstream expression profiling. This microdissection strategy provides a viable option to existing sample collection strategies for obtaining total RNA from discrete brain regions, opening possibilities for new gene expression discoveries.

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

RNA expression profiling of discrete mouse brain regions requires a precise and repeatable tissue collection strategy. A protocol that uses both coronal brain sectioning and tissue corer-assisted microdissection is described here. The yield and quality of total RNA obtained from the resulting samples confirms the utility of the outlined method.

Toplam RNA İzolasyonu ve Alt Nesil Sıralama ve Kaynak gösterilmeden kullanılamaz Ayrık Fare Beyin Bölgeler Mikrodisseksiyon Sigara Lazer Yakalama Mikroskopi Yaklaşım

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

High-resolution Live Imaging of Cell Behavior in the Developing Neuroepithelium

The embryonic spinal cord consists of cycling neural progenitor cells that give rise to a large percentage of the neuronal and glial cells of the central nervous system (CNS). Although much is known about the molecular mechanisms that pattern the spinal cord and elicit neuronal differentiation1, 2, we lack a deep understanding of these early events at the level of cell behavior. It is thus critical to study the behavior of neural progenitors in real time as they undergo neurogenesis.
In the past, real-time imaging of early embryonic tissue has been limited by cell/tissue viability in culture as well as the phototoxic effects of fluorescent imaging. Here we present a novel assay for imaging such tissue for long periods of time, utilizing a novel ex vivo slice culture protocol and wide-field fluorescence microscopy (Fig. 1). This approach achieves long-term time-lapse monitoring of chick embryonic spinal cord progenitor cells with high spatial and temporal resolution.
This assay may be modified to image a range of embryonic tissues3, 4 In addition to the observation of cellular and sub-cellular behaviors, the development of novel and highly sensitive reporters for gene activity (for example, Notch signaling5) makes this assay a powerful tool with which to understand how signaling regulates cell behavior during embryonic development.

Imaging embryonic tissue in real-time is challenging over long periods of time. Here we present an assay for monitoring cellular and sub-cellular changes in chick spinal cord for long periods with high spatial and temporal resolution. This technique can be adapted for other regions of the nervous system and developing embryo.

Gelişmekte Neuroepithelium Hücre Davranış Yüksek çözünürlüklü Canlı Görüntüleme

The embryonic spinal cord consists of cycling neural progenitor cells that give rise to a large percentage of the neuronal and glial cells of the central ...

Functional Neuroimaging Using Ultrasonic Blood-brain Barrier Disruption and Manganese-enhanced MRI

Although mice are the dominant model system for studying the genetic and molecular underpinnings of neuroscience, functional neuroimaging in mice remains technically challenging. One approach, Activation-Induced Manganese-enhanced MRI (AIM MRI), has been used successfully to map neuronal activity in rodents 1-5. In AIM MRI, Mn2+ acts a calcium analog and accumulates in depolarized neurons 6,7. Because Mn2+ shortens the T1 tissue property, regions of elevated neuronal activity will enhance in MRI. Furthermore, Mn2+ clears slowly from the activated regions; therefore, stimulation can be performed outside the magnet prior to imaging, enabling greater experimental flexibility. However, because Mn2+ does not readily cross the blood-brain barrier (BBB), the need to open the BBB has limited the use of AIM MRI, especially in mice.
One tool for opening the BBB is ultrasound. Though potentially damaging, if ultrasound is administered in combination with gas-filled microbubbles (i.e., ultrasound contrast agents), the acoustic pressure required for BBB opening is considerably lower. This combination of ultrasound and microbubbles can be used to reliably open the BBB without causing tissue damage 8-11.
Here, a method is presented for performing AIM MRI by using microbubbles and ultrasound to open the BBB. After an intravenous injection of perflutren microbubbles, an unfocused pulsed ultrasound beam is applied to the shaved mouse head for 3 minutes. For simplicity, we refer to this technique of BBB Opening with Microbubbles and UltraSound as BOMUS 12. Using BOMUS to open the BBB throughout both cerebral hemispheres, manganese is administered to the whole mouse brain. After experimental stimulation of the lightly sedated mice, AIM MRI is used to map the neuronal response.
To demonstrate this approach, herein BOMUS and AIM MRI are used to map unilateral mechanical stimulation of the vibrissae in lightly sedated mice 13. Because BOMUS can open the BBB throughout both hemispheres, the unstimulated side of the brain is used to control for nonspecific background stimulation. The resultant 3D activation map agrees well with published representations of the vibrissae regions of the barrel field cortex 14. The ultrasonic opening of the BBB is fast, noninvasive, and reversible; and thus this approach is suitable for high-throughput and/or longitudinal studies in awake mice.

A technique is described for broadly opening the blood-brain barrier in the mouse using microbubbles and ultrasound. Using this technique, manganese can be administered to the mouse brain. Because manganese is an MRI contrast agent that accumulates in depolarized neurons, this approach enables imaging of neuronal activity.

Ultrasonik Kan-beyin bariyeri bozulması ve Manganez kontrastlı MRG kullanma İşlevsel beyin görüntüleme

Although mice are the dominant model system for studying the genetic and molecular underpinnings of neuroscience, functional neuroimaging in mice remains ...

Recording and Analysis of Circadian Rhythms in Running-wheel Activity in Rodents

When rodents have free access to a running wheel in their home cage, voluntary use of this wheel will depend on the time of day1-5. Nocturnal rodents, including rats, hamsters, and mice, are active during the night and relatively inactive during the day. Many other behavioral and physiological measures also exhibit daily rhythms, but in rodents, running-wheel activity serves as a particularly reliable and convenient measure of the output of the master circadian clock, the suprachiasmatic nucleus (SCN) of the hypothalamus. In general, through a process called entrainment, the daily pattern of running-wheel activity will naturally align with the environmental light-dark cycle (LD cycle; e.g. 12 hr-light:12 hr-dark). However circadian rhythms are endogenously generated patterns in behavior that exhibit a ~24 hr period, and persist in constant darkness. Thus, in the absence of an LD cycle, the recording and analysis of running-wheel activity can be used to determine the subjective time-of-day. Because these rhythms are directed by the circadian clock the subjective time-of-day is referred to as the circadian time (CT). In contrast, when an LD cycle is present, the time-of-day that is determined by the environmental LD cycle is called the zeitgeber time (ZT).
Although circadian rhythms in running-wheel activity are typically linked to the SCN clock6-8, circadian oscillators in many other regions of the brain and body9-14 could also be involved in the regulation of daily activity rhythms. For instance, daily rhythms in food-anticipatory activity do not require the SCN15,16 and instead, are correlated with changes in the activity of extra-SCN oscillators17-20. Thus, running-wheel activity recordings can provide important behavioral information not only about the output of the master SCN clock, but also on the activity of extra-SCN oscillators. Below we describe the equipment and methods used to record, analyze and display circadian locomotor activity rhythms in laboratory rodents.

Circadian rhythms in voluntary wheel-running activity in mammals are tightly coupled to the molecular oscillations of a master clock in the brain. As such, these daily rhythms in behavior can be used to study the influence of genetic, pharmacological, and environmental factors on the functioning of this circadian clock.

Kemirgenler Faaliyet teker Running kayıt ve Sirkadiyen Rhythms Analizi

When rodents have free access to a running wheel in their home cage, voluntary use of this wheel will depend on the time of day1-5. Nocturnal rodents, ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

Morfolino Oligonükleotidler bir Cerebroventricular Mikroenjeksiyon kullanarak Yetişkin Zebra balığı Beyin Gen İfade Mikromanipülasyon

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Simultaneous Electrophysiological Recording and Calcium Imaging of Suprachiasmatic Nucleus Neurons

Simultaneous electrophysiological and fluorescent imaging recording methods were used to study the role of changes of membrane potential or current in regulating the intracellular calcium concentration. Changing environmental conditions, such as the light-dark cycle, can modify neuronal and neural network activity and the expression of a family of circadian clock genes within the suprachiasmatic nucleus (SCN), the location of the master circadian clock in the mammalian brain. Excitatory synaptic transmission leads to an increase in the postsynaptic Ca2+ concentration that is believed to activate the signaling pathways that shifts the rhythmic expression of circadian clock genes. Hypothalamic slices containing the SCN were patch clamped using microelectrodes filled with an internal solution containing the calcium indicator bis-fura-2. After a seal was formed between the microelectrode and the SCN neuronal membrane, the membrane was ruptured using gentle suction and the calcium probe diffused into the neuron filling both the soma and dendrites. Quantitative ratiometric measurements of the intracellular calcium concentration were recorded simultaneously with membrane potential or current. Using these methods it is possible to study the role of changes of the intracellular calcium concentration produced by synaptic activity and action potential firing of individual neurons. In this presentation we demonstrate the methods to simultaneously record electrophysiological activity along with intracellular calcium from individual SCN neurons maintained in brain slices.

Procedures are described to perform simultaneous recordings of membrane potential or current and changes of intracellular calcium concentration. Suprachiasmatic nucleus neurons are filled with the calcium indicator bis-fura-2 using a patch clamp electrode in the whole cell patch clamp configuration.

Eşzamanlı Elektrofizyolojik Kayıt ve Suprakiazmatik Nucleus Nöronlar Kalsiyum Görüntüleme

Simultaneous electrophysiological and fluorescent imaging recording methods were used to study the role of changes of membrane potential or current in ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective treatment for several movement disorders that have failed to respond to medication. Recent progress in the field of DBS surgery has begun to extend the application of this surgical technique to other conditions as diverse as morbid obesity, depression and obsessive compulsive disorder. Despite these expanding indications, little is known about the underlying physiological mechanisms that facilitate the beneficial effects of DBS surgery. One approach to this question is to perform gene expression analysis in neurons that receive the electrical stimulation. Previous studies have shown that neurogenesis in the rat dentate gyrus is elicited in DBS targeting of the anterior nucleus of the thalamus1. DBS surgery targeting the ATN is used widely for treatment refractory epilepsy. It is thus of much interest for us to explore the transcriptional changes induced by electrically stimulating the ATN. In this manuscript, we describe our methodologies for stereotactically-guided DBS surgery targeting the ATN in adult male Wistar rats. We also discuss the subsequent steps for tissue dissection, RNA isolation, cDNA preparation and quantitative RT-PCR for measuring gene expression changes. This method could be applied and modified for stimulating the basal ganglia and other regions of the brain commonly clinically targeted. The gene expression study described here assumes a candidate target gene approach for discovering molecular players that could be directing the mechanism for DBS.

The mechanism underlying the therapeutic effects of Deep Brain Stimulation (DBS) surgery needs investigation. The methods presented in this manuscript describe an experimental approach to examine the cellular events triggered by DBS by analyzing the gene expression profile of candidate genes that can facilitate neurogenesis post DBS surgery.

Ön Talamusun Çekirdek Derin Beyin Stimülasyon sonra Sıçan Hippocampus Gen İfade Değişim Analizi

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...