We thank Hongjae Sunwoo for helpful advice for oligonucleotide design in RNA FISH. We also thank Serenity Curtis for editing the manuscript. N.Y. was supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science (JSPS). This work was supported by the NIH (RO1-GM102184), the March of Dimes Research Foundation (#6-FY12-337), and the Developmental Fund and Trustee Grant at Cincinnati Children's Hospital Medical Center to Y.O.

1. Prob Hazırlık <ol><li> 5&#39;-amino modifikasyon ile birden fazla benzersiz Xist oligonükleotitlerin (20-30 nükleotid uzunlukta oligonükleotitlerin, 63-65 ° C, erime sıcaklığı, Tablo 1) elde edilir ve su içinde askıya. </li><li> 5&#39;-amino modifikasyon (toplam 4.5 ug) ve imalatçının talimatları izlenerek, amin-reaktif bir floresan boya ile etiket ile oligonükleotidler havuzu, eşit molar miktarlarda. <ol><li> Nükleaz içermeyen suyun nihai 5 ul toplanmış oligonükleotidler çözülür ve oligonükleotit solüsyonuna 1 M sodyum bikarbonat ve 3 ul ekleyin. </li><li> Kısaca, amin-reaktif boya ve girdap şişeye 2 ul DMSO ekleyin. </li><li> DMSO içinde reaktif boya ile oligonükleotid çözeltisi karıştırılır ve karanlıkta 1 saat boyunca oda sıcaklığında karışım inkübe edin. </li></ol></li><li> Etanol ile çökeltme, ardından G-25 kolonu ile floresan etiketli oligonükleotid probları arındırın. <ol><li&gt; 750 xg 1 dakika süreyle Santrifüj G-25 sütunu fazla depolama tampon kaldırmak için. </li><li> Adım 1.2.3 üretilen etiketleme karışımına 40 ul nükleaz ücretsiz su ekleyin ve G-25 kolonuna uygulanır. 2 dakika boyunca 750 x g&#39;de santrifüjleyin. </li><li> Aşama 1.3.2 arıtılmış proba 50 ul nükleaz içermeyen su, 10 ul 3 M sodyum asetat (pH 5.2) ve 250 ul etanol ekleyin. 4 ° C&#39;de 15 dakika boyunca 21,000 x g&#39;de 30 dakika santrifüj için -80 ° C&#39;de saklayın. </li><li> % 70 etanol, 1 ml ile bir kez çöktürülerek oligonükleotidler yıkayın. </li><li> 50 ul içinde yeniden askıya nükleaz içermeyen su veya TE (10 mM Tris-HCI, pH 7.5; 1 mM EDTA) içinde yaklaşık 10 uM bir nihai konsantrasyonu. </li></ol></li><li> Hibridizasyon tampon maddesi ile 250 nM arasında bir nihai konsantrasyona floresan etiketli oligonükleotit problar seyreltin (% 10 formamid, 2X SSC [300 mM NaCI, 30 mM sodyum sitrat] 2 mg / ml BSA;% 10 dekstran sülfat). NOT: Bu hızlı BALIK protokolü ile, oligonükleotid pXist elbiseler tasarlanmış ve hibridizasyon için kuluçka süresini kısaltmak için, oligonükleotit problar kullanılarak normal BALIK protokollerine göre daha yüksek bir konsantrasyonda kullanılmıştır. </li></ol> 2. Slayt Hazırlama NOT: Slaytlar fare embriyonik kök (ES) veya embriyoid gövdesini (EB) kullanarak bağışıklık FISH için hazırlanabilir ya poli-lizin-tedavi slayt üzerinde doğrudan büyüyen veya hücre süspansiyonu ile sitospin kullanarak hücreleri 20, 21 farklılaştırarak. Burada, Sitospin slayt hazırlama gösterilir. <ol><li> 6 gözlü tabak içinde kültür ortamı aspire. İyice PBS (oda sıcaklığı) ve aspirasyon ile yıkayın. </li><li> 37 ° C&#39;de 5-10 dakika süreyle inkübe, 6-çukurlu tabağa tripsin 0.5 ml ilave edilir. </li><li> Ortamın 5 ml ilave edilir ve bir kaç kez özenle aşağı yukarı pipetleme hücreleri dağıtılır. </li><li> Oda sıcaklığında, 200 x g&#39;de 5 dakika boyunca, bir 15 ml tüp santrifüj hücreleri aktarın. </li><li> Ortam, bir atınyavaşça 2 ml PBS içinde hücrelerin süspansiyonu d. </li><li> Hemasitometre kullanarak hücreleri sayın ve PBS ile 4 x 10 5 hücre / ml hücre süspansiyonu seyreltin. </li><li> Bir slayt, bir filtre kartı ve bir klip ile bir odayı birleştirin ve Sitospin rotor uygun yuvalara yerleştirin. Sitospin monte birimlerin her odasına adım 2.6 hazırlanan her numunenin 250 ul ekleyin. Oda sıcaklığında 10 dakika boyunca 1500 rpm&#39;de santrifüj. </li><li> 40 ml buz-soğuğu PBS CSK tamponu her biri buz üzerinde 3 coplin kavanoz doldurun (10mM PIPES pH 6.8; 100 mM NaCI, 300 mM sakaroz, 3 mM MgCl2) ve CSKT tamponu (% 0.5 Triton CSK tampon X-100) idi. </li><li> Sitospin tamamlandıktan sonra hızla buz gibi soğuk PBS içine slayt aktarmak ve 5 dakika süreyle inkübe edilir. </li><li> Buz soğukluğunda CSK tampon içine slayt aktarın ve 1 dakika boyunca inkübe edin. </li><li> Buz soğukluğunda CSKT arabelleğe slayt aktarın ve 5 dakika süreyle inkübe edilir. </li><li> Buz-soğuk CSK buf geri slayt aktarınfer ve 1 dakika boyunca inkübe edin. </li><li> PBS içinde% 4 paraformaldehid içinde slayt aktarın ve oda sıcaklığında 10 dakika inkübe edilir. </li></ol> 3. İmmünofloresan <ol><li> Birkaç saniye (% 0.1 Tween-20 ile 1x PBS), PBST ile coplin kavanoza slaytlar yerleştirin. </li><li> Slayt aşağı akmasına tampon kalan izin eğik slaytlar yerleştirin. Dikkatle slayt kapalı aşırı sıvı silin ve su ile boş bir pipet ucu kutusuna yerleştirin. Yumuşak bir lamel, bloke etme çözeltisi 40 ul (1 x PBS,% 1 BSA,% 0.1 Tween-20) ile slayt Yerleşimi, ve oda sıcaklığında 10 dakika inkübe edilir. </li><li> Lamel Bloke etme çözeltisi uzaklaştırılır kaldırmak ve 1 bir konsantrasyona seyreltilmiştir Histon H3K27me3 birincil antikor 40 ul: 500 çözüm engelleme. Geri slayt lamel yerleştirin ve oda sıcaklığında 30 dakika inkübe edilir. Not: bloke çözeltisi içinde bir RNaz inhibitör bu RNA FIS RNA&#39;yı korumak için yararlı olabilirPoliklonal antikorlar kullanılmıştır lH protokolüdür. </li><li> Yıkama hafifçe yıkama sırasında sallayarak, 5 dakika her biri için, PBST ile dolu coplin kavanozlarda 2 kez kaydırın. </li><li> Slayt aşağı akmasına tampon kalan izin eğik slaytlar yerleştirin. Dikkatle aşırı sıvı silin ve tekrar ucu kutuya slayt yerleştirin. Ikincil antikor (1: 500) 40 ul Kaplama çözeltisi engelleme seyreltilmiş, bir lamel ve karanlıkta 15 dakika boyunca inkübe edin. Aşağıdaki adımları için, her zaman karanlıkta slayt tutun. </li><li> Adım 3.4 gibi PBST ile kavanoz Coplin 2 kez yıkayın. </li></ol> Oligonükleotid Probları 4. RNA BALIK <ol><li> Adım 4.3 RNA FISH için 37 ° C&#39;de kurumasını önlemek için slaytlar altındaki su ile boş bir pipet ucu kutusu Ön-sıcak. </li><li> Slayt aşağı akmasına tampon kalan izin eğik slaytlar yerleştirin. Dikkatle adım 3,6 slayt kapalı aşırı sıvı silin ve wat ile pipet ucu kutusu içine slayt yerleştirinalt er. Slayt üzerinde FISH yıkama tamponu (2x SSC,% 10 formamid) 500 ul ilave edin ve oda sıcaklığında 5 dakika inkübe edilir. </li><li> FISH yıkama solüsyonu çıkarın slayt üzerine oligonükleotid prob 8 ul ekleyin, bir kapak kayma yerleştirin ve alt su ile önceden ısıtılmış pipet ucu kutusu slayt aktarmak; 1-2 saat boyunca 37 ° C&#39;de inkübe edin. </li><li> BALIK yıkama tamponu, DAPI FISH yıkama tamponu ve 2 x SSC ile 37 ° C&#39;de bir su banyosu içinde 3 önceden ısıtılmış coplin kavanoz yerleştirin. </li><li> RNA FISH için 1-2 saat inkübasyondan sonra, önceden ısıtılmış BALIK yıkama tamponu içine slayt koydu. </li><li> Lamel slayt düşer kadar birkaç dakika için slayt inkübe. </li><li> Geri yıkama tamponu içine slayt yerleştirin ve 5 dakika inkübasyon devam ediyor. </li><li> 0.5 ng / ml DAPI ile önceden ısıtılmış BALIK yıkama tamponu ile bir coplin kavanoza slayt aktarın ve 5 dakika boyunca inkübe edin. </li><li> Önceden ısıtılmış 2x SSC ile başka coplin kavanoza slayt aktarın ve 5 mil inküben. </li><li> Slayt aşağı akmasına tampon kalan izin eğik slaytlar yerleştirin. Dikkatle aşırı sıvı silin ve kuru bir ucu kutuya geri slayt yerleştirin. Slayt üzerine DAPI ile antifade 4 ul ekleyin ve bir lamel yerleştirin. </li><li> Oje ile lamel Seal ve bir mikroskop altında gözlemlemek. Lam, bir kaç ay boyunca karanlıkta 4 ° C de muhafaza edilebilir. </li></ol>

<ol>
	<li>Payer, B., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+chromosome+dosage+compensation:+how+mammals+keep+the+balance.">X chromosome dosage compensation: how mammals keep the balance.</a> Annu Rev Genet. 42, 733-772 (2008).</li><li>Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gracefully+ageing+at+50,+X-chromosome+inactivation+becomes+a+paradigm+for+RNA+and+chromatin+control.">Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control.</a> Nat Rev Mol Cell Biol. 12, 815-826 (2011).</li><li>Gendrel, A. V., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fifty+years+of+X-inactivation+research.">Fifty years of X-inactivation research.</a> Development. 138, 5049-5055 (2011).</li><li>Froberg, J. E., Yang, L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guided+by+RNAs:+X-inactivation+as+a+model+for+lncRNA+function.">Guided by RNAs: X-inactivation as a model for lncRNA function.</a> J Mol Biol. 425, 3698-3706 (2013).</li><li>Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+Xist+in+X+chromosome+inactivation.">Requirement for Xist in X chromosome inactivation.</a> Nature. 379, 131-137 (1996).</li><li>Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xist-deficient+mice+are+defective+in+dosage+compensation+but+not+spermatogenesis.">Xist-deficient mice are defective in dosage compensation but not spermatogenesis.</a> Genes Dev. 11, 156-166 (1997).</li><li>Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XIST+RNA+paints+the+inactive+X+chromosome+at+interphase:+evidence+for+a+novel+RNA+involved+in+nuclear/chromosome+structure.">XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure.</a> J Cell Biol. 132, 259-275 (1996).</li><li>Sado, T., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+chromosome+silencing+by+the+long+non-coding+RNA.">Advances in understanding chromosome silencing by the long non-coding RNA.</a> Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322, 750-756 (2008).</li><li>Plath, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+histone+H3+lysine+27+methylation+in+X+inactivation.">Role of histone H3 lysine 27 methylation in X inactivation.</a> Science. 300, 131-135 (2003).</li><li>Silva, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+histone+h3+methylation+on+the+inactive+X+chromosome+requires+transient+recruitment+of+Eed-Enx1+polycomb+group+complexes.">Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes.</a> Dev Cell. 4, 481-495 (2003).</li><li>Gall, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+synthesis+of+the+genes+for+ribosomal+RNA+during+amphibian+oogenesis.">Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis.</a> Proc Natl Acad Sci U S A. 60, 553-560 (1968).</li><li>Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+single+RNA+transcripts+in+situ.">Visualization of single RNA transcripts in situ.</a> Science. 280, 585-590 (1998).</li><li>Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat Methods. 5, 877-879 (2008).</li><li>Chaumeil, J., Augui, S., Chow, J. C., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+immunofluorescence,+RNA+fluorescent+in+situ+hybridization,+and+DNA+fluorescent+in+situ+hybridization+to+study+chromatin+changes,+transcriptional+activity,+nuclear+organization,+and+X-chromosome+inactivation.">Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation.</a> Methods Mol Biol. 463, 297-308 (2008).</li><li>Katayama, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+transcription+in+the+mammalian+transcriptome.">Antisense transcription in the mammalian transcriptome.</a> Science. 309, 1564-1566 (2005).</li><li>Ogawa, Y., Xite Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-inactivation+intergenic+transcription+elements+that+regulate+the+probability+of+choice.">X-inactivation intergenic transcription elements that regulate the probability of choice.</a> Mol Cell. 11, 731-743 (2003).</li><li>Panning, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+inactivation+in+mouse+ES+cells:+histone+modifications+and+FISH.">X inactivation in mouse ES cells: histone modifications and FISH.</a> Methods Enzymol. 376, 419-428 (2004).</li><li>Khalil, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+human+large+intergenic+noncoding+RNAs+associate+with+chromatin-modifying+complexes+and+affect+gene+expression.">Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression.</a> Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).</li><li>Martin, G. R., Evans, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+clonal+lines+of+teratocarcinoma+cells:+formation+of+embryoid+bodies+in+vitro.">Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro.</a> Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).</li><li>Lee, J. T., Lu, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+of+Tsix+leads+to+nonrandom+X+inactivation.">Targeted mutagenesis of Tsix leads to nonrandom X inactivation.</a> Cell. 99, 47-57 (1999).</li><li>Zhang, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomeric+RNAs+mark+sex+chromosomes+in+stem+cells.">Telomeric RNAs mark sex chromosomes in stem cells.</a> Genetics. 182, 685-698 (2009).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472, 365-386 (2010).</li><li>Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+organization+of+histone+H3+modifications+as+revealed+by+a+panel+of+specific+monoclonal+antibodies.">The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies.</a> Cell Struct Funct. 33, 61-73 (2008).</li><li>Ogawa, Y., Sun, B. K., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intersection+of+the+RNA+interference+and+X-inactivation+pathways.">Intersection of the RNA interference and X-inactivation pathways.</a> Science. 320, 1336-1341 (2008).</li><li>Kohlmaier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chromosomal+memory+triggered+by+Xist+regulates+histone+methylation+in+X+inactivation.">A chromosomal memory triggered by Xist regulates histone methylation in X inactivation.</a> PLoS Biol. 2, 171 (2004).</li><li>Wang, K. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+long+noncoding+RNAs.">Molecular mechanisms of long noncoding RNAs.</a> Mol Cell. 43, 904-914 (2011).</li></ol>

No conflicts of interest declared.

Bu yazıda, H3K27me3 için slayt hazırlama, Xist RNA FISH ve immünoflüoresans tamamlamak için en az 5 saat sürer hızlı bir bağışıklık BALIK protokolü sundu. Genellikle RNA FISH gecede inkübasyon ihtiyacı Xist RNA saptanması, genel bağışıklık FISH yaklaşımı ile karşılaştırıldığında, bu protokol önemli ölçüde harcanan zamanı azaltır, aynı zamanda oligonükleotid probları kullanılarak bağışıklık FISH duyarlılığını artırır sadece. Xist yüksek X-kromozomu inaktivasyonu sırasında transkripsiyonu ve yoğun sis içinde Xi birikir onun transkript bulundu olduğundan, farklılaştırarak ve RNA FISH ile farklılaşmış hücrelerin nispeten kısa bir inkübasyon süresi kullanılmasında Xist RNA sinyal tespit etmek kolaydır. Bağışıklık ve RNA FISH optimizasyon gerekli olabilir, ancak bu immüno-BALIK protokol, ilgi ve bol RNA &#39;sının diğer proteinler için uygulanabilir. Amacıyla, diğer RNA num protokolünü uygulamakolası oligonükleotid prob ber RNA FISH için sondanın konsantrasyon deneme-yanılma optimizasyonu, inkübasyon süresi ve sıcaklığı takip, dikkate alınması gerekir. Diğer uygulamaların bir örneği tek LNA probları 22 ile telomer RNA tespit önceki başarı. Sonda tasarımı ve düşük miktarda RNA hedeflerinin tespiti için hazırlanması için, Raj ve Tyagi 23 ile makaleye bakın. Dikkate alınması gereken bir başka konu permeabilizasyon adımdır. Farklı permeabilizasyon durumuyla ilgili dikkatli bir değerlendirme gereklidir; Örneğin, bizim protokol açıklanan olandan daha hafif etkileri tespit 15 sonra permeabilization ile oluşabilir. Çeşitli permeabilizasyon prosedürleri de farklı hücre tipleri kullanılarak immün-FISH yaparken dikkat edilmesi gereken. immunfloresan ve RNA FISH sırası da bağışıklık FISH ile hedef proteinlerin, değişiklikler, ve RNA tespiti etkileyebilir. RNA BALIK gerçekleştirmek iseed önce Immünofloresan için, RNA BALIK segmentinde sırasında bir saatlik inkübasyon Xist RNA sinyal tespit etmek yeterlidir. Hibridizasyon tamponu ve FISH yıkama tamponu bulunan formamıd olumsuz H3K27me3 immünoflüoresans etkiler çünkü Ancak, biz her zaman bu protokol Xist RNA FISH önce H3K27me3 immünoflüoresans yürütmek. Diğer uygulamalar için, hedef proteinler ve epigenetik değişiklikler bağlıdır prosedürlerle sırası bağışıklık uyması gereken. Biz H3K27me3 Immünofloresan için kullanılan birincil antikor H3K27me3 24 yüksek bir titreye ve özgüllüğü, biz immünofloresans için kısa inkübasyon süresi kullanmak mümkün. Bununla birlikte, reaksiyon süresi ve immün için, sıcaklık, kullanılan antikora bağlı olduğu ve bu nedenle en iyi duruma getirme her bir antikor için gereklidir. Oligonükleotid probları kullanarak, RNA FISH ile Xist RNA algılama düzelme olduğu saptandı. Daha önceki çalışmalarda, bulduğumuz bu dif bir alt kümesiXi H3K27me3 boyama ile ferentiating hücreler Xist RNA sinyali 25 ile ilişkili değildir. Xi H3K27me3 değişiklik Xist RNA 9 ile PRC2 işe ilişkili olduğundan - 11, 26, biz bu immünofloresans için antikor göre çekirdeklerin içine riboprobes verimsiz penetrasyon nedeniyle olduğunu iddia. Bu protokolde oligonükleotid problar kullanarak, neredeyse her zaman Xist RNA (Şekil 1) ile birlikte lokalize dişi hücrelerin ayırt o H3K27me3 sinyalini gözlendi. Bu hızlı bağışıklık BALIK protokolü bize Xist lncRNA etrafında dönen dinamik değişikliklerin bir anlık kazanç sağlar ve lncRNA işleri şekilde bir anlayışa yardımcı olmak için yeni bir araç sunuyor. Böyle genomik imprinting, gen düzenlemesi, RNA çeviri ve RNA olgunlaşması 27 gibi çeşitli hücresel fonksiyonları etkileyen IncRNAs. Farklı rolü artmış anlayış geliştirmekileri alanını itmek ve insan vücudunun içinde yaşamsal hücresel süreçlerin düzenlenmesinde gelecek keşifler için izin, yanı sıra hastalık tedavileri için potansiyel hedefler gelişimine katkıda yardımcı olacağını lncRNA tarafından oynanan s. Bu protokol kolayca diğer belirteçlerin ve ilgi lncRNAs göre optimize edilebilir olduğundan, hücrelerde çeşitli lncRNAs sırlarını mücadele yardımcı olmak için harika bir araçtır.

Memeli X-kromozomu inaktivasyonu (XCI) kadınlarda iki X-kromozomu biri transkripsiyonel 1 inaktive burada XX ve XY arasındaki X-bağlantılı gen doz dengesizliği telafi etmek için bir stratejidir. X-kromozomu inaktivasyonu uzun olmayan kodlama RNA (lncRNA) araştırma için harika bir model sistemidir. X-kromozomu inaktivasyonu birden lncRNAs tarafından düzenlenir ve yoğun lncRNAs, transkripsiyon, kromatin yapısı ve nükleer organizasyonu 2, 3 arasındaki karışma mekanizmaları ortaya çıkarmak için son birkaç yılda çalışılmıştır. X kromozomunda bulunan X inaktivasyon merkezi (XIC) kodlayıcı olmayan RNA&#39;lar 4 üreten genlerin bir dizi içeren bir kompleks genetik lokus olduğu. X-aktif spesifik transkript (Xist) lncRNA eutherian memelilerde X kromozomu inaktivasyonu 5,6 çok önemli bir rol oynar böyle bir lncRNA olup. Xist transkript fu yerini çevreleyenTure Xi X-kromozomu inaktivasyonu başlatmak ve RNA FISH kullanılarak görüntülendi zaman bir bulut gibi görünmesini; Bu oluşum &quot;Xist Cloud&quot; 7 olarak adlandırılır. Xist RNA, çeşitli kromatin değiştirici enzimler ile etkileşim için, sessiz bir kromatin ve baskı transkripsiyon için farklı epigenetik değişiklikler ile Xist bulutlar eş-lokalizasyonu X kromozomu inaktivasyonu 8 süresince gözlenir. Örneğin, Xist RNA H3K27me3 sorumludur ve baskıcı bir kromatin devlet 9 uyaran Polycomb baskıcı kompleksi 2 (PRC2) ile etkileşime girer. Xi ve yoğun H3K27me3 modifikasyonu ile birlikte yerelleştirme Xist bulut oluşumu Xi 10,11 bir fakültatif heterokromatinin manzara temsil eder. Böyle DNA / RNA FISH gibi sitogenetik teknikler, gelişmiş hassasiyet ile son ve gelişmiş teknikler, radyoaktif işaretli problar 12 kullanılarak geleneksel yöntemle uzun bir yol katettikBirden fazla oligonükleotid sondaları 13,14 kullanılarak flüoresan görüntüleme. Immünofloresan ile birleştiğinde DNA / RNA BALIK rutin Spatiotemporal nükleer organizasyonu, RNA lokalizasyonu, kromatin yapısını ve değişiklikleri anlamak için bir sitolojik araç olarak kullanılmıştır. RNA, FISH için pek çok standart prob hazırlama plazmid ya da bakteriyel yapay kromozom (BAC) klonu ve çentik translasyonu veya rastgele prime 15 ya da daha sonraki etiketi kullanılmasını içerir. Bununla birlikte, farelerde genlerin yaklaşık% 70 ve insanlarda genlerin% 40 sens ve antisens transkriptleri ayırmak için bu nedenle bir büküm özel FISH yöntem gerektiren, sens ve antisens transkriptleri 16 bir üst üste göstermektedir. İn vitro transkribe RNA sondaları (riboprob ) genellikle iplik-spesifik RNA FISH 17,18 için kullanılır; bununla birlikte, bu, T7, SP6 veya T3 promoteri ve sentezlenmesi riboprobes bir plazmid klonu ya da PCR ürün hazırlama içerir. Ayrıca, genomunun elde riboproblarıic DNA veya cDNA sık sık yüksek arka plan gürültüsü neden non-spesifik bölgeleri ve tekrarlayan unsurlar içerir. Diğer konu da, uzunluğu bir kaç yüz nükleotidlerdir ve birden florofor içeren riboprobları, etkili bir çekirdek içine girmek edemezler. Bu aşmak için, ucunda tek bir florofor ile işaretlenmiş çok sayıda daha kısa oligonükleotid probları iyi hassasiyet, düzgün sinyal kuvveti ve saflaştırma kolaylığı ve 14 taşıma olduğu geliştirilmiştir. Buna ek olarak, DNA oligonükleotidleri, genel olarak RNA daha stabildir. Bu X kromozomu etkisizleştirme işlemi sırasında Xist lncRNA neden Xi epigenetik dinamiklerini anlamak için immünofloresan ile Xist RNA, FISH 19 oligonükleotidleri kullanılarak benzer bir strateji uygulanır. Bu protokol, oligonükleotid prob ve hücrelerin uygun hazırlama oluşturma, hem de bağışıklık ve RNA FISH kullanımını tarif etmektedir. Birden oligonucle kullanarak Xist RNA BALIKXist RNA BALIK kişinin laboratuvarında rutin olarak ise, SEK, uzun vadede maliyet etkin bir yaklaşımdır. Bu teknik aynı zamanda epigenetik değişiklikler ya da faktörleri ile birlikte-lokalizasyonunu haritalama ise hücrelerinde lncRNAs tanımlamak için kullanılabilir. Protokolün bir büyük avantajı kolayca kişinin araştırma çıkarlarına uygun şekilde değiştirmek için yeteneğidir.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">oligonucleotides with 5&#8217;-amine modification</td>
			<td style="width:187px;">IDT</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">Alexa Fluor 488 Reactive Dye</td>
			<td style="width:187px;">Life Technologies</td>
			<td style="width:119px;">A32750</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">MicroSpin G-25 columns</td>
			<td style="width:187px;">GE Healthcare</td>
			<td style="width:119px;">27-5325-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">Cytospin 2</td>
			<td style="width:187px;">Shandon</td>
			<td align="right" style="width:119px;">59900102</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:267px;">Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer)</td>
			<td style="width:187px;">Roche</td>
			<td style="width:119px;">10715859103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">Histone H3K27me3 antibody</td>
			<td style="width:187px;">Active Motif</td>
			<td style="width:119px;">61017</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:267px;">Accutase</td>
			<td style="width:187px;">Innovative Cell Technologies</td>
			<td style="width:119px;">AT104</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:267px;">Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed</td>
			<td style="width:187px;">Life Technologies</td>
			<td style="width:119px;">A21424</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">ProLong Gold antifade reagent</td>
			<td style="width:187px;">Life Technologies</td>
			<td style="width:119px;">P36931</td>
		</tr>
	</tbody>
</table>

quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation

Immünfloresans (immün-FISH) ile in situ hibridizasyon (FISH) RNA floresan proteinleri birleştiren, epigenetik değişiklikler ve diğer detaylar lokalizasyonu içine eşzamanlı bir bakış açısı ile RNA lokalizasyonu mekansal dinamiklerini tespit etmek için tek hücre düzeyinde istihdam edilebilir bir teknik oluşturur hangi immünofloresan vurgulanmış olabilir. X-kromozomu inaktivasyonu uzun olmayan kodlama RNA (lncRNA) aracılı gen susturulması için bir paradigma olduğunu. Memeli kadınlarda iki X-kromozom birinde (bir Xist bulut denir) X-inaktif özel transkript (Xist) lncRNA birikimi X-kromozomu inaktivasyonu başlatmak için kritik bir adımdır. Xist RNA doğrudan veya dolaylı olarak çeşitli kromatin-modifiye enzimler ile etkileşim ve inaktif X-kromozomu (Xi) için ayrı epigenetik manzara tanıttı. Xi biri bilinen epigenetik damgasını Histone H3 trimetil-lizin 27 (H3K27me3) değişiklik. Burada, biz basit ve hızlı bir immün FISH tarifXist RNA lokalizasyonu ve ilişkili epigenetik değişiklikleri incelemek için H3K27me3 immünofloransı ile birleştiğinde birden oligonükleotid probları ile RNA FISH kullanarak Xist RNA tespiti için protokol. Oligonükleotid probları daha kısa bir kuluçkalama süresi sonuçları in vitro ötelenmiş RNA probları (riboprobları) göre Xist RNA daha hassas algılama kullanılması. Bu protokol lncRNAs dinamiklerini ve ilgili epigenetik değişiklik, kromatin yapısı, nükleer organizasyon ve transkripsiyon düzenleme anlamak için güçlü bir araç sağlar.

Pratik immüno-FISH temsili görüntüleri Şekil 1A&#39;da gösterilmiştir. Xi Xist RNA bulut ve H3K27me3 sinyalinin Eş-lokalizasyonu kadın hücrelerin ayırt saptandı. Farklılaşması üzerine 12. günde EB hücrelerinin% 90&#39;dan daha fazla bir Xist bulut (Şekil 1B) vardı. (; 150% 97, n = Şekil 1C) Kısa oligonükleotid probları etkin bir şekilde neredeyse tüm H3K27me3 sinyalleri Xist RNA ile birlikte lokalize bir görselleştirme yol, çekirdeklerin içine nüfuz. <img alt="Şekil 1," src="/files/ftp_upload/52053/52053fig1highres.jpg" /> Şekil 1: Xist RNA ve H3K27me3 farklılaşma üzerine günde 12 dişi EB hücreleri ayırt H3K27me3 değişiklik ile Xist RNA için fare EB (A) Immuno-FISH ayırt Xi birlikte lokalize.. Xist probları Alexa Fluor 488 ile işaretlendi, ve anti-H3K27me3 birincil antikor de edildianti-fare IgG ve Alexa Fluor 555-konjuge sekonder antikor ile korunan. Çekirdekler DAPI ile zıt. kutulu bölge alt panellerde büyütülür. Ölçek çubukları:... 10 um (B), farklılaşma üzerine 12. günde EB Xist Cloud ve H3K27me3-pozitif hücrelerin frekansı (C), farklılaşma üzerine 12. günde EB H3K27me3 sinyali Xist bulut eş-lokalizasyonu sıklığı <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52053/52053fig1large.jpg" target="_blank">, lütfen Bu rakamın büyük halini görmek için buraya tıklayın.</a> <table><tbody><tr><td> Xp1 </td><td> ggtaagtatccaaaaccccgttgg </td></tr><tr><td> Xp2 </td><td> cgatcagcagcaacagtacacg </td></tr><tr><td> XP3 </td><td> gcaattggttgcttttatccagtcc </td></tr><tr><td> XP4 </td><td> cgcaacaccgcacactaatacg </td></tr><tr><td> Xp5 </td><td> gccatcttagacacattcaagagcat </td></tr><tr><td> XP6 </td><td> cacacgtgaagtaccaagcgaaac </td></tr><tr><td> Xp7 </td><td> gccacgtatagagcactgtaagagactatg </td></tr><tr><td> XP8 </td><td> caaagcacactatcagacgtgtcg </td></tr><tr><td> Xp9 </td><td> ggagaatctagatgccataaaggcaag </td></tr><tr><td> XP10 </td><td> tgatggacactgcattttagcactg </td></tr><tr><td> Xp11 </td><td> ggacactgcattttagcaatacgattc </td></tr><tr><td> Xp12 </td><td> gtgatgggcactgcattttagc </td></tr><tr><td> Xp13 </td><td> agatgggctatctcagtcttataggct </td></tr><tr><td> XP14 </td><td> ggaagtcagtatggagggggtatg </td></tr><tr><td> Xp15 </td><td> tgggactgtgactactacagcaatga </td></tr><tr><td> Xp16 </td><td> aagactcaattcctagtcaggattatccac </td></tr><tr><td> Xp17 </td><td> gggctgtagctctatgacagtgcttt </td></tr><tr><td> Xp18 </td><td> gtcttcaccagatgcagattactacagtg </td></tr><tr><td> XP19 </td><td> aatagtttgaggaaggggtttcaagtg </td></tr><tr><td> XP20 </td><td> gctgttcaggtttccttctgtagtga </td></tr><tr><td> Xp21 </td><td> gcaagagatacaatggtccgaaaagt </td></tr><tr><td> Xp22 </td><td> agcacttcgtacaaccctctttctg </td></tr><tr><td> Xp23 </td><td> gaagagagcaggtcattcgtcagag </td></tr><tr><td> XP24 </td><td> gcaactgagacactgtagccatatgaag </td></tr><tr><td> XP25 </td><td> ttcctggaggaagaacggaaaga </td></tr><tr><td> Xp26 </td><td> tgattagaaggcttaggtcatcttcca </td></tr><tr><td> XP27 </td><td> ttttgttcagagtagcgaggacttga </td></tr><tr><td> Xp28 </td><td> aatagagcagaatggcttcctcgaa </td></tr><tr><td> Xp29 </td><td> acattgcttgatcacgctgaagac </td></tr><tr><td> XP30 </td><td> gcaaggaagaaatagacacacaaagc </td></tr><tr><td> XP31 </td><td> ggaagaaatagatgtaacaaagaattagacaca </td></tr><tr><td> XP32 </td><td> cacttcagagccacttgaatcctg </td></tr><tr><td> Xp33 </td><td> agtcacaggtgtcctgtagaaacagttc </td></tr><tr><td> Xp34 </td><td> cctttatgggcaatggcaacaat </td></tr><tr><td> Xp35 </td><td> ggcacatctgcatattgcttgtcta </td></tr><tr><td> XP36 </td><td> gcaactaagaccatgaacccacaa </td></tr><tr><td> Xp37 </td><td> aaacacactggccttaagtatatggactg </td></tr><tr><td> Xp38 </td><td> cattcatttgcacacatggaacaat </td></tr><tr><td> Xp39 </td><td> tgggagacaatatttagcctccaggt </td></tr><tr><td> Xp40 </td><td> cctagcaagggcactgttttgtaataa </td></tr><tr><td> Xp41 </td><td> taacatttagcacactgccttgcac </td></tr><tr><td> Xp42 </td><td> cagtgatctacactaggtccacctcaca </td></tr><tr><td> Xp43 </td><td> ttatgttgaaggaatcttggccttg </td></tr><tr><td> Xp44 </td><td> aagtgagagctgtagtctcaaggtgtga </td></tr><tr><td> Xp45 </td><td> gtattcaacctctgaggcaaactgtg </td></tr><tr><td> Xp46 </td><td> agattgtggaacttagatggctgtca </td></tr><tr><td> Xp47 </td><td> tggaactgcattaaagtcccaacttag </td></tr><tr><td> Xp48 </td><td> gaactcccagacctcttcaacctg </td></tr></tbody></table&gt; Tablo 1: Xist RNA FISH için floresan markajlı oligonükleotidlerin dizisi. 48 oligonükleotid Xist RNA, FISH için floresan etiketli oligonükleotid probları hazırlamak için 5&#39;-amino modifikasyon ile sentezlenmiştir.

Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level.

Hızlı Floresan<em&gt; In Situ</emX-kromozomu İnaktivasyonu içinde histon Modifikasyon İmmünofloresan ile Xist RNA Kombine için&gt; Hibridizasyon Protokolü

Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell ...

quick-fluorescent-situ-hybridization-protocol-for-xist-rna-combined

Nanyang Technological University

Research

JoVE Journal

Biology

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

13.9K Görüntüleme.  Cincinnati Children's Hospital Medical Center. We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level. 

Video: Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying  gene expression in brain, neural tube, somite and heart primordia formation. This video demonstrates the different steps in 2-color whole mount in situ hybridization; First, the embryo is dissected from the egg and fixed in paraformaldehyde. Second, the embryo is processed for prehybridization. The embryo is then hybridized with two different probes, one coupled to DIG, and one coupled to FITC.  Following overnight hybridization, the embryo is incubated with DIG coupled antibody. Color reaction for DIG substrate is performed, and the region of interest appears blue. The embryo is then incubated with FITC coupled antibody. The embryo is processed for color reaction with FITC, and the region of interest appears red. Finally, the embryo is fixed and processed for phtograph and sectioning. A troubleshooting guide is also presented.

This video demonstrates 2-color whole mount in situ hybridization, a method by which the spatial and temporal expression pattern of 2 different genes can be visualized in young chick embryos. This method was originally introduced by David Wilkinson, Domingos Henrique, Phil Ingham and David Ish -Horowicz.

Erken Civciv Embriyolar in situ Hibridizasyon Çift Tüm Dağı

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Biyoloji

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of tissue specific expression is limited because of problems in dissecting individual tissues. Expression data needs to be confirmed and complemented with expression patterns using e.g. in situ hybridization, a technique used to localize cell specific mRNA expression. The in situ hybridization method is laborious, time-consuming and often requires extensive optimization depending on species and tissue. In situ experiments are relatively more difficult to perform in woody species such as the conifer Norway spruce (Picea abies). Here we present a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including P. abies. With just a few adjustments, including altered RNase treatment and proteinase K concentration, we could use the protocol to study tissue specific expression of homologous genes in male reproductive organs of one gymnosperm and two angiosperm species; P. abies, Arabidopsis thaliana and Brassica napus. The protocol worked equally well for the species and genes studied. AtAP3 and BnAP3 were observed in second and third whorl floral organs in A. thaliana and B. napus and DAL13 in microsporophylls of male cones from P. abies. For P. abies the proteinase K concentration, used to permeablize the tissues, had to be increased to 3 g/ml instead of 1 g/ml, possibly due to more compact tissues and higher levels of phenolics and polysaccharides. For all species the RNase treatment was removed due to reduced signal strength without a corresponding increase in specificity. By comparing tissue specific expression patterns of homologous genes from both flowering plants and a coniferous tree we demonstrate that the DIG in situ protocol presented here, with only minute adjustments, can be applied to a wide range of plant species. Hence, the protocol avoids both extensive species specific optimization and the laborious use of radioactively labeled probes in favor of DIG labeled probes. We have chosen to illustrate the technically demanding steps of the protocol in our film.
Anna Karlgren and Jenny Carlsson contributed equally to this study.
Corresponding authors: Anna Karlgren at Anna.Karlgren@ebc.uu.se and Jens F. Sundstr&#246;m at Jens.Sundstrom@vbsg.slu.se

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

We describe a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including Norway spruce. With just a few adjustments, including altered RNase treatment and proteinase K concentration, the protocol may be used in studies of different tissues and species.

Radyoaktif olmayan In situ Hibridizasyon Norveç Ladin Uygulanacak Protokol ve Bitki Türlerinin Aralığı

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of ...

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. The protocol is a modified version of the standard in situ hybridization using alkaline phosphatase and substrates such as NBT/BCIP and Fast Red 1,2. This protocol utilizes standard digoxygenin and fluorescein labeled probes along with tyramide signal amplification (TSA) 3. The commercially available TSA kits allow flexible experimental design as fluorescence emission from green to far-red can be used in combination with various nuclear stains, such as propidium iodide, or fluorescence immunohistochemistry for proteins. TSA produces a reactive fluorescent substrate that quickly covalently binds to moieties, typically tyrosine residues, in the immediate vicinity of the labeled antisense riboprobe. The resulting staining patterns are high resolution in that subcellular localization of the mRNA can be observed using laser scanning confocal microscopy 3,4. One can observe nascent transcripts at the chromosomal loci, distinguish nuclear and cytoplasmic staining and visualize other patterns such as cortical localization of mRNA. Studies in Drosophila indicate that roughly 70% of mRNAs exhibit specific patterns of subcellular localization that frequently correlate with the function of the encoded protein 5. When combined with computer-aided reconstruction of 3D confocal datasets, our protocol allows the detailed analysis of mRNA distribution with sub-cellular resolution in whole vertebrate embryos.

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. We include a propidium iodide nuclear counter-stain to highlight tissue organization.

Zebra balığı Tüm Dağı Yüksek Çözünürlüklü Çift Floresan Yerinde Hibridizasyon

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology.  Here, we present a high-resolution double ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

Floresan In situ İnsan Sperm hibridizasyon (FISH) Protokolü

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

Bitkilerde Transkriptler Hassas Yerelleştirme Situ Hibridizasyon

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Viruses that infect cells elicit specific changes to normal cell functions which serve to divert energy and resources for viral replication. Many aspects of host cell function are commandeered by viruses, usually by the expression of viral gene products that recruit host cell proteins and machineries. Moreover, viruses engineer specific membrane organelles or tag on to mobile vesicles and motor proteins to target regions of the cell (during de novo infection, viruses co-opt molecular motor proteins to target the nucleus; later, during virus assembly, they will hijack cellular machineries that will help in the assembly of viruses). Less is understood on how viruses, in particular those with RNA genomes, coordinate the intracellular trafficking of both protein and RNA components and how they achieve assembly of infectious particles at specific loci in the cell. The study of RNA localization began in earlier work. Developing lower eukaryotic embryos and neuronal cells provided important biological information, and also underscored the importance of RNA localization in the programming of gene expression cascades. The study in other organisms and cell systems has yielded similar important information. Viruses are obligate parasites and must utilise their host cells to replicate. Thus, it is critical to understand how RNA viruses direct their RNA genomes from the nucleus, through the nuclear pore, through the cytoplasm and on to one of its final destinations, into progeny virus particles 1.
FISH serves as a useful tool to identify changes in steady-state localization of viral RNA. When combined with immunofluorescence (IF) analysis 22, FISH/IF co-analyses will provide information on the co-localization of proteins with the viral RNA3. This analysis therefore provides a good starting point to test for RNA-protein interactions by other biochemical or biophysical tests 4,5, since co-localization by itself is not enough evidence to be certain of an interaction. In studying viral RNA localization using a method like this, abundant information has been gained on both viral and cellular RNA trafficking events 6. For instance, HIV-1 produces RNA in the nucleus of infected cells but the RNA is only translated in the cytoplasm. When one key viral protein is missing (Rev) 7, FISH of the viral RNA has revealed that the block to viral replication is due to the retention of the HIV-1 genomic RNA in the nucleus 8. 
Here, we present the method for visual analysis of viral genomic RNA in situ. The method makes use of a labelled RNA probe. This probe is designed to be complementary to the viral genomic RNA. During the in vitro synthesis of the antisense RNA probe, the ribonucleotide that is modified with digoxigenin (DIG) is included in an in vitro transcription reaction. Once the probe has hybridized to the target mRNA in cells, subsequent antibody labelling steps (Figure 1) will reveal the localization of the mRNA as well as proteins of interest when performing FISH/IF.

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

A fluorescence in situ hybridization (FISH) method was developed to visually detect viral genomic RNA using fluorescence microscopy. A probe is made with specificity to the viral RNA that can then be identified using a combination of hybridization and immunofluorescence techniques. This technique offers the advantage of identifying the localization of the viral RNA or DNA at steady-state, providing information on the control of intracellular virus trafficking events.

Floresans tarafından viral RNA tespit edilmesi<em&gt; In situ</em&gt; Hibridizasyon (FISH)

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

RNA Floresan tarafından Tek hücreli Gen Transkripsiyon Analizi<em&gt; In Situ</em&gt; Hibridizasyon (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The specification of replication timing is thought to be a dynamic process regulated by tissue-specific and developmental cues that are responsive to epigenetic modifications. However, the mechanisms regulating where and when DNA replication initiates along chromosomes remains poorly understood. Homologous chromosomes usually replicate synchronously, however there are notable exceptions to this rule. For example, in female mammalian cells one of the two X chromosomes becomes late replicating through a process known as X inactivation1. Along with this delay in replication timing, estimated to be 2-3 hr, the majority of genes become transcriptionally silenced on one X chromosome. In addition, a discrete cis-acting locus, known as the X inactivation center, regulates this X inactivation process, including the induction of delayed replication timing on the entire inactive X chromosome. In addition, certain chromosome rearrangements found in cancer cells and in cells exposed to ionizing radiation display a significant delay in replication timing of &gt;3 hours that affects the entire chromosome2,3. Recent work from our lab indicates that disruption of discrete cis-acting autosomal loci result in an extremely late replicating phenotype that affects the entire chromosome4. Additional 'chromosome engineering' studies indicate that certain chromosome rearrangements affecting many different chromosomes result in this abnormal replication-timing phenotype, suggesting that all mammalian chromosomes contain discrete cis-acting loci that control proper replication timing of individual chromosomes5.
Here, we present a method for the quantitative analysis of chromosome replication timing combined with fluorescent in situ hybridization. This method allows for a direct comparison of replication timing between homologous chromosomes within the same cell, and was adapted from6. In addition, this method allows for the unambiguous identification of chromosomal rearrangements that correlate with changes in replication timing that affect the entire chromosome. This method has advantages over recently developed high throughput micro-array or sequencing protocols that cannot distinguish between homologous alleles present on rearranged and un-rearranged chromosomes. In addition, because the method described here evaluates single cells, it can detect changes in chromosome replication timing on chromosomal rearrangements that are present in only a fraction of the cells in a population.

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

A quantitative method for the analysis of chromosome replication timing is described. The method utilizes BrdU incorporation in combination with fluorescent in situ hybridization (FISH) to assess replication timing of mammalian chromosomes. This technique allows for the direct comparison of rearranged and un-rearranged chromosomes within the same cell.

Floresan ile birlikte Kromozom çoğaltılıyor Zamanlama<em&gt; Yerinde</em&gt; Hibridizasyon

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The ...

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Tüm Dağı RNA Floresan<em&gt; In situ</emVe&gt; Hibridizasyon<em&gt; Drosophila</em&gt; Embriyolar

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

Marine elasmobranchs are valued animal models for biomedical and genomic studies as they are the most primitive vertebrates to have adaptive immunity and have unique mechanisms for osmoregulation 1-3. As the most primitive living jawed-vertebrates with paired appendages, elasmobranchs are an evolutionarily important model, especially for studies in evolution and development. Marine elasmobranchs have also been used to study aquatic toxicology and stress physiology in relationship to climate change 4. Thus, development and adaptation of methodologies is needed to facilitate and expand the use of these primitive vertebrates to multiple biological disciplines. Here I present the successful adaptation of RNA whole mount in situ hybridization and histological techniques to study gene expression and cell histology in elasmobranchs.
Monitoring gene expression is a hallmark tool of developmental biologists, and is widely used to investigate developmental processes 5. RNA whole mount in situ hybridization allows for the visualization and localization of specific gene transcripts in tissues of the developing embryo. The expression pattern of a gene's message can provide insight into what developmental processes and cell fate decisions a gene may control. By comparing the expression pattern of a gene at different developmental stages, insight can be gained into how the role of a gene changes during development.
While whole mount in situ's provides a means to localize gene expression to tissue, histological techniques allow for the identification of differentiated cell types and tissues. Histological stains have varied functions. General stains are used to highlight cell morphology, for example hematoxylin and eosin for general staining of nuclei and cytoplasm, respectively. Other stains can highlight specific cell types. For example, the alcian blue stain reported in this paper is a widely used cationic stain to identify mucosaccharides. Staining of the digestive tract with alcian blue can identify the distribution of goblet cells that produce mucosaccharides. Variations in mucosaccharide constituents on short peptides distinguish goblet cells by function within the digestive tract 6. By using RNA whole mount in situ's and histochemical methods concurrently, cell fate decisions can be linked to gene-specific expression.
Although RNA in situ's and histochemistry are widely used by researchers, their adaptation and use in marine elasmobranchs have met limited and varied success. Here I present protocols developed for elasmobranchs and used on a regular basis in my laboratory. Although further modification of the RNA in situ's hybridization method may be needed to adapt to different species, the protocols described here provide a strong starting point for researchers wanting to adapt the use of marine elasmobranchs to their scientific inquiries.

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

By combining methods for RNA whole mount in situ hybridization and histology, gene expression can be linked with cell fate decisions in the developing embryo. These methods have been adapted to marine elasmobranchs and facilitate the use of these animals as model organisms for biomedical, toxicology and comparative studies.

RNA<em&gt; Yerinde</emTüm Dağı Embriyolar ve Hücre histolojisi&gt; Hibridizasyon Deniz Elasmobranchs İçin Uyarlanmış

Marine  elasmobranchs are valued animal models for biomedical and genomic studies as  they are the most primitive vertebrates to have adaptive immunity ...