Najmeh Nikpour and Fiona Alum provided suggestions and edited this manuscript. Department of Biochemistry at McGill University supported HM and VM with the CIHR Training Initiative in Chemical Biology. This work was supported by Canadian Institute of Health Research (CIHR) grant 119464 (to R. S.).

Aşağıdaki protokol floresan RNA dayalı düzenleme tahlilini yapmak için prosedür açıklanmaktadır. Deney, tek bir PCR tüpü, deney kapsamına bağlı olarak, 96 oyuklu, veya 384 oyuklu plakalar içerisinde gerçekleştirilir. Daha sonra, floresans sinyali uygun bir gerçek zamanlı PCR algılama sistemi üzerinde okunabilir. Burada deney 384 oyuklu plakalar bağlamında tarif edilmektedir. 1.. Kültürleme T. brucei Hücreler <ol><li> T. için bir büyüme ortamı hazırlayın brucei formu hücreleri procyclic. Ortamı, 1 L için: <ol><li> 800 ml&#39;lik mili Q suyu içinde 25.4 g SDM-79 tozu çözülür. </li><li> 10 M NaOH ile 7.3 &#39;e 2 NaHCO 3 g ve pH ekleyin. </li><li> 900 ml, filtre ile sterilize bir son hacme nanopure su ekleyin. </li><li> % 10 son konsantrasyonlara Fetal Bovine Serum (FBS), penisilin-streptomisin çözeltisi ve hemin (2.5 mg / ml) (v / v), 100 U / ml ve 7.5 mg / L idi. </li></ol></li><li> T &lt;300 ml büyümekem&gt; 1.5 x 10 7 hücre / ml &#39;lik bir yoğunluğa kadar 70 rpm&#39;de çalkalanarak 28 ° C&#39;de brucei 1.7A vahşi tip (procyclic form) hücreleri. Not: Bu aktif editosome 3 ml üretmelidir ~ 600 düzenleme reaksiyonlar için yeterli toplam protein, 0.5 mg. </li><li> 4 ° C&#39;de 10 dakika boyunca 6000 x g&#39;de santrifüj ile hücreler hasat </li><li> Soğutulmuş PBSG tamponu, 50 ml (10 mM Na 2 HPO 4, 10 mM NaH 2 PO 4, 145 mM NaCl ve 6 mM glukoz) ile pelet yıkayın ve 10 dk için 10,000 x g&#39;de santrifüj ile tekrar hücrelerin aşağı spin 4 ° C. </li></ol> Ham Mitokondri 2.. İzolasyonu Not: Tüm adımlar editosome aktivitesini korumak için buz üzerinde ya da 4 ° C&#39;de gerçekleştirilmelidir. <ol><li> DTE tamponu, 30 ml (1 mM Tris-HCl, pH 8.0 ve 1 mM EDTA) içinde yeniden süspanse hasat edilen hücreler. Yukarı okşayarak ve aşağı buz üzerinde en az 10 defa hücre zarı bozmak için bir 40 ml steril Dounce homojenleştirici (pre-soğutulmuş) kullanın. </li&gt; <li> Tercihen mitokondri çökertmek için, 4 ° C&#39;de 10 dakika boyunca 15.800 x g&#39;de 0.25 M. Santrifüj bir son konsantrasyon elde etmek için homojenat için hemen 4.3 ml,% 60 sukroz (örneğin, 1.75 M w / v) ekleyin. </li><li> STM tampon maddesi (20 mM Tris-HCl pH 8.0, 250 mM sukroz ve 2 mM MgCI2) 4.6 ml mitokondriyal pelletini. I, sırasıyla 0.3 mM ve 9 U / ml nihai konsantrasyonda 0.1 M CaCI2 13.8 ul ve RNase-barındırmayan DNase 4 ul ekleyin. Buz üzerinde 1 saat için karışımın inkübe edin. </li><li> 4 ° C&#39;de 10 dakika boyunca 15,800 xg&#39;de DNase I Santrifüjü etkisiz hale getirmek için STE tampon 4,6 ml (20 mM Tris-HCl pH 8.0, 250 mM sukroz ve 2 mM EDTA) ekleyin </li><li> 400 ul liziz tamponu (10 mM Tris-HCl pH 7.2, 10 mM MgCl2, 100 mM KCI, 1 ug / ml pepstatin, 1 mM DTT, ve 1 x tam EDTA içermeyen proteaz inhibitörü) ve bir transfer pelletini mikrofüj tüpü. </li><li> % 1 a bir nihai konsantrasyona kadar% 10 Triton X-100 eklemend bir boru döndürücüde 4 ° C&#39;de 15 dakika boyunca inkübe lizat. </li><li> 4 ° C&#39;de 15 dakika boyunca 17,000 x g santrifüj ile iki kez mitokondriyal lizat temizleyin; temizlenmiş süpernatan her tutma. </li></ol> 3.. Editosome Arıtma <ol><li> Dökün 10 ml 10% -30% (40 mM HEPES pH 7.9, 20 mM Mg (OAc) 2, 100 mM KCl 2x HHE gradyan tamponu kullanılarak, bir ultra santrifüj tüp içinde (v / v) gliserol lineer gradyan (Tablo 1), ve 2 mM EDTA) ve kullanma kılavuzunu takip ederek bir degrade yapımcısı. </li><li> Dikkatlice gliserol gradyanın tepesinden çözeltisi 500 ul çıkarıp hafifçe silinir mitokondriyal lizat 500 ul yükleyin. Ultrasantrifüj işlemi kullanılarak 4 ° C&#39;de 6 saat boyunca 178,000 x g&#39;de Spin. </li><li> 4 ° C &#39;de, gradyanın alt üst sıralı 500 ul fraksiyonlar toplamak Sonra kullanıma kadar -80 ° C&#39;de sıvı azot ve mağaza kullanarak kesirler dondurma oturtun. </li></ol><ol><li> 3 dakika boyunca 90 ° C&#39;de ısıtma ile 1:1 &#39;lik bir mol oranında, bir T7 yükseltici oligonükleotid (5&#39;-TAATACGACTCACTATAGGG-3&#39;) ile T7 promotörü dizisi (Tablo 2) tamamlayıcı bir sekansı içeren ve oda sıcaklığında soğutulduktan ilgili DNA şablonu tavlama en az 10 dakika karıştırıldı. </li><li> Kullanım kılavuzunu takip ederek in vitro transkripsiyon kiti kullanılarak RNA&#39;yı. </li><li> 7 M üre boya (7 M üre,% 0.05 ksilen Cynol ve% 0.05 bromofenol mavisi) eşit hacmi eklenerek transkripsiyon reaksiyonu durdurun. 9% poliakrilamid jel (% 9 akrilamid, 7 M üre, 1 x TBE) denatüre steril bir filtre üzerinde çalıştırın. </li><li> Bir bulmak için kısa dalga boylu UV lamba ve tüketim ilgili RNA ile ultraviyole (UV) gölgeleme kullanın. Bir mikrofüj tüpüne eksize jel parça koyun ve jel elüsyon tampon 400 ul (20 mM Tris-HCl pH 7.5, 250 mM NaOAc, 1 mM EDTA ve% 0.25 SDS) ekleyin. Bir tüpü rotatifine oda sıcaklığında gece boyunca Zehir. </li><li> Precisoğuk% 100 etanol içinde 1 ml ilave edildi ve 30 dakika, -20 ° C, gece boyunca -80 ° C&#39;de ya da inkübe edilerek elüe RNA pitate. </li><li> RNA aşağı pelet 4 ° C&#39;de 30 dakika boyunca 16,000 x g&#39;de santrifüjleyin. </li><li> % 75 etanol içinde 1 ml pelet yıkayın. 4 ° C&#39;de 20 dakika boyunca 16,000 x g&#39;de santrifüje </li><li> Tablo 2&#39;de gösterildiği gibi, istenen konsantrasyonları elde etmek için RNase içermeyen su içinde uygun bir RNA topağı yeniden süspanse edin. </li></ol> 5. Floresans tabanlı RNA Düzenleme Testi <ol><li> Tek bir reaksiyon için, bir mikrofuj tüp içinde preA6Rbz 1 pmol (1 ul) ve 2.5 pmol gA6Rbz (1 ul) (1:2.5 mol oranı) bir araya 3 dakika boyunca 70 ° C&#39;de inkübe edilir ve bu da oda sıcaklığında bekletin en az 10 dak. </li><li> Bu arada (25 mM HEPES pH 7.9, 10 mM Mg (OAc) 2, 50 mM KCI ve 10 mM EDTA), 1 mM 1x HHE tampon içeren düzenleme reaksiyonu için, preA6Rbz ve gA6Rbz olmadan Tablo 3 kullanarak bir ana karışım hazırlamakATP, 5 mM CaCl2, Torula maya RNA,% 0.1 Triton X-100 ve saflaştırılmış editosome 16 ng / ml. </li><li> Ana karışımı tamamlamak için tavlı preA6Rbz ve gA6Rbz ekleyin. </li><li> RNase içermeyen su 2 ul (no bileşikleri ile kuyu) veya 200 uM kimyasal bileşiklerin birinin veya 2 ul birini içeren kuyu içine ana karışımı (Tablo 3) 18 ul koyun ve şekil 5&#39;e göre olan bir plaka içerisinde kontrol örneklerini içerir. </li><li> Bir plaka kapatıcı ile plaka Seal ve herhangi bir hava kabarcıklarını çıkarmak için aşağı plaka döndürün. 4 saat boyunca 28 ° C&#39;de inkübe edilir. </li><li> Her bir oyuğa gA6Rbz yarışmacının 25 pmol (2 ul) ilave edin. Plakayı aşağı spin ve gerçek-zamanlı PCR makinesine koyun, taze bir mühürleyen yerleştirin. Aşağıdaki deney Programı: Adım 1: 5 dakika boyunca 85 ° C; Adım 2: 10 dakika boyunca 24 ° C; Adım 3: kes. </li><li> 23 ul son hacim olması için her bir oyuğa FRET alt-tabakanın 15 pmol (1 ul) ilave edin. Taze bir mühürleyen ile plaka mühür.Çabuk plaka spin ve real-time PCR makinede geri yerleştirin. </li><li> Aşağıdaki adımlara yeni bir deneme Programı: Adım 1: 1 dakika için 37 ° C; Adım 2: oku; Adım 3: 1, 40 kez Git Adım; Adım 4: durdurun. </li><li> Okuma gerektiren ve FAM filtresi seçmek tüm kuyuları seçerek Kur plaka. 23 ul ve çalışma başlatmak gibi giriş seviyesi. </li><li> Analizi için bir çubuk grafik üzerinde yamaçları çizilerek kinetik bir ölçümünü elde etmek için her bir oyuğa / numuneden elde edilen değerlerin eğimi hesaplanır. NOT: Bir kinetik okuma numune ve arka plan arasındaki sinyal-gürültü oranını iyileştirir; arkaplan örneği sıfıra yakın bir eğime sahip gibi. Bir uç nokta okuma yüksek bir arka plan gürültü vardır. </li></ol>

<ol>
	<li>Benne, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=transcript+of+the+frameshifted+coxII+gene+from+trypanosome+mitochondria+contains+four+nucleotides+that+are+not+encoded+in+the+DNA.">transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA.</a> Cell. 46, 819-826 (1986).</li><li>Hajduk, S., Ochsenreiter, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+kinetoplastids.">RNA editing in kinetoplastids.</a> RNA biology. 7, 229-236 (2010).</li><li>Aphasizhev, R., Aphasizheva, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+insertion/deletion+editing+in+trypanosomes:+a+playground+for+RNA-guided+information+transfer.">Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer.</a> Wiley interdisciplinary reviews RNA. 2, 669-685 (2011).</li><li>Seiwert, S. D., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing:+transfer+of+genetic+information+from+gRNA+to+precursor+mRNA+in+vitro.">RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro.</a> Science. 266, 114-117 (1994).</li><li>Weng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guide+RNA-binding+complex+from+mitochondria+of+trypanosomatids.">Guide RNA-binding complex from mitochondria of trypanosomatids.</a> Molecular. 32, 198-209 (2008).</li><li>Hashimi, H., Zikova, A., Panigrahi, A. K., Stuart, K. D., Lukes, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TbRGG1,+an+essential+protein+involved+in+kinetoplastid+RNA+metabolism+that+is+associated+with+a+novel+multiprotein+complex.">TbRGG1, an essential protein involved in kinetoplastid RNA metabolism that is associated with a novel multiprotein complex.</a> RNA. 14, 970-980 (2008).</li><li>Ammerman, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+trypanosome+RNA+editing+accessory+complex,+MRB1.">Architecture of the trypanosome RNA editing accessory complex, MRB1.</a> Nucleic Acids Res. 40, 5637-5650 (2012).</li><li>Huang, C. E., O'Hearn, S. F., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+and+function+of+the+RNA+editing+complex+in+Trypanosoma+brucei+requires+band+III+protein.">Assembly and function of the RNA editing complex in Trypanosoma brucei requires band III protein.</a> Molecular and cellular biology. 22, 3194-3203 (2002).</li><li>Carnes, J., Trotter, J. R., Peltan, A., Fleck, M., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+Trypanosoma+brucei+requires+three+different+editosomes.">RNA editing in Trypanosoma brucei requires three different editosomes.</a> Molecular and cellular biology. 28, 122-130 (2008).</li><li>Hearn, S. F., Huang, C. E., Hemann, M., Zhelonkina, A., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+brucei+RNA+editing+complex:+band+II+is+structurally+critical+and+maintains+band+V+ligase,+which+is+nonessential.">Trypanosoma brucei RNA editing complex: band II is structurally critical and maintains band V ligase, which is nonessential.</a> Molecular and cellular biology. 23, 7909-7919 (2003).</li><li>Schnaufer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+ligase+essential+for+RNA+editing+and+survival+of+the+bloodstream+form+of+Trypanosoma+brucei.">An RNA ligase essential for RNA editing and survival of the bloodstream form of Trypanosoma brucei.</a> Science. 291, 2159-2162 (2001).</li><li>Tarun, S. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KREPA6+is+an+RNA-binding+protein+essential+for+editosome+integrity+and+survival+of+Trypanosoma+brucei.">KREPA6 is an RNA-binding protein essential for editosome integrity and survival of Trypanosoma brucei.</a> RNA. 14, 347-358 (2008).</li><li>Croft, S. L., Barrett, M. P., Urbina, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemotherapy+of+trypanosomiases+and+leishmaniasis.">Chemotherapy of trypanosomiases and leishmaniasis.</a> Trends in parasitology. 21, 508-512 (2005).</li><li>Denise, H., Barrett, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uptake+and+mode+of+action+of+drugs+used+against+sleeping+sickness.">Uptake and mode of action of drugs used against sleeping sickness.</a> Biochemical pharmacology. 61, 1-5 (2001).</li><li>Seiwert, S. D., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+visualization+of+uridylate+deletion+in+vitro+suggests+a+mechanism+for+kinetoplastid+RNA+editing.">Direct visualization of uridylate deletion in vitro suggests a mechanism for kinetoplastid RNA editing.</a> Cell. 84, 831-841 (1996).</li><li>Igo, R. P., Palazzo, S. S., Burgess, M. L., Panigrahi, A. K., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridylate+addition+and+RNA+ligation+contribute+to+the+specificity+of+kinetoplastid+insertion+RNA+editing.">Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing.</a> Molecular and cellular biology. 20, 8447-8457 (2000).</li><li>Igo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+uridylate-specific+exoribonuclease+activity+in+Trypanosoma+brucei+RNA+editing.">Role of uridylate-specific exoribonuclease activity in Trypanosoma brucei RNA editing.</a> Eukaryotic cell. 1, 112-118 (2002).</li><li>Wang, B., Salavati, R., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hammerhead+ribozyme+substrate+and+reporter+for+in+vitro+kinetoplastid+RNA+editing.">A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing.</a> RNA. 8, 548-554 (2002).</li><li>Moshiri, H., Salavati, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+reporter+substrate+for+monitoring+RNA+editing+in+trypanosomatid+pathogens.">A fluorescence-based reporter substrate for monitoring RNA editing in trypanosomatid pathogens.</a> Nucleic Acids Res. 38, e138 (2010).</li><li>Jenne, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+identification+and+characterization+of+hammerhead-ribozyme+inhibitors+using+fluorescence-based+technology.">Rapid identification and characterization of hammerhead-ribozyme inhibitors using fluorescence-based technology.</a> Nature. 19, 56-61 (2001).</li><li>Hartig, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein-dependent+ribozymes+report+molecular+interactions+in+real+time.">Protein-dependent ribozymes report molecular interactions in real time.</a> Nature. 20, 717-722 (2002).</li><li>Famulok, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+aptamers+and+aptazymes+as+probes+for+screening+approaches.">Allosteric aptamers and aptazymes as probes for screening approaches.</a> Current opinion in molecular therapeutics. 7, 137-143 (2005).</li><li>Teng, B., Burant, C. F., Davidson, N. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+an+apolipoprotein+B+messenger+RNA+editing+protein.">Molecular cloning of an apolipoprotein B messenger RNA editing protein.</a> Science. 260, 1816-1819 (1993).</li><li>Jurica, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Searching+for+a+wrench+to+throw+into+the+splicing+machine.">Searching for a wrench to throw into the splicing machine.</a> Nature chemical biology. 4, 3-6 (2008).</li><li>Spahn, C., Prescott, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Throwing+a+spanner+in+the+works:+antibiotics+and+the+translation+apparatus.">Throwing a spanner in the works: antibiotics and the translation apparatus.</a> Journal of molecular medicine. 74, 423-439 (1996).</li></ol>

The authors have nothing to disclose.

Trypanosom RNA düzenleme kompleksine karşı inhibitörlerini teşhis etmek için yeni bir yüksek veri akışı tarama yöntemi tripanosomatidlerde neden olduğu hastalıkların karşı ilaç keşfi için yeni bir araç temin sunuldu. FRET tabanlı tahlil ribozim yaygın olarak farklı amaçlar 20-22 için kullanılmıştır; ancak, RNA düzenleme aktivitesi 19 in vitro izlenmesi için FRET bazlı ribozim tahlilin kapasitesini kullanılmıştır var. Bu deney, potansiyel olarak, memelilerde 23 çekirdeği ile kodlanmış RNA&#39;ların nükleotid ikame düzenleme gibi ökaryotlarda RNA düzenleme diğer türleri, adapte edilebilir. Bu tahlilin yenilik başına FRET tabanlı bir ribozim tahlilleri kurulmasında değil, editosome karşı kimyasal yüksek verimli tarama için uygun olan bir RNA düzenleme tahlilinde içine bu tekniği içeren bir yöntem geliştirme. Ribozim tahlil-tabanlı bir yöntem diğer ekranlar ve eşek üzerinde çeşitli avantajları vardırays şu anda bu amaç için kullanılabilir. Özel olarak, teknik, böylelikle, yüksek miktarda madde taraması için uygun yapım 19, bir radyo-etiketli bir karşıt olarak alt-tabaka üzerinde bir floresan dayanan bir hassas ve tekrarlanabilir bir &quot;mix-ve-ölçer&quot; deneyi sunar. Bunun yerine basit bir uç-nokta sinyalinin alt tabakanın ilavesinden sonra bir floresan sinyalinin gerçek zamanlı izleme sayesinde daha doğru bir test bileşiklerinin 19, IC50 değerlerini belirlemek için yapar. Bundan başka, tek tek rekombinan proteinlerin aksine bütün-editosome kompleks bileşiklerin önleyici etkilerinin test edilmesine imkan verir. Protein kompleksleri içindeki etkileşimlerinin dinamik yapısı göz önüne alındığında, bu yöntem daha biyolojik temsilcisi editosome proteinlere karşı inhibitörlerinin belirlenmesi 24 ayar veriyor söylenebilir. Buna ek olarak, tüm-editosome kompleksi potansiyel hedef RNA düzenleme ilerlemesini durdurmak için bir fırsat sağlarÇeşitli geçici adımlar olduğunu daha önce tespit edilmemiştir. Böylece, teknik RNA düzenleme süreci için çok önemli etkileşimleri ve faaliyetleri olarak daha iyi bir bakış açısı kazanıyor sağlayacaktır. Bu yaklaşım, karmaşık 24,25 inhibitörleri olarak hareket eden prokaryotik ribozom kompleks birleştirmesi ve işlevi örneğin viomisin ve eritromisin gibi antibiyotikler, kullanan aydınlatılmasına örneklediği gibi geçmişte başarılı olduğu bulunmuştur. Yöntemin başarılı tamamlanmasını sağlamak için, protokollerin bazı ayarlamalar gerekli olabilir. İlk olarak, uygun gliserol gradyan mitokondriyal özü fraksiyonun seçimi çok önemlidir. Burada, gradyanın ~ 20S bölgesine karşılık gelen 11 üzerinden kısımlar 7, kısım 9, maksimum aktivite sergileyen en yüksek düzenleme aktivitesi gösterdi. Bu fraksiyon sunulan tüm testleri için seçilmiş olmakla birlikte, hangi fra değerlendirmek amacıyla önceden tüm fraksiyonlar test etmek için gereklidirdüzenleme aktivitesi tepe şeklinde gösterilmektedir. İkinci olarak, bir seçim fraksiyon doğrulamak için, bu Z&#39;-faktör değeri hesaplanarak sinyal-gürültü oranını değerlendirmek için ön testler için çok önemlidir. Uygun mitokondriyal özü gliserol gradyan ayırma tamamlanmış ise 0,6 &#39;lık bir Z&#39;-değeri elde edilebilir. Daha sonra, titrasyon 19 ile maksimum düzenleme aktivitesi elde etmek için gerekli mitokondriyal özü tekrar değerlendirilmesi reaksiyon hacmi için tavsiye edilir. Bu yazıda sunulan tekniğin önemli bir kısıtlılığı editosome kompleksi 19 saflaştırılmış edildiği mitokondriyal özü gliserol degrade fraksiyonlamanın zahmetli ve zaman alıcı bir süreç ile ilgilidir. Bu dezavantajlara rağmen, bu yöntem, tercihen, böylece yüksek verimli tarama uygulama için eleme, verim potansiyeline karşı düşük maliyeti göz önüne alındığında, ham editosome elde etmek üzere sürülmektedir. Böyle TAP-etiket pu gibi kontrast, diğer yöntemlerdearalığında olacak şekilde yapılır, daha da saflaştırılmış fraksiyonlar editosome vermek mümkün olan bu tür ikincil deneyleri durumunda olduğu gibi bir orta verimli deneyler düşük için uygun olan. Ayrıca, bileşiklerin spesifik inhibitör etkisi sağlamak için, bu editosome yokluğunda ribozim (A6Rbz) aktivitesine karşı test etmek için kontroller dahil etmek gerekir. Daha önceki çalışmalar, bu yöntem sayesinde yüksek bileşik konsantrasyonları 19 de olası parazit boya benzeri bileşikler için IC50 değerlerini hesaplarken de etkisiz olabilir sermiştir unutulmamalıdır. Daha önceden bölünmüş önceden düzenlenmiş ribozim içeren benzer bir floresans bazlı analiz geliştirme sunulan HTS tekniği duyarlılığını artırmak için faydalıdır. Bu editosome karmaşık endonükleazları ile katalize oran-sınırlayıcı endonükleolitik klivaj adımı atlayarak izin verecektir. Bu tadil edilmiş tahlilin diğer bir avantajı ikinci bir tarama aracı olarak bir uygulama olurExoUase, TUTase ve ligasyon katalitik aktiviteleri üzerindeki birincil bir elek vasıtasıyla tanımlanır inhibitörlerinin etkisini izlemek için. Şu anda teklif edilen deney RNA düzenleme silme tür karşı inhibitörlerinin tespiti ile sınırlıdır. Bu nedenle, keşfetmek için başka bir cadde RNA düzenleme ekleme türüne bileşik etkileri izleyebilmek için sunulan testin değişiklik olacaktır.

RNA düzenleme, bir post-transkripsiyonel mRNA modifikasyon bir işlem olup, ilk tripanosomatidlerde 1 keşfedilmiştir. O zamandan beri, önemli iş Tiypanosoma brucei 2,3 RNA düzenleme arkasındaki mekanizmayı inceleyerek yapılmıştır. Enzimatik reaksiyonlar bir dizi olarak, editosome, yaklaşık 20 protein bir çekirdek kompleksi, enerji üretim oksidatif fosforilasyon sisteminin çoklu bileşenleri için olgun mRNA mitokondriyal oluşturur. Katalitik olayların sırası kılavuzu RNA&#39;lar (gRNAs) tarafından dikte gibi, endonükleolitik bölünme, üridilat (U) ekleme veya silme, ve ligasyon 4. Çekirdek editosome kompleks proteinlerine ilave olarak, yardımcı bir dizi faktör de 5-7 tespit edilmiştir. Bu proteinler daha çok bağımsız kompleksleri gruplandırılmıştır görülür. Ancak, çekirdek editosome kompleks protein montaj sırası ve aksesuar ile çekirdek kompleks etkileşim kalıplarıkompleksleri belirlenecek henüz. Tripanosomatidlerde RNA düzenleme işlemini hedefleme kimyasal Disektörler sağlayabilir ki editosome kompleksinin oluşumu ve işlevi okuyan yardım. Ayrıca, birkaç editosome proteinler üzerinde fonksiyonel çalışmalar ilaç 8-12 hedef olarak potansiyellerini gösteren, farklı yaşam evrelerinde genelinde zorunluluk göstermiştir. Bu nedenle, editosome en bulunan inhibitörleri aynı zamanda tripanosomatidlerde karşı kurşun bileşikleri olarak hareket edebilir. Tripanosomatid neden olduğu hastalıklara karşı mevcut ilaçlar, toksik verimsiz ve 13,14 pahalı gibi bu, zamanında. Bir etkili ve uygun in vitro deney RNA düzenlemeyi engelleyen özel inhibitörler için kimyasal evreni keşfetmek için gereklidir. Üç deneyleri geliştirilmiş ve editosome aktivitelerini izlemek için kullanılmıştır: vitro RNA düzenleme tahlilinde 15 (a) tam yuvarlak, (b) in vitro RNA düzenleme tahlilinde 16,17, ön ayrıldı and (c) çekiç ribozimi (HHR) deneyi 18-tabanlı. İlk iki deney radyoaktivite yardımıyla düzenlenmiş ürün (ATPase 6 mRNA) doğrudan görselleştirme dayanır. HHR-bazlı analiz düzenleme üzerine bir Ribozim davranmasına modellenmiştir ATPaz 6 mRNA değiştirilmiş bir sürümünü kullanır. Fonksiyonel Ribozim sonra özellikle bir muhabir olarak hizmet veren, radyo etiketli RNA substrat Cleaves. Son zamanlarda, Moshiri&#39;nin et al. Geliştirilmiş bir &#39;karışımı ve ölçmek&#39; radyo işaretli RNA alt-tabaka, bir flüoresan rezonans enerji transferi (FRET) alt-tabaka 19 ile değiştirildiği burada RNA düzenleme izlemek için in vitro tahlilinde raportör HHR-göre. Bu testin prensibi avantajlar şunlardır: (a) aktif ribozim ve alt-tabaka bölünme üretim düşük hacimli (örneğin 20 ul) aynı tüp içerisinde aynı anda meydana gibi, hızlı ve uygun bir karışım ve tahlilin ölçmek tür, (b ) bu radyoaktif etiketli malzemelerin kullanımı önler, (c) bir hassasiyeti olduğufloresan bir mikro-titre plaka biçiminde enstrümantasyon, ve (d)-gürültü oranı yüksek bir sinyal ile fforded. Bu tayin kullanılarak, saflaştırılmış editosome karşı bilinen RNA ligaz düzenleme inhibitörlerinin etkisi 19, teyit edilmiştir. Bu deney esas olarak T&#39;den bütün editosomes karşı, RNA düzenleme önleyicilerinin hızlı tespit edilmesi için tahlil doğrulanmış brucei. Şekil 1 ayrıntılı bir adım adım şemadır flüoresan bazlı vitro RNA düzenleme deneyde gösterilebilir. Bu protokol, ya in vitro RNA ya da düzenleme izleme kolayca çeşitli ölçekler bileşik kütüphanelerinin taranması için adapte edilmesi için kullanılabilir.

<table border="0" cellpadding="0" cellspacing="0" width="979">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Name of Material/ Equipment</td>
			<td style="width:203px;">Company</td>
			<td style="width:139px;">Catalog Number</td>
			<td style="width:248px;">Comments/Description</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SDM-79 Medium</td>
			<td>Gibco by life technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Fetal Bovine Serum</td>
			<td>life technologies</td>
			<td style="width:139px;">12483-020</td>
			<td>heat inactivation at 550C for 1 h</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Hemin, minimum 80%</td>
			<td style="width:203px;">Sigma</td>
			<td style="width:139px;">H5533-10G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Penicillin-Streptomycin Sollution</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">MT-30-002-CI</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Dnase 1 recombinant, Rnase Free&#160;</td>
			<td style="width:203px;">Roche</td>
			<td style="width:139px;">4716728001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">T7 RiboMax Express Large&#160; scale RNA&#160; production system</td>
			<td style="width:203px;">Promega</td>
			<td style="width:139px;">P1320</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Kimble Kontes Dounce Tissue Grinders&#160;&#160;</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">K885300-0040&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Gradient Master, ver 5.25&#160;</td>
			<td style="width:203px;">Biocomp</td>
			<td style="width:139px;">107-201M</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Ultra Clear Tube, 13.2ML</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">344059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Optima L-100XP&#160; Ultracentrifuge&#160;</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">392052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">SW 41 Ti ROTOR</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">331336</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">MicroSeal &#39;B&#39; Seal, Seals</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">MSB1001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">CFX 384 Touch Real-Time PCR Detection System</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">185-5484</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Acryl/Bis solution (19: 1), 40% (w/v)</td>
			<td style="width:203px;">Bio Basic</td>
			<td style="width:139px;">A0006-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Urea, Molecular biology grade, 1Kg</td>
			<td style="width:203px;">life technologies</td>
			<td style="width:139px;">AM9902</td>
			<td style="width:248px;"></td>
		</tr>
	</tbody>
</table>

rna catalyst as a reporter for screening drugs against rna editing in trypanosomes

Önemli bir ilerleme trypanosom mitokondriyal RNA düzenleme mekanizmasını belirleyen yapılmıştır. Benzer bir şekilde, önemli bir ilerleme RNA düzenlemeyi katalize editosome kompleksin bileşenleri tespit yapılmıştır. Ancak, bu proteinlerin nasıl birlikte çalıştığını hala net değildir. Editosome karşı yüksek verimli bir ekrandan edilen kimyasal bileşikler, düzenleme çevrimi içinde bir veya daha fazla aşamasını bloke eden ya da etkileyebilir. Bu nedenle, yeni kimyasal bileşiklerin tanımlanması editosome fonksiyonu ve kesme düzeneği için değerli moleküler problar üretecektir. Önceki çalışmalarda, in vitro deneyler, düzenleme, radyo-etiketli RNA kullanılarak gerçekleştirildi. Bu deneyler zaman verimsiz ve yüksek verimli amaçlar için uygun, alıcıdır. Burada, homojen floresans-esaslı &quot;karıştır ve ölçmek&quot; RNA düzenleme izlemek için bir çekiç ribozim in vitro haberci deneyi sunulmuştur. Sadece bir RNA düzenleme bir sonucu olarakçekiç ribozim, bir flüoresan rezonans enerji transferi (FRET) oligonükleotid alt-tabaka bölünme geçirmektedir. Bu da, böylece bir sinyal üreten söndürücüden fluorofor ayrılması ile sonuçlanır. Editosome fonksiyonu bloke edildiğinde aksine, floresans sinyali söndürülür olacaktır. Bu in vitro RNA ya da düzenleme editosome fonksiyonunu inhibe kimyasallar yüksek yayılımlı tarama esnasında izlenmesi için genel olarak uygulanabilir olması gerekir, son derece hassas ve basit bir testtir.

Büyük çaplı bir ekranı set edilmesi için gereken gerekli adımları göstermek için, 2-5 tahlilin kalitesine ilişkin temsili kontrol deneyleri Şekil. Bu tarama birkaç gün boyunca tutarlı bir deney için ya da farklı ekranlar karşılaştırılması için gerekli kontrol deneyleri bulunmaktadır. Floresan Sinyal-gürültü Oranı değerlendirilmesi Büyük çaplı bir kurulumunda fosforla etiketlenmiş oligonükleotid substratın istikrar ve kalitesini sağlamak için, arka plan ve deney maksimum sinyal arasındaki fark olarak tanımlanan Z&#39;-faktör, aktif ribozim molekülü (A6Rbz) kullanılarak hesaplanmıştır. . &#39;(; Verici FAM) ve 3 flöresin&#39; N, N &#39;-tetrametil-Z&#39;faktör ile deneyler&gt; 0,5 yüksek verimli ekran için kabul edilebilir olarak kabul edilir Şekil 2 FRET 5 etiketli substrat kullanılarak temsili verileri göstermektedirthylrhodamine (TAMRA; söndürücü) (A6Rbz_F / T). A6Rbz varlığında ve yokluğunda 72 çoğaltır kullanılarak hesaplanmıştır, bu alt-tabaka bir 0.64 Z&#39;-faktörü üretti. Bu deneyde, Iowa koyu siyah bir söndürücü maddenin (A6Rbz_F/Ib) kullanan alternatif bir alt-tabaka TAMRA kıyasla daha iyi bir sinyal-gürültü oranı verebilir. Iowa Siyah, TAMRA aksine, yaydığı ısı ve ışık olarak değil enerjisini absorbe olmasıdır. FAM / Iowa Black (F / Ib)-etiketli substrat kullanılarak elde Z&#39;-faktörü 0.68 idi. TAMRA etiketli alt-tabaka üzerine F / Ib-işaretli substrat için Z&#39;-faktör iyileşme nedeniyle göreceli olarak daha düşük arka plan taşımaktadır. Bu temsili sonuçları, her iki alt-tabakalar, yüksek geçirimli bir elek kullanılmak için uygun seçenekler olduğunu göstermektedir. Gliserol Gradient Kesirler Düzenleme Faaliyetleri Belirlenmesi , Deneyler için glisero en aktif editosome fraksiyonları belirlemek ve seçmek içinl gradyan fraksiyonları flüoresan bazlı deney (Aşama V) kullanılarak in vitro düzenleme için test edilmiştir. Bu veriler en aktif fraksiyonları gibi (Şekil 3) fraksiyonları 7-12 göstermek (≥% 50 düzenleme etkinlik;% 100 olarak en aktif fraksiyonu ile). Daha editosome gerekli olduğunda bu kısımlar kombine edilebilir. Editosome eden fraksiyonlar bir araya getirilmiş iken Z&#39;-faktörünün hesaplanması En aktif fraksiyonlar (F8 + F9 + F10) editosome kaynağı olarak kullanıldığı zaman editosome fraksiyonu birleştirilir ve etkisini belirlemek için, 0.6 Z&#39;-faktör değeri hesaplanmıştır. 72 suret editosome varlığında ve yokluğunda (Şekil 4) test edildi Z&#39;-faktörünü hesaplamak için. F / Ib alt-tabaka, bu deneyde kullanıldı. Bu veriler, gliserol gradyan fraksiyonları bir araya Z&#39;-faktör dayalı tahlilin kalitesi üzerinde minimal bir etkiye sahip olduğunu göstermektedir. ass = &quot;jove_content&quot;&gt; Örnek Testi için Kontrol Deneyi Farklı kontrol örnekleri karşılaştırarak Örnek veri tahlilde değişkenleri analiz etmek için kullanıldı. Şekil 5&#39;te gösterildiği gibi, herhangi bir RNA düzenleme bileşeni (reaksiyon 1-4) kayıp reaksiyonları substratı yarmak yoktur. Ve bağıl floresan düzenleme aktivitesi ile ölçüldüğü gibi, substratın yarılması sadece bir inhibitörü (Reaksiyon 5) yokluğunda ya da tüm düzenleme bileşenlerin varlığı ve aktif olmayan bir bileşik (bir reaksiyon düzenleme reaksiyonların tüm bileşenlerinin mevcudiyetinde gözlenmektedir 6). Bunun aksine, bir inhibe edici bileşik RNA düzenleme blok ve bir pozitif kontrol (Reaksiyon 7) olarak kullanılır. Burada, Mordan Siyah (MrB) ve C53 bileşikleri, sırasıyla pozitif ve negatif kontroller olarak kullanılmıştır. ghres.jpg &quot;width =&quot; 500 &quot;/&gt; Şekil 1. Çekiç ribozim tabanlı vitro RNA düzenleme deneyde gösterilebilir. A) adım adım şematik bir temsilidir floresan merkezli düzenleme vitro deneyde: kendi kılavuz RNA (gA6Rbz) ile önceden düzenlenmiş çekiç ribozim (önceden düzenlenmiş A6Rbz) (a) hibridizasyonu. (B) Tanıma ve saflaştırılmış editosome kompleksi tarafından RNA dubleks etkileşimi. Editosome tarafından katalize (c) Silme RNA düzenleme. (D) 85 ° C&#39;de ısıtılarak ve kılavuz RNA yarışmacının (gA6Rbz_comp) eklenmesi ile editosome ve gA6Rbz gelen düzenlenmiş A6Rbz ayrışması. (E) aktif A6 çekiç ribozim (aktif A6Rbz) ile alt-tabakanın FRET hibridizasyonu. (F) aktif ribozimini. B) Önceden düzenlenmiş çekiç ribozimdir (A6Rbz önceden düzenlenmiş) tarafından FRET substratın bölünmesini aşağıdaki FAM sinyallerin algılanması üç Bize silme (çift başlı arro belirtir gA6Rbz ile birlikte gösterilirdüzenleme bölgesi (ES) için ağırlık). Fonksiyonel editosome mevcudiyetinde RNA düzenleme sonucu olarak etkin ribozim artık FRET substratı (bir ok ile gösterilen bölünme sitesi) yarabilir aktif formuna (düzenlenmiş A6Rbz) içine düzenlenir. 5&#39;-Cuga-3 &#39;ribozimdir aktivite (düzenlenebilir site) için gerekli katalitik çekirdek düzenlenmiş A6Rbz arasında (Bu rakam Moshiri&#39;nin 19 modifiye edilmiştir) vurgulanır korunmuş. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51712/51712fig1highres.jpg" target="_blank">, bu rakamın daha büyük bir versiyonunu görmek için buraya tıklayınız.</a> <img alt="Şekil 2," fo:content-width="5in" src="/files/ftp_upload/51712/51712fig2highres.jpg" width="500" /> Şekil 2.. Sinyal-gürültü farklı söndürücüleri barındıran FRET yüzeyler arasındaki oran karşılaştırma. FAM / TAMRA (F / T) ve FAM / Iowa Siyah FQ (F / lb) yüzeyler kullanılarak ribozyme (A6Rbz) aktivitesi. Y-ekseni, hukDakikada NTS floresan keyfi birim (FAU). <img alt="Şekil 3," fo:content-width="5in" src="/files/ftp_upload/51712/51712fig3highres.jpg" width="500" /> Mitokondriyal lizat gliserol gradyan santrifüjü. Kesir 9. (F9) &#39;den elde seçim fraksiyonların Şekil 3,. RNA düzenleme aktivitesi, en yüksek aktiviteye sahiptir. Y-ekseni,% 100 olarak F9 dikkate alınarak, yüzde olarak nispi düzenleme aktivitesini temsil etmektedir. <img alt="Şekil 4," fo:content-width="5in" src="/files/ftp_upload/51712/51712fig4highres.jpg" width="500" /> Şekil 4,. Editosome kaynağı olarak en aktif fraksiyonlar (F8 + F9 + F10) kullanılarak Z&#39;-faktör hesaplanması. Deneysel varyasyon tepkime her tür 72 kez tekrarlanmış olan elde edilmiştir. Z&#39;-faktörü 0.6 olarak hesaplandı. Y-ekseni, göreli düzenleme aktivitesini temsil etmektedir. <img alt="Şekil 5," fo:content-width="5in" src="/files/ftp_upload/51712/51712fig5highres.jpg" width="500" /> Şekil 5,. Floresan merkezli düzenleme RNA deneyi için deney Örnek. Reaksiyonları ve CFX384 TouchTM gerçek zamanlı PCR algılama sistemi başına 20 ul&#39;lik bir nihai hacimde gerçekleştirilmiştir floresan sinyalini ölçmek için kullanıldı. Grafik deneyi (# 5) için tüm bileşenleri ihtiva eden bir tam düzenleme reaksiyonuna ilaveten çeşitli kontrolleri göstermektedir. Floresan tek başına (# 1) alt-tabakanın bütünlüğünü değerlendirmek için FRET alt-tabakanın mevcudiyetinde ölçülmüştür. Örnek 2. önce düzenleme için bir ribozim etkinliğini izlemek için editosome yokluğunda gerçekleştirildi. Alt tabaka üzerinde denatüre editosome etkisini değerlendirmek için, floresans editosome ve FRET alt-tabakanın mevcudiyetinde ölçülmüştür ancak (# 3). Rehber-yönettiği düzenleme özgünlük, bir sam sınamak içinple gA6Rbz yokluğunda (# 4) kullanılmıştır. Olmayan bir inhibitör (C53, # 6) ve bir inhibitör bileşiği (MrB, # 7) düzenleme tahlil üzerindeki etkisini test etmek için kullanıldı. RNA düzenleme MRB önemli ölçüde inhibe edilirken, C53 göz ardı edilebilir bir etkiye sahiptir. Hata çubukları 10 kez tekrarlanmış arasında deneysel varyasyon (standart sapma) karşılık gelir. Y-ekseni,% 100 olarak reaksiyonun tamamlandığı (# 5) göz önüne alındığında, yüzde olarak nispi düzenleme aktivitesini temsil etmektedir. <table border="0" cellpadding="0" cellspacing="0" width="614"><tbody><tr><td></td><td> % 10. </td><td> % 30 </td></tr><tr><td> 2x HHE degrade tampon </td><td> 5 mi </td><td> 5 mi </td></tr><tr><td> Gliserin </td><td> 1 mi </td><td> 3 mi </td></tr><tr><td> DEPC H2O </td><td> 4 mi </td><td> 2 mi </td></tr><tr><td> 1 M DTT </td><td> 10 ul </td><td> 10 ul </td></tr></tbody></table>Tablo 1.% 10 ve% 30 Gliserin Solüsyonu (10ml her biri). <table border="0" cellpadding="0" cellspacing="0" width="600"><tbody><tr><td colspan="2"> Pre-Düzenlenen A6 Ribozim (preA6Rbz) </td></tr><tr><td> preA6Rbz DNA şablonu </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCA TCAAAAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTT CCCTATAGTGAGTCGTATTA CC-3 &#39; </td></tr><tr><td> preA6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUUUUGAUGAGUCCGUGAGGACGAAACAAUAGA UCAAAUGU-3 &#39; </td></tr><tr><td> RNA stok kons. </td><td> 1 uM </td></tr><tr><td colspan="2"> Kılavuz A6 Ribozim (gA6Rbz) </td></tr><tr><td> gA6RBz DNA şablonu </td><td> 5&#39;-AAAAAAAAAAAAAAAAATAATTATCATATCACTGT CAAGGGAAAGTTGTGAGGGTGATGAGTCCGTGTATATCC CTATAGTGAGTCGTATTA CC-3 &#39; </td></tr><tr><td> gA6Rbz RNA </td><td> 5&#39;-GGGAUAUACACGGACUCAUCACCCUCACAACUU UCCCUUGACAGUGAUAUGAUAAUUAUUUUUUUUUUUUUUUUU-3 &#39; </td></tr><tr><td> RNA stok kons. </td><td> 2.5 uM </td></tr><tr><td colspan="2"> Kılavuz A6 Ribozim Rakip (gA6RBz_comp) </td></tr><tr><td> gA6Rbz_comp DNA şablonu </td><td> 5&#39;-GGATATACACGGACTCATCACCCTCACAACTTTC CCTTGACAGTGATATGATAATTATTTTTTTTTTTTTTTTT CCCTAT AGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> gA6Rbz_comp RNA </td><td> 5&#39;-AAAAAAAAAAAAAAAAAUAAUUAUCAUAUCACUG UCAAGGGAAGUUGUGAGGGUGAUGAGUCCGUGUAUAUCC-3 &#39; </td></tr><tr><td> RNA stok kons. </td><td> 12.5 uM </td></tr><tr><td colspan="2"> Aktif A6 Ribozim (A6RBz) </td></tr><tr><td> A6Rbz DNA şablonu </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCAT CAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTTCC CTATAGTGAGTCGTATTA CC-3 &#39; </td></tr><tr><td> A6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUGAUGAGUCCGUGAGGACGAAACAAUAGAUCA AAUGU-3 &#39; </td></tr><tr><td> RNA stok kons. </td><td> 1 uM </td></tr><tr><td colspan="2"> Tabakayı FRET </td></tr><tr><td> TAMRA söndürücü </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA-TAMRA-3 &#39;(Eurogentec) </td></tr><tr><td> Iowa Siyah söndürücü </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA-Iowa Black-3 &#39;(IDT) </td></tr><tr><td> RNA stok kons. </td><td> 15 uM (her ikisi için) </td></tr></tbody></table> Tablo 2.. DNA ve RNA Şablonlar Yüzeyleri. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Bileşim </td><td> Düzenleme reaksiyonu (ul) </td></tr><tr><td> 10x HHE </td><td> 1.5 </td></tr><tr><td> 0.1 M CaCl2 </td><td> 1 </td></tr><tr><td> 100 mM ATP </td><td> 0.2 </td></tr><tr><td> 10% Triton X-100 </td><td> 0.2 </td></tr><tr><td> 500 ng / Torula maya RNA uL </td><td> 1 </td></tr><tr><td> Editosome </td><td> 5 </td></tr><tr><td> RNazsız H 2 O </td><td> 7.1 </td></tr><tr><td> 1 uM preA6Rbz </td><td> 1 </td></tr><tr><td> 2.5 iM gA6Rbz </td><td> 1 </td></tr><tr><td> Toplam </td><td> 18 </td></tr></tbody></table> Tablo 3. Reaksiyon Kompozisyon ve Master Mix.

Watch this Scientific Journal Video about RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes at JoVE.com

RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Tripanozomlann RNA Düzenleme karşı ilaçlar Tarama için bir Muhabiri olarak RNA Catalyst

Substantial progress has been made in determining the mechanism of mitochondrial RNA editing in trypanosomes. Similarly, considerable progress has been ...

rna-catalyst-as-reporter-for-screening-drugs-against-rna-editing

Nanyang Technological University

Research

JoVE Journal

Biology

8.4K Görüntüleme.  McGill University. A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Video: RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

Visualizing RNA Localization in Xenopus Oocytes

RNA localization is a conserved mechanism of establishing cell polarity. Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to spatially restrict gene expression of Vg1 protein. Tight control of Vg1 distribution in this manner is required for proper germ layer specification in the developing embryo. RNA sequence elements in the 3' UTR of the mRNA, the Vg1 localization element (VLE) are required and sufficient to direct transport. To study the recognition and transport of Vg1 mRNA in vivo, we have developed an imaging technique that allows extensive analysis of trans-factor directed transport mechanisms via a simple visual readout. 
To visualize RNA localization, we synthesize fluorescently labeled VLE RNA and microinject this transcript into individual oocytes. After oocyte culture to allow transport of the injected RNA, oocytes are fixed and dehydrated prior to imaging by confocal microscopy. Visualization of mRNA localization patterns provides a readout for monitoring the complete pathway of RNA transport and for identifying roles in directing RNA transport for cis-acting elements within the transcript and trans-acting factors that bind to the VLE (Lewis et al., 2008, Messitt et al., 2008). We have extended this technique through co-localization with additional RNAs and proteins (Gagnon and Mowry, 2009, Messitt et al., 2008), and in combination with disruption of motor proteins and the cytoskeleton (Messitt et al., 2008) to probe mechanisms underlying mRNA localization.

Visualizing RNA Localization in Xenopus Oocytes

Visualization of in vivo RNA transport is accomplished by microinjection of fluorescently labeled RNA transcripts into Xenopus oocytes, followed by confocal microscopy.

Görselleştirme RNA Yerelleştirme Xenopus Oosit

RNA localization is a conserved mechanism of establishing cell polarity.  Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to ...

Biyoloji

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

HeLa Hücre Transfeksiyon Ardından Gaussia Lusiferaz mRNA in vitro transkripsiyon ve Kapatma yılında

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

RNA Saflaştırma tarafından Kromatin İzolasyon (chirp)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Electroantennographic Bioassay as a Screening Tool for Host Plant Volatiles

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host plant.1,2 When a host plant is an important agronomic commodity feeding damage by insect pests can inflict serious economic losses to growers. Accordingly, kairomones can be used as attractants to lure or confuse these insects and, thus, offer an environmentally friendly alternative to pesticides for insect control.3 Unfortunately, plants can emit a vast number volatiles with varying compositions and ratios of emissions dependent upon the phenology of the commodity or the time of day. This makes identification of biologically active components or blends of volatile components an arduous process. To help identify the bioactive components of host plant volatile emissions we employ the laboratory-based screening bioassay electroantennography (EAG). EAG is an effective tool to evaluate and record electrophysiologically the olfactory responses of an insect via their antennal receptors. The EAG screening process can help reduce the number of volatiles tested to identify promising bioactive components. However, EAG bioassays only provide information about activation of receptors. It does not provide information about the type of insect behavior the compound elicits; which could be as an attractant, repellent or other type of behavioral response. Volatiles eliciting a significant response by EAG, relative to an appropriate positive control, are typically taken on to further testing of behavioral responses of the insect pest. The experimental design presented will detail the methodology employed to screen almond-based host plant volatiles4,5 by measurement of the electrophysiological antennal responses of an adult insect pest navel orangeworm (Amyelois transitella) to single components and simple blends of components via EAG bioassay. The method utilizes two excised antennae placed across a "fork" electrode holder. The protocol demonstrated here presents a rapid, high-throughput standardized method for screening volatiles. Each volatile is at a set, constant amount as to standardize the stimulus level and thus allow antennal responses to be indicative of the relative chemoreceptivity. The negative control helps eliminate the electrophysiological response to both residual solvent and mechanical force of the puff. The positive control (in this instance acetophenone) is a single compound that has elicited a consistent response from male and female navel orangeworm (NOW) moth. An additional semiochemical standard that provides consistent response and is used for bioassay studies with the male NOW moth is (Z,Z)-11,13-hexdecadienal, an aldehyde component from the female-produced sex pheromone.6-8

A method to rapidly screen host plant volatiles by measurement of the electrophysiological response of adult navel orangeworm (Amyelois transitella) antennae to single components and blends via electroantennographic analysis is demonstrated.

Konak Bitki uçucu için bir tarama aracı olarak Electroantennographic Biyoassay

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

CRISPR / Cas Sistemleri Endonükleazlar için Substrat Üretimi

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity and functionality of the gut community will provide insight into the effects of gut microbiota on mosquito life traits. Metagenomic RNA-Seq has become an important tool to analyze transcriptomes from various microbes present in a microbial community. Messenger RNA usually comprises only 1-3% of total RNA, while rRNA constitutes approximately 90%. It is challenging to enrich messenger RNA from a metagenomic microbial RNA sample because most prokaryotic mRNA species lack stable poly(A) tails. This prevents oligo d(T) mediated mRNA isolation. Here, we describe a protocol that employs sample derived rRNA capture probes to remove rRNA from a metagenomic total RNA sample. To begin, both mosquito and microbial small and large subunit rRNA fragments are amplified from a metagenomic community DNA sample. Then, the community specific biotinylated antisense ribosomal RNA probes are synthesized in vitro using T7 RNA polymerase. The biotinylated rRNA probes are hybridized to the total RNA. The hybrids are captured by streptavidin-coated beads and removed from the total RNA. This subtraction-based protocol efficiently removes both mosquito and microbial rRNA from the total RNA sample. The mRNA enriched sample is further processed for RNA amplification and RNA-Seq.

A ribosomal RNA (rRNA) depletion protocol was developed to enrich messenger RNA (mRNA) for RNA-seq of the mosquito gut metatranscriptome. Sample specific rRNA probes, which were used to remove rRNA via subtraction, were created from the mosquito and its gut microbes. Performance of the protocol can result in the removal of approximately 90-99% of rRNA.

Sivrisinek Gut Metagenomic RNA-seq Ribozomal RNA tükenmesi

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity ...

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

Marine elasmobranchs are valued animal models for biomedical and genomic studies as they are the most primitive vertebrates to have adaptive immunity and have unique mechanisms for osmoregulation 1-3. As the most primitive living jawed-vertebrates with paired appendages, elasmobranchs are an evolutionarily important model, especially for studies in evolution and development. Marine elasmobranchs have also been used to study aquatic toxicology and stress physiology in relationship to climate change 4. Thus, development and adaptation of methodologies is needed to facilitate and expand the use of these primitive vertebrates to multiple biological disciplines. Here I present the successful adaptation of RNA whole mount in situ hybridization and histological techniques to study gene expression and cell histology in elasmobranchs.
Monitoring gene expression is a hallmark tool of developmental biologists, and is widely used to investigate developmental processes 5. RNA whole mount in situ hybridization allows for the visualization and localization of specific gene transcripts in tissues of the developing embryo. The expression pattern of a gene's message can provide insight into what developmental processes and cell fate decisions a gene may control. By comparing the expression pattern of a gene at different developmental stages, insight can be gained into how the role of a gene changes during development.
While whole mount in situ's provides a means to localize gene expression to tissue, histological techniques allow for the identification of differentiated cell types and tissues. Histological stains have varied functions. General stains are used to highlight cell morphology, for example hematoxylin and eosin for general staining of nuclei and cytoplasm, respectively. Other stains can highlight specific cell types. For example, the alcian blue stain reported in this paper is a widely used cationic stain to identify mucosaccharides. Staining of the digestive tract with alcian blue can identify the distribution of goblet cells that produce mucosaccharides. Variations in mucosaccharide constituents on short peptides distinguish goblet cells by function within the digestive tract 6. By using RNA whole mount in situ's and histochemical methods concurrently, cell fate decisions can be linked to gene-specific expression.
Although RNA in situ's and histochemistry are widely used by researchers, their adaptation and use in marine elasmobranchs have met limited and varied success. Here I present protocols developed for elasmobranchs and used on a regular basis in my laboratory. Although further modification of the RNA in situ's hybridization method may be needed to adapt to different species, the protocols described here provide a strong starting point for researchers wanting to adapt the use of marine elasmobranchs to their scientific inquiries.

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

By combining methods for RNA whole mount in situ hybridization and histology, gene expression can be linked with cell fate decisions in the developing embryo. These methods have been adapted to marine elasmobranchs and facilitate the use of these animals as model organisms for biomedical, toxicology and comparative studies.

RNA<em&gt; Yerinde</emTüm Dağı Embriyolar ve Hücre histolojisi&gt; Hibridizasyon Deniz Elasmobranchs İçin Uyarlanmış

Marine  elasmobranchs are valued animal models for biomedical and genomic studies as  they are the most primitive vertebrates to have adaptive immunity ...

A Chemical Screening Procedure for Glucocorticoid Signaling with a Zebrafish Larva Luciferase Reporter System

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids can lead to severe side effects. Test systems are needed to search for novel compounds influencing glucocorticoid signaling in vivo or to determine unwanted effects of compounds on the glucocorticoid signaling pathway. We have established a transgenic zebrafish assay which allows the measurement of glucocorticoid signaling activity in vivo and in real-time, the GRIZLY assay (Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY). The luciferase-based assay detects effects on glucocorticoid signaling with high sensitivity and specificity, including effects by compounds that require metabolization or affect endogenous glucocorticoid production. We present here a detailed protocol for conducting chemical screens with this assay. We describe data acquisition, normalization, and analysis, placing a focus on quality control and data visualization. The assay provides a simple, time-resolved, and quantitative readout. It can be operated as a stand-alone platform, but is also easily integrated into high-throughput screening workflows. It furthermore allows for many applications beyond chemical screening, such as environmental monitoring of endocrine disruptors or stress research.

We describe the procedure and data analysis of a chemical screening system for glucocorticoid stress hormone signaling using zebrafish larvae: the Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY (GRIZLY) assay. The assay sensitively and specifically detects effects on glucocorticoid signaling by compounds that require metabolization or affect endogenous glucocorticoid production.

Bir Zebra balığı Larva Lusıferaz Muhabir Sistemi ile glukokortikoid Signaling&#39;den için bir Kimyasal Tarama Prosedürü

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids ...

A Method for Screening and Validation of Resistant Mutations Against Kinase Inhibitors

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the potential of targeting the kinase in cancers by effectively treating the CML patients. This observation revolutionized drug development to target the oncogenic kinases implicated in various other malignancies, such as, EGFR, B-RAF, KIT and PDGFRs. However, one major drawback of anti-kinase therapies is the emergence of drug resistance mutations rendering the target to have reduced or lost affinity for the drug. Understanding the mechanisms employed by resistant variants not only helps in developing the next generation inhibitors but also gives impetus to clinical management using personalized medicine. We reported a retroviral vector based screening strategy to identify the spectrum of resistance conferring mutations in BCR/ABL, which has helped in developing the next generation BCR/ABL inhibitors. Using Ruxolitinib and JAK2 as a drug target pair, here we describe in vitro screening methods that utilizes the mouse BAF3 cells expressing the random mutation library of JAK2 kinase.

Emergence of genetic resistance against kinase inhibitor therapy poses significant challenge for effective cancer therapy. Identification and characterization of resistant mutations against a newly developed drug helps in better clinical management and next generation drug design. Here, we describe our protocol for in vitro screening and validation of resistant mutations.

Kinaz İnhibitörleri Karşı Dayanıklı Mutasyonlarının Tarama ve Doğrulama için Bir Yöntem

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the ...

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression regulation at posttranscriptional levels by affecting the stability and translational efficiency of target mRNAs. RNA pull-down technique has been widely used to study RNA-protein interaction, which is necessary to elucidate the mechanism underlying RBPs&#39; as well as long non-coding RNAs&#39; (lncRNAs) function. However, the high lipid abundance in adipocytes poses a technical challenge in conducting this experiment. Here a detailed RNA pull-down protocol is optimized for primary adipocyte culture. An RNA fragment from androgen receptor&#39;s (AR) 3&#39; untranslated region (3&#39;UTR) containing an adenylate-uridylate-rich elementwas used as an example to demonstrate how to retrieve its RBP partner, HuR protein, from adipocyte lystate. The method described here can be applied to detect the interactions between RBPs and noncoding RNAs, as well as between RBPs and coding RNAs.

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

An RNA pull-down protocol is optimized here for detection of interactions between RNA-binding proteins (RBPs) and noncoding as well as coding RNAs. An RNA fragment from androgen receptor (AR) was used as an example to demonstrate how to retrieve its RBP from lystate of primary brown adipocytes.

RNA bağlama proteinlerinin tespiti ile<em&gt; İn Vitro</emAdiposit Kültür&gt; RNA pull-down

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression ...