We thank Hongjae Sunwoo for helpful advice for oligonucleotide design in RNA FISH. We also thank Serenity Curtis for editing the manuscript. N.Y. was supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science (JSPS). This work was supported by the NIH (RO1-GM102184), the March of Dimes Research Foundation (#6-FY12-337), and the Developmental Fund and Trustee Grant at Cincinnati Children's Hospital Medical Center to Y.O.

1. Preparação Probe <ol><li> Obter vários oligonucleotídeos únicas em Xist (oligonucleotídeos 20-30 nucleotídeos de comprimento, 63-65 ºC de temperatura de fusão, a Tabela 1) com uma modificação 5&#39;-amino e suspender em água. </li><li> Piscina quantidades equimolares de oligonucleotídeos com 5&#39;-amino modificação (total 4,5 g) e etiqueta com corante fluorescente amino-reactivo seguindo as instruções do fabricante. <ol><li> Dissolve-se os oligonucleótidos reunidos no final de 5 ul de água isenta de nuclease e adicionar 3 mL de 1 M de bicarbonato de sódio à solução de oligonucleótido. </li><li> Adicionar 2 mL de DMSO para o frasco de corante e vortex brevemente reactivo com amina. </li><li> Misturar a solução de oligonucleótido com o corante reactivo em DMSO e incubar a mistura à temperatura ambiente durante 1 h no escuro. </li></ol></li><li> Purifica-se as sondas oligonucleotídicas marcadas com fluorescência por coluna G-25 seguido de precipitação com etanol. <ol><li&gt; Centrífuga coluna G-25 a 750 xg durante 1 min para remover o excesso de tampão de armazenamento. </li><li> Adicionar 40 ul livre de nuclease de água à mistura de rotulagem produzido no Passo 1.2.3 e aplicar à coluna de G-25. Centrifugar a 750 xg por 2 min. </li><li> Adicionar 50 ul de água livre de nuclease, 10 ul de acetato de sódio 3M (pH 5,2) e 250 ul de etanol a sonda purificada a partir do passo 1.3.2. Armazenar a -80 ° C durante 30 min e centrifuga-se a 21.000 xg durante 15 min a 4 ° C. </li><li> Lavar os oligonucleótidos precipitados uma vez com 1 ml de etanol a 70%. </li><li> Re-suspender em 50 ul de água isenta de nuclease ou TE (10 mM Tris-HCl, pH 7,5; EDTA 1 mM) para uma concentração final de aproximadamente 10 pM. </li></ol></li><li> Dilui-se as sondas de oligonucleótidos marcados com fluorescência para uma concentração final de 250 nM com tampão de hibridação (formamida a 10%; 2 x SSC [NaCl 300 mM; citrato de sódio 30 mM], 2 mg / ml de BSA, 10% de sulfato de dextrano). NOTA: Com este protocolo FISH rápida, oligonucleotídeo pmantos de Xist foram concebidos e utilizados com uma concentração mais elevada do que o protocolo normal de FISH utilizando sondas oligonucleotídicas, a fim de encurtar o tempo de incubação para a hibridação. </li></ol> 2. Deslize Preparação NOTA: As lâminas podem ser preparados para imuno-FISH utilizando o rato-tronco embrionárias (ES) ou corpo embryoid (EB) diferenciação de células 20, 21 ou por cultivá-las diretamente em um slide tratados com poli-lisina ou usando cytospin com suspensão de células. Aqui, preparação da lâmina por cytospin é mostrado. <ol><li> Aspirar o meio de cultura em um prato de 6 poços. Lavar com PBS (temperatura ambiente), e aspirado cuidadosamente. </li><li> Adicionar 0,5 ml de tripsina para o prato de 6 poços, incubar durante 5-10 min a 37 ° C. </li><li> Adicionar 5 ml de meio e dispersar as células por suavemente pipetando para cima e para baixo várias vezes. </li><li> Transferir as células para um tubo de 15 ml, centrifugar durante 5 minutos a 200 xg à temperatura ambiente. </li><li> Descartar o meio de umd suavemente suspender as células em 2 ml de PBS. </li><li> Contagem de células utilizando um hemocitómetro, e dilui-se a suspensão celular a 4 x 10 5 células / ml por PBS. </li><li> Montar uma corrediça, um cartão de filtro e uma câmara com um grampo e colocá-los dentro das ranhuras adequadas no rotor do cytospin. Adicionar 250 mL de cada amostra preparada no passo 2.6 em cada câmara das unidades montadas na cytospin. Centrifuga-se a 1.500 rpm durante 10 minutos à temperatura ambiente. </li><li> Encher frascos de 3 coplin sobre gelo com 40 mL de cada um de tampão PBS, CSK gelado (10 mM PIPES, pH 6,8; NaCl 100 mM; sacarose 300 mM; MgCl2 3 mM) e tampão CSKT (CSK com tampão de 0,5% de Triton X-100), respectivamente. </li><li> Após a citocentrifugação está terminado, rapidamente transferir a corrediça em PBS gelado e incubar durante 5 min. </li><li> Transferir as lâminas para tampão CSK gelada e incubar durante 1 min. </li><li> Transferir as lâminas para tampão CSKT gelada e incubar durante 5 min. </li><li> Transferir as lâminas de volta para gelada CSK buffer e incubar durante 1 min. </li><li> Transferir as lâminas em 4% de paraformaldeído em PBS e incubar durante 10 min à temperatura ambiente. </li></ol> 3. Imunofluorescência <ol><li> Colocar as lâminas em um frasco coplin com PBST (1x PBS com 0,1% de Tween-20) durante vários segundos. </li><li> Colocar as lâminas em uma inclinação permitindo tampão restante flua no escorregador. Limpe cuidadosamente o excesso de líquido para fora do slide e colocá-lo em uma caixa de pipeta-tip vazio com água. Sobrepor a lâmina com 40 ul de solução de bloqueio (PBS 1x, 1% BSA, 0,1% de Tween-20), colocar suavemente uma lamela, e incubar durante 10 min à temperatura ambiente. </li><li> Retirar as lamelas, remover a solução de bloqueamento e adicionar 40 ul de anticorpo de histona H3K27me3 primário diluído para uma concentração de 1: 500 em solução de bloqueio. Coloque a lamela de volta sobre a lâmina e incubar durante 30 min à temperatura ambiente. NOTA: Um inibidor RNase na solução de bloqueio pode ser útil para preservar RNA neste RNA FISProtocolo de H quando são utilizados anticorpos policlonais. </li><li> Wash deslizar 2 vezes em frascos coplin cheios de PBST, durante 5 minutos cada, agitando suavemente durante a lavagem. </li><li> Colocar as lâminas em uma inclinação permitindo tampão restante flua no escorregador. Limpe cuidadosamente o excesso de líquido e coloque a lâmina de volta na caixa de ponta. Sobreposição com 40 ul do anticorpo secundário (1: 500) diluídos em solução de bloqueio, colocar uma lamela, e incubar durante 15 min no escuro. Para os passos seguintes, manter o slide no escuro em todos os momentos. </li><li> Lavar duas vezes em frascos Coplin com PBST como no passo 3.4. </li></ol> 4. FISH RNA com Oligonucleotide Sondas <ol><li> Pré-aquecer uma caixa de pipeta-tip vazio com água na parte inferior para evitar slides de secagem a 37 ° C por RNA FISH no passo 4.3. </li><li> Colocar as lâminas em uma inclinação permitindo tampão restante flua no escorregador. Limpe cuidadosamente o excesso de líquido para fora do slide a partir do passo 3.6 e coloque a lâmina na caixa de pipeta-ponta com water na parte inferior. Adicionar 500 ul de tampão de lavagem de FISH (10% de formamida em 2 x SSC) sobre a lâmina e incubar durante 5 min à temperatura ambiente. </li><li> Remover solução de lavagem FISH, adicione 8 mL de sondas de oligonucleotídeos para o slide, coloque uma lamela, e transferir o slide para uma caixa de pipeta-ponta pré-aquecido com água na parte inferior; incubar a 37 ° C durante 1-2 horas. </li><li> Coloque 3 frascos coplin pré-aquecido em banho-maria a 37 ° C com tampão de lavagem FISH, tampão de lavagem FISH com DAPI, e 2x SSC. </li><li> Depois de 1-2 incubação hr para RNA FISH, coloque o slide no tampão de lavagem FISH pré-aquecido. </li><li> Incubar a lâmina durante alguns minutos até que a lamela cai fora da lâmina. </li><li> Colocar a lâmina de volta para o tampão de lavagem, e continuar a incubação durante 5 min. </li><li> Transferir as lâminas para outro frasco coplin com tampão de lavagem pré-aquecido FISH com 0,5 ng / ml DAPI e incubar por 5 min. </li><li> Transferir as lâminas para outro frasco coplin com pré-aquecido 2x SSC e incubar por 5 min. </li><li> Colocar as lâminas em uma inclinação permitindo tampão restante flua no escorregador. Limpe cuidadosamente o excesso de líquido e coloque a lâmina de volta em uma caixa de ponta seca. Adicione 4 l de antifade com DAPI para o slide e colocar uma lamela. </li><li> Selar a lamela com unha polonês e observar ao microscópio. A corrediça pode ser armazenado a 4 ° C no escuro, por alguns meses. </li></ol>

<ol>
	<li>Payer, B., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+chromosome+dosage+compensation:+how+mammals+keep+the+balance.">X chromosome dosage compensation: how mammals keep the balance.</a> Annu Rev Genet. 42, 733-772 (2008).</li><li>Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gracefully+ageing+at+50,+X-chromosome+inactivation+becomes+a+paradigm+for+RNA+and+chromatin+control.">Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control.</a> Nat Rev Mol Cell Biol. 12, 815-826 (2011).</li><li>Gendrel, A. V., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fifty+years+of+X-inactivation+research.">Fifty years of X-inactivation research.</a> Development. 138, 5049-5055 (2011).</li><li>Froberg, J. E., Yang, L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guided+by+RNAs:+X-inactivation+as+a+model+for+lncRNA+function.">Guided by RNAs: X-inactivation as a model for lncRNA function.</a> J Mol Biol. 425, 3698-3706 (2013).</li><li>Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+Xist+in+X+chromosome+inactivation.">Requirement for Xist in X chromosome inactivation.</a> Nature. 379, 131-137 (1996).</li><li>Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xist-deficient+mice+are+defective+in+dosage+compensation+but+not+spermatogenesis.">Xist-deficient mice are defective in dosage compensation but not spermatogenesis.</a> Genes Dev. 11, 156-166 (1997).</li><li>Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XIST+RNA+paints+the+inactive+X+chromosome+at+interphase:+evidence+for+a+novel+RNA+involved+in+nuclear/chromosome+structure.">XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure.</a> J Cell Biol. 132, 259-275 (1996).</li><li>Sado, T., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+chromosome+silencing+by+the+long+non-coding+RNA.">Advances in understanding chromosome silencing by the long non-coding RNA.</a> Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322, 750-756 (2008).</li><li>Plath, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+histone+H3+lysine+27+methylation+in+X+inactivation.">Role of histone H3 lysine 27 methylation in X inactivation.</a> Science. 300, 131-135 (2003).</li><li>Silva, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+histone+h3+methylation+on+the+inactive+X+chromosome+requires+transient+recruitment+of+Eed-Enx1+polycomb+group+complexes.">Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes.</a> Dev Cell. 4, 481-495 (2003).</li><li>Gall, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+synthesis+of+the+genes+for+ribosomal+RNA+during+amphibian+oogenesis.">Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis.</a> Proc Natl Acad Sci U S A. 60, 553-560 (1968).</li><li>Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+single+RNA+transcripts+in+situ.">Visualization of single RNA transcripts in situ.</a> Science. 280, 585-590 (1998).</li><li>Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat Methods. 5, 877-879 (2008).</li><li>Chaumeil, J., Augui, S., Chow, J. C., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+immunofluorescence,+RNA+fluorescent+in+situ+hybridization,+and+DNA+fluorescent+in+situ+hybridization+to+study+chromatin+changes,+transcriptional+activity,+nuclear+organization,+and+X-chromosome+inactivation.">Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation.</a> Methods Mol Biol. 463, 297-308 (2008).</li><li>Katayama, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+transcription+in+the+mammalian+transcriptome.">Antisense transcription in the mammalian transcriptome.</a> Science. 309, 1564-1566 (2005).</li><li>Ogawa, Y., Xite Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-inactivation+intergenic+transcription+elements+that+regulate+the+probability+of+choice.">X-inactivation intergenic transcription elements that regulate the probability of choice.</a> Mol Cell. 11, 731-743 (2003).</li><li>Panning, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+inactivation+in+mouse+ES+cells:+histone+modifications+and+FISH.">X inactivation in mouse ES cells: histone modifications and FISH.</a> Methods Enzymol. 376, 419-428 (2004).</li><li>Khalil, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+human+large+intergenic+noncoding+RNAs+associate+with+chromatin-modifying+complexes+and+affect+gene+expression.">Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression.</a> Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).</li><li>Martin, G. R., Evans, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+clonal+lines+of+teratocarcinoma+cells:+formation+of+embryoid+bodies+in+vitro.">Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro.</a> Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).</li><li>Lee, J. T., Lu, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+of+Tsix+leads+to+nonrandom+X+inactivation.">Targeted mutagenesis of Tsix leads to nonrandom X inactivation.</a> Cell. 99, 47-57 (1999).</li><li>Zhang, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomeric+RNAs+mark+sex+chromosomes+in+stem+cells.">Telomeric RNAs mark sex chromosomes in stem cells.</a> Genetics. 182, 685-698 (2009).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472, 365-386 (2010).</li><li>Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+organization+of+histone+H3+modifications+as+revealed+by+a+panel+of+specific+monoclonal+antibodies.">The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies.</a> Cell Struct Funct. 33, 61-73 (2008).</li><li>Ogawa, Y., Sun, B. K., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intersection+of+the+RNA+interference+and+X-inactivation+pathways.">Intersection of the RNA interference and X-inactivation pathways.</a> Science. 320, 1336-1341 (2008).</li><li>Kohlmaier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chromosomal+memory+triggered+by+Xist+regulates+histone+methylation+in+X+inactivation.">A chromosomal memory triggered by Xist regulates histone methylation in X inactivation.</a> PLoS Biol. 2, 171 (2004).</li><li>Wang, K. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+long+noncoding+RNAs.">Molecular mechanisms of long noncoding RNAs.</a> Mol Cell. 43, 904-914 (2011).</li></ol>

No conflicts of interest declared.

Neste artigo, apresentamos um protocolo de imuno-FISH rápida, que leva menos de 5 horas para completar a preparação slide, Xist RNA FISH, e imunofluorescência para H3K27me3. Em comparação com a abordagem geral imuno-FISH para Xist RNA de detecção, que normalmente precisa de incubação durante a noite para RNA FISH, este protocolo não só reduz significativamente o tempo gasto, mas também melhora a sensibilidade imunológica-FISH usando sondas de oligonucleotídeos. Uma vez que é altamente Xist transcritas durante inactivação do cromossoma X e a sua transcrição é encontrada a acumular-se sobre o intensamente Xi em cis, que é fácil de detectar Xist sinal de ARN e na diferenciação de células diferenciadas, por FISH de ARN utilizando um tempo de incubação relativamente breve. Este protocolo de imuno-FISH pode ser aplicado para outras proteínas de interesse e RNA abundantes, embora optimização em imunofluorescência e ARN FISH pode ser necessária. A fim de aplicar o protocolo para outro RNA, o númeero de possíveis sondas oligonucleotídicas que devem ser considerados, seguido por optimização de tentativa-e-erro de concentração da sonda, tempo de incubação e temperatura de ARN FISH. Um exemplo de outras aplicações é o nosso sucesso anterior na detecção de RNA telomeric utilizando sondas LNA solteiro 22. Para o projeto da sonda e preparação para a detecção de alvos baixos de RNA abundantes, consulte o artigo de Raj e Tyagi 23. Outra questão que deve ser considerado é o passo permeabilização. É necessária uma análise cuidadosa sobre diferentes condições de permeabilização; por exemplo, os efeitos mais suaves do que o que está descrito no nosso protocolo pode ocorrer com permeabilização após fixação 15. Vários procedimentos permeabilização também precisam ser considerados aquando da realização de imuno-FISH, utilizando diferentes tipos de células. A fim de imunofluorescência e ARN FISH também podem afectar a detecção de proteínas alvo, modificações e ARN por imuno-FISH. Se RNA FISH é executared antes de imunofluorescência, uma hora de incubação, durante o segmento de ARN FISH é suficiente para detectar o sinal de RNA Xist. No entanto, uma vez que a formamida contida no tampão de hibridação e tampão de lavagem FISH afeta negativamente H3K27me3 imunofluorescência, nós sempre realizar H3K27me3 imunofluorescência antes Xist RNA FISH neste protocolo. Para outras aplicações, a fim de procedimentos que dependem das proteínas alvo e modificações epigenética a ser observada por imunofluorescência. Como o anticorpo primário foi utilizado para imunofluorescência H3K27me3 tem um elevado título e especificidade para H3K27me3 24, somos capazes de utilizar um tempo de incubação mais curto para imunofluorescência. No entanto, o tempo de reacção e temperatura para imunocoloração são dependentes do anticorpo utilizado e, assim, é necessária optimização para cada anticorpo. Utilizando sondas de oligonucleótidos, Xist detecção de ARN pela ARN-FISH foi significativamente melhorada. Em nossos estudos anteriores, verificou-se que um subconjunto de differentiating células com coloração H3K27me3 no Xi não estão associados ao sinal de Xist ARN 25. Desde H3K27me3 modificação no Xi é associada com o recrutamento PRC2 por Xist ARN 9-11, 26, especulamos que isto era devido à penetração ineficaz de ribossondas para os núcleos em comparação com o anticorpo para imunofluorescência. Ao usar sondas de oligonucleotídeos neste protocolo, observou-se que o sinal H3K27me3 na diferenciação de células femininas quase sempre co-localizados com Xist RNA (Figura 1). Este protocolo de imuno-FISH rápido nos permite ter um instantâneo das mudanças dinâmicas que giram em torno Xist lncRNA e oferece uma nova ferramenta para ajudar a obter uma melhor compreensão do modo lncRNA funciona. IncRNAs afetar várias funções celulares como imprinting genômico, regulação gênica, tradução de RNA, e maturação RNA 27. Desenvolver uma maior compreensão do papel diversoé tocada por lncRNA ajudaria a impulsionar o campo para a frente e para permitir futuras descobertas na regulação de processos celulares vitais dentro do corpo humano, bem como contribuir para o desenvolvimento de alvos potenciais para o tratamento de doenças. Uma vez que este protocolo pode ser facilmente otimizado em relação a outros marcadores e lncRNAs de interesse, é uma grande ferramenta para ajudar a resolver os mistérios de vários lncRNAs nas células.

Mammalian inactivação do cromossoma X (XCI) é uma estratégia para compensar o desequilíbrio de dosagem do gene ligado ao X e XY entre XX, em que um dos dois cromossomas X em fêmeas é transcricionalmente inactiva 1. Inativação do cromossomo X é um grande sistema modelo para RNA longo não-codificante (lncRNA) pesquisa. Inativação do cromossomo X é regulada por vários lncRNAs, e tem sido amplamente estudado ao longo das últimas décadas para descobrir os mecanismos de crosstalk entre lncRNAs, transcrição, estrutura da cromatina e organização nuclear 2, 3. O centro X inactivação (XIC) localizado no cromossoma X é um locus genético complexo composto de um número de genes que produzem não codificantes RNAs 4. X-inativo transcrição específico (Xist) lncRNA em mamíferos eutherian é um desses lncRNA que desempenha um papel crucial na inativação do cromossomo X 5,6. Transcrições XIST rodeiam o local do future Xi para iniciar inativação do cromossomo X, e aparecem como uma nuvem quando visualizada usando RNA FISH; esta formação é referido como o &quot;Xist Nuvem&quot; 7. Desde Xist ARN interage com vários enzimas de modificação de cromatina, a co-localização das nuvens XIST com diferentes modificações epigenética para cromatina silenciosa e repressor de transcrição é observado durante a inactivação do cromossoma X 8. Por exemplo, Xist ARN interage com Polycomb complexo repressor 2 (PRC2) que é responsável pela H3K27me3 e induz um estado repressivo 9 cromatina. A ocorrência da nuvem Xist no Xi e sua co-localização com a modificação intensiva H3K27me3 representa uma paisagem heterocromatina facultativa do Xi 10,11. Técnicas de citogenética, como o DNA / RNA FISH têm percorreu um longo caminho desde o método tradicional utilizando sondas radiomarcados 12 às técnicas recentes e avançados, com maior sensibilidade eimagens fluorescentes usando várias sondas de oligonucleotídeos 13,14. PEIXES ADN / ARN acoplado com a imunofluorescência foi rotineiramente usado como uma ferramenta para compreender citológico organização espaço-temporal nuclear, ARN de localização, a estrutura da cromatina e modificações. A preparação mais padrão sonda para RNA FISH envolve o uso de plasmídeo ou cromossoma artificial (BAC) clones bacterianas e sua rotulagem subsequente quer com tradução nick ou iniciação ao acaso 15. No entanto, cerca de 70% dos genes em ratos e 40% de genes em humanos mostram uma sobreposição de transcritos de sentido e anti-16, exigindo assim um método FISH específico de cadeia, a fim de distinguir o sentido e anti-transcrições. Em sondas de ARN transcritos in vitro (ribossonda ) são frequentemente utilizados para específicos de cadeia de ARN FISH 17,18; No entanto, isto envolve a preparação de um clone de plasmídeo ou com o produto de PCR de T7, SP6 ou T3 promotor e ribossondas sintetizar. Além disso, ribossondas derivado genomic DNA ou cDNA geralmente contêm regiões não-específicas e elementos repetitivos, que resultam em alto ruído de fundo. Outra questão é que ribossondas, que são algumas centenas de nucleótidos de comprimento e contêm vários fluoróforos, não pode penetrar de forma eficiente para o núcleo. Para contornar este, várias sondas de oligonucleótidos mais curtos marcados com um fluoróforo único no final foram desenvolvidos que possuem uma boa sensibilidade, a intensidade do sinal uniforme, e facilidade de purificação e de manuseamento 14. Além disso, os oligonucleótidos de ADN são geralmente mais estáveis ​​do que o RNA. Nós aplicamos uma estratégia similar de usar oligonucleotídeos em Xist RNA FISH 19 com imunofluorescência para entender a dinâmica epigenéticas do Xi induzidas por Xist lncRNA durante o processo de inativação do cromossomo X. Este protocolo descreve a criação de sondas de oligonucleótidos e preparação de células apropriada, bem como a utilização de imunofluorescência e ARN FISH. Xist RNA FISH usando oligonucle múltiplaotides é o custo abordagem eficaz a longo prazo, se Xist RNA FISH é realizada rotineiramente em um laboratório. Esta técnica pode ser usada para identificar lncRNAs em células, ao mesmo tempo mapeando sua co-localização com modificações epigenética ou factores. Uma das principais vantagens do protocolo é a capacidade de modificá-lo facilmente para atender um de interesses de pesquisa.

<table><tbody><tr><td>oligonucleotides with 5&amp;rsquo;-amino modification</td><td>IDT</td><td></td><td></td></tr><tr><td>Alexa Fluor 488 Reactive Dye</td><td>Life Technologies</td><td>A32750</td><td></td></tr><tr><td>MicroSpin G-25 columns</td><td>GE Healthcare</td><td>27-5325-01</td><td></td></tr><tr><td>Cytospin 2</td><td>Shandon</td><td>59900102</td><td></td></tr><tr><td>Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer)</td><td>Roche</td><td>10715859103</td><td></td></tr><tr><td>Histone H3K27me3 antibody</td><td>Active Motif</td><td>61017</td><td></td></tr><tr><td>Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed</td><td>Life Technologies</td><td>A21424</td><td></td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36931</td><td></td></tr></tbody></table>

quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation

Combinando ARN hibridização in situ fluorescente (FISH) com a imunofluorescência (imuno-FISH) cria uma técnica que pode ser empregue no nível da célula individual para detectar a dinâmica espacial de localização de ARN com visão simultânea para a localização de proteínas, modificações epigenética e outros detalhes que pode ser destacado por imunofluorescência. Inativação do cromossomo X é um paradigma para longo RNA não-codificante (lncRNA) silenciamento gênico mediado. Transcrição específico (Xist) acumulação lncRNA X-inactiva (chamado uma nuvem Xist) em um dos dois X-cromossomas em fêmeas de mamíferos é um passo crítico para iniciar a inactivação do cromossoma X. RNA Xist direta ou indiretamente interage com várias enzimas modificadoras da cromatina e introduz paisagens epigenéticas distintas para os inactivos cromossomo X (Xi). Uma característica conhecida da epigenética Xi representa a histona H3 trimetil-lisina 27 modificação (H3K27me3). Aqui, descrevemos um imuno-FISH simples e rápidaprotocolo para a detecção Xist RNA usando RNA FISH com várias sondas de oligonucleotídeos juntamente com imunofluorescência de H3K27me3 para examinar a localização dos Xist RNA e modificações epigenéticas associadas. Usando sondas oligonucleotídicas resulta em um tempo de incubação mais curto e de detecção mais sensível do Xist ARN em comparação com in vitro transcritos de sondas de ARN (ribossondas). Este protocolo fornece uma poderosa ferramenta para a compreensão da dinâmica de lncRNAs e sua modificação epigenética associados, estrutura da cromatina, organização nuclear e de regulação da transcrição.

Imagens representativas de rápida imuno-FISH são apresentados na Figura 1A. A co-localização do sinal de Xist ARN nuvem e H3K27me3 no Xi foi detectado na diferenciação das células do sexo feminino. No dia 12 após a diferenciação, mais de 90% das células tinha uma nuvem EB Xist (Figura 1B). Sondas oligonucleotídicas curto eficientemente penetrou nos núcleos, levando a uma visualização de quase todos H3K27me3 sinais co-localizada com Xist ARN (Figura 1C; 97%, n = 150). <img alt="Figura 1" src="/files/ftp_upload/52053/52053fig1highres.jpg" /> Figura 1: RNA Xist e H3K27me3 co-localizar no Xi na diferenciação do mouse EB (A) Immuno-FISH para Xist RNA com modificação H3K27me3 na diferenciação de células EB femininos no dia 12 na diferenciação.. XIST sondas foram marcadas com Alexa Fluor 488, e anti-H3K27me3 anticorpo primário foi desgido por anti-IgG de ratinho com Alexa Fluor 555 anticorpo secundário conjugado. Os núcleos foram contrastadas com DAPI. A região em caixa é ampliada nos painéis inferiores. Barras de escala:... 10 mm (B) Freqüência de XIST células em nuvem e H3K27me3-positivas na EB no dia 12 na diferenciação (C) Freqüência de co-localização de Xist nuvem com sinal H3K27me3 na EB no dia 12 na diferenciação <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52053/52053fig1large.jpg" target="_blank">favor clique aqui para ver uma versão maior desta figura.</a> <table><tbody><tr><td> Xp1 </td><td> ggtaagtatccaaaaccccgttgg </td></tr><tr><td> Xp2 </td><td> cgatcagcagcaacagtacacg </td></tr><tr><td> Xp3 </td><td> gcaattggttgcttttatccagtcc </td></tr><tr><td> XP4 </td><td> cgcaacaccgcacactaatacg </td></tr><tr><td> XP5 </td><td> gccatcttagacacattcaagagcat </td></tr><tr><td> XP6 </td><td> cacacgtgaagtaccaagcgaaac </td></tr><tr><td> XP7 </td><td> gccacgtatagagcactgtaagagactatg </td></tr><tr><td> XP8 </td><td> caaagcacactatcagacgtgtcg </td></tr><tr><td> Xp9 </td><td> ggagaatctagatgccataaaggcaag </td></tr><tr><td> XP10 </td><td> tgatggacactgcattttagcactg </td></tr><tr><td> Xp11 </td><td> ggacactgcattttagcaatacgattc </td></tr><tr><td> Xp12 </td><td> gtgatgggcactgcattttagc </td></tr><tr><td> Xp13 </td><td> agatgggctatctcagtcttataggct </td></tr><tr><td> Xp14 </td><td> ggaagtcagtatggagggggtatg </td></tr><tr><td> Xp15 </td><td> tgggactgtgactactacagcaatga </td></tr><tr><td> Xp16 </td><td> aagactcaattcctagtcaggattatccac </td></tr><tr><td> Xp17 </td><td> gggctgtagctctatgacagtgcttt </td></tr><tr><td> Xp18 </td><td> gtcttcaccagatgcagattactacagtg </td></tr><tr><td> Xp19 </td><td> aatagtttgaggaaggggtttcaagtg </td></tr><tr><td> XP20 </td><td> gctgttcaggtttccttctgtagtga </td></tr><tr><td> Xp21 </td><td> gcaagagatacaatggtccgaaaagt </td></tr><tr><td> Xp22 </td><td> agcacttcgtacaaccctctttctg </td></tr><tr><td> Xp23 </td><td> gaagagagcaggtcattcgtcagag </td></tr><tr><td> Xp24 </td><td> gcaactgagacactgtagccatatgaag </td></tr><tr><td> Xp25 </td><td> ttcctggaggaagaacggaaaga </td></tr><tr><td> Xp26 </td><td> tgattagaaggcttaggtcatcttcca </td></tr><tr><td> Xp27 </td><td> ttttgttcagagtagcgaggacttga </td></tr><tr><td> Xp28 </td><td> aatagagcagaatggcttcctcgaa </td></tr><tr><td> Xp29 </td><td> acattgcttgatcacgctgaagac </td></tr><tr><td> XP30 </td><td> gcaaggaagaaatagacacacaaagc </td></tr><tr><td> Xp31 </td><td> ggaagaaatagatgtaacaaagaattagacaca </td></tr><tr><td> XP32 </td><td> cacttcagagccacttgaatcctg </td></tr><tr><td> Xp33 </td><td> agtcacaggtgtcctgtagaaacagttc </td></tr><tr><td> Xp34 </td><td> cctttatgggcaatggcaacaat </td></tr><tr><td> Xp35 </td><td> ggcacatctgcatattgcttgtcta </td></tr><tr><td> Xp36 </td><td> gcaactaagaccatgaacccacaa </td></tr><tr><td> Xp37 </td><td> aaacacactggccttaagtatatggactg </td></tr><tr><td> Xp38 </td><td> cattcatttgcacacatggaacaat </td></tr><tr><td> Xp39 </td><td> tgggagacaatatttagcctccaggt </td></tr><tr><td> Xp40 </td><td> cctagcaagggcactgttttgtaataa </td></tr><tr><td> Xp41 </td><td> taacatttagcacactgccttgcac </td></tr><tr><td> Xp42 </td><td> cagtgatctacactaggtccacctcaca </td></tr><tr><td> Xp43 </td><td> ttatgttgaaggaatcttggccttg </td></tr><tr><td> Xp44 </td><td> aagtgagagctgtagtctcaaggtgtga </td></tr><tr><td> Xp45 </td><td> gtattcaacctctgaggcaaactgtg </td></tr><tr><td> Xp46 </td><td> agattgtggaacttagatggctgtca </td></tr><tr><td> Xp47 </td><td> tggaactgcattaaagtcccaacttag </td></tr><tr><td> Xp48 </td><td> gaactcccagacctcttcaacctg </td></tr></tbody></table&gt; Tabela 1: Seqüência de oligonucleotídeos marcados fluorescente para Xist RNA FISH. Os 48 oligonucleótidos foram sintetizados com uma modificação 5&#39;-amino para preparar as sondas oligonucleotídicas marcadas com fluorescência para ARN Xist FISH.

Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level.

Fluorescent Rápida<em&gt; In Situ</em&gt; Protocolo de hibridação para Xist RNA combinado com imunofluorescência de Histone Modificação na inativação do cromossomo X

Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell ...

quick-fluorescent-situ-hybridization-protocol-for-xist-rna-combined

Nanyang Technological University

Research

JoVE Journal

Biology

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

13.9K visualizações.  Cincinnati Children's Hospital Medical Center. We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level. 

Vídeo: Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Uso de hibridização in situ de fluorescência (FISH) para monitorar o estado da coesão do braço em oócitos de Drosophila na prometáfase e na metáfase I

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Biologia do Desenvolvimento

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. The protocol is a modified version of the standard in situ hybridization using alkaline phosphatase and substrates such as NBT/BCIP and Fast Red 1,2. This protocol utilizes standard digoxygenin and fluorescein labeled probes along with tyramide signal amplification (TSA) 3. The commercially available TSA kits allow flexible experimental design as fluorescence emission from green to far-red can be used in combination with various nuclear stains, such as propidium iodide, or fluorescence immunohistochemistry for proteins. TSA produces a reactive fluorescent substrate that quickly covalently binds to moieties, typically tyrosine residues, in the immediate vicinity of the labeled antisense riboprobe. The resulting staining patterns are high resolution in that subcellular localization of the mRNA can be observed using laser scanning confocal microscopy 3,4. One can observe nascent transcripts at the chromosomal loci, distinguish nuclear and cytoplasmic staining and visualize other patterns such as cortical localization of mRNA. Studies in Drosophila indicate that roughly 70% of mRNAs exhibit specific patterns of subcellular localization that frequently correlate with the function of the encoded protein 5. When combined with computer-aided reconstruction of 3D confocal datasets, our protocol allows the detailed analysis of mRNA distribution with sub-cellular resolution in whole vertebrate embryos.

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. We include a propidium iodide nuclear counter-stain to highlight tissue organization.

Zebrafish Whole Mount Alta Resolução Duplo Fluorescente In Situ Hibridização

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology.  Here, we present a high-resolution double ...

Biologia

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including genetic disorders, of which chromosomal abnormalities are the most common. Fluorescence in situ hybridization (FISH) is a well-known and frequently used method to detect chromosomal aberrations in humans. FISH is mainly used for the analysis of chromosomal abnormalities in the spermatozoa of males with numerical or structural chromosomal aberrations. Furthermore, this technique is also frequently applied in females to detect X chromosomal aberrations that are known to cause ovarian dysgenesis. However, information on the X chromosomal content of ovarian cells from females with X chromosomal aberrations in lymphocytes and/or buccal cells is still lacking.
The aim of this study is to advance basic research regarding X chromosomal aberrations in females, by presenting two methods based on FISH to identify the X chromosomal content of ovarian cells. First, a method is described to determine the X chromosomal content of isolated ovarian cells (oocytes, granulosa cells, and stromal cells) in non-grafted ovarian cortex tissue from females with X chromosomal aberrations. The second method is directed at evaluating the effect of chromosomal aberrations on folliculogenesis by determining the X chromosomal content of ovarian cells of newly formed secondary and antral follicles in ovarian tissue, from females with X chromosomal aberrations after long-term grafting into immunocompromised mice. Both methods could be helpful in future research to gain insight into the reproductive potential of females with X chromosomal aberrations.

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

This article presents two methods based on fluorescence in situ hybridization to determine the X chromosomal content of ovarian cells in non-grafted and grafted ovarian cortex tissue from females with X chromosomal aberrations.

Explorando aberrações cromossômicas X em células ovarianas usando hibridização in situ fluorescente

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including ...

Genética

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

Fluorescência In situ Hybridization (FISH) Protocolo no esperma humano

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological processes. In particular, appropriate regulation of calcium activity patterns during embryogenesis is necessary for many aspects of vertebrate neural development, including proper neural tube closure, synaptogenesis, and neurotransmitter phenotype specification. While the observation that calcium activity patterns can differ in both frequency and amplitude suggests a compelling mechanism by which these fluxes might transmit encoded signals to downstream effectors and regulate gene expression, existing population-level approaches have lacked the precision necessary to further explore this possibility. Furthermore, these approaches limit studies of the role of cell-cell interactions by precluding the ability to assay the state of neuronal determination in the absence of cell-cell contact. Therefore, we have established an experimental workflow that pairs time-lapse calcium imaging of dissociated neuronal explants with a fluorescence in situ hybridization assay, allowing the unambiguous correlation of calcium activity pattern with molecular phenotype on a single-cell level. We were successfully able to use this approach to distinguish and characterize specific calcium activity patterns associated with differentiating neural cells and neural progenitor cells, respectively; beyond this, however, the experimental framework described in this article could be readily adapted to investigate correlations between any time-series activity profile and expression of a gene or genes of interest.

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

We present a two-part protocol that combines fluorescent calcium imaging with in situ hybridization, allowing the experimenter to correlate patterns of calcium activity with gene expression profiles on a single-cell level.

Imagem fluorescente de cálcio e subsequente hibridização em Situ para caracterização do precursor neuronal em xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological ...

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can be hampered by the lack of specific primary or secondary antibodies for immunostaining. Here we describe a protocol to detect the expression of three different genes in the same brain section using double fluorescence in situ hybridization with two gene-specific probes followed by immunostaining with an antibody of high specificity directed against the protein encoded by a third gene. The Aspartoacyclase (ASPA) gene, mutations of which can lead to a rare human white matter disease - Canavan disease - is thought to be expressed in oligodendrocytes and microglia but not in astrocytes and neurons. However, the precise expression pattern of ASPA in the brain has yet to be established. This protocol has allowed us to determine that ASPA is expressed in a subset of mature oligodendrocytes and it can be generally applied to a wide range of gene expression pattern studies.

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Localizing gene expression to specific cell types can be challenging due to the lack of specific antibodies. Here we describe a protocol for simultaneous triple detection of gene expression by combining double fluorescence RNA in situ hybridization with immunostaining.

Combinando Duplo Fluorescência<em&gt; In Situ</em&gt; A hibridação com imunomarcação para a detecção da expressão de três genes em secções do cérebro do rato

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can ...

Neurociência

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The specification of replication timing is thought to be a dynamic process regulated by tissue-specific and developmental cues that are responsive to epigenetic modifications. However, the mechanisms regulating where and when DNA replication initiates along chromosomes remains poorly understood. Homologous chromosomes usually replicate synchronously, however there are notable exceptions to this rule. For example, in female mammalian cells one of the two X chromosomes becomes late replicating through a process known as X inactivation1. Along with this delay in replication timing, estimated to be 2-3 hr, the majority of genes become transcriptionally silenced on one X chromosome. In addition, a discrete cis-acting locus, known as the X inactivation center, regulates this X inactivation process, including the induction of delayed replication timing on the entire inactive X chromosome. In addition, certain chromosome rearrangements found in cancer cells and in cells exposed to ionizing radiation display a significant delay in replication timing of &gt;3 hours that affects the entire chromosome2,3. Recent work from our lab indicates that disruption of discrete cis-acting autosomal loci result in an extremely late replicating phenotype that affects the entire chromosome4. Additional 'chromosome engineering' studies indicate that certain chromosome rearrangements affecting many different chromosomes result in this abnormal replication-timing phenotype, suggesting that all mammalian chromosomes contain discrete cis-acting loci that control proper replication timing of individual chromosomes5.
Here, we present a method for the quantitative analysis of chromosome replication timing combined with fluorescent in situ hybridization. This method allows for a direct comparison of replication timing between homologous chromosomes within the same cell, and was adapted from6. In addition, this method allows for the unambiguous identification of chromosomal rearrangements that correlate with changes in replication timing that affect the entire chromosome. This method has advantages over recently developed high throughput micro-array or sequencing protocols that cannot distinguish between homologous alleles present on rearranged and un-rearranged chromosomes. In addition, because the method described here evaluates single cells, it can detect changes in chromosome replication timing on chromosomal rearrangements that are present in only a fraction of the cells in a population.

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

A quantitative method for the analysis of chromosome replication timing is described. The method utilizes BrdU incorporation in combination with fluorescent in situ hybridization (FISH) to assess replication timing of mammalian chromosomes. This technique allows for the direct comparison of rearranged and un-rearranged chromosomes within the same cell.

Tempo cromossomo Replicando Combinado com Fluorescente<em&gt; Em situ</em&gt; Hibridização

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The ...

Combined Immunofluorescence and DNA FISH on 3D-preserved Interphase Nuclei to Study Changes in 3D Nuclear Organization

Fluorescent in situ hybridization using DNA probes on 3-dimensionally preserved nuclei followed by 3D confocal microscopy (3D DNA FISH) represents the most direct way to visualize the location of gene loci, chromosomal sub-regions or entire territories in individual cells. This type of analysis provides insight into the global architecture of the nucleus as well as the behavior of specific genomic loci and regions within the nuclear space. Immunofluorescence, on the other hand, permits the detection of nuclear proteins (modified histones, histone variants and modifiers, transcription machinery and factors, nuclear sub-compartments, etc). The major challenge in combining immunofluorescence and 3D DNA FISH is, on the one hand to preserve the epitope detected by the antibody as well as the 3D architecture of the nucleus, and on the other hand, to allow the penetration of the DNA probe to detect gene loci or chromosome territories 1-5. Here we provide a protocol that combines visualization of chromatin modifications with genomic loci in 3D preserved nuclei.

Here we describe a protocol for simultaneous detection of histone modifications by immunofluorescence and DNA sequences by DNA FISH followed by 3D microscopy and analyses (3D immuno-DNA FISH).

Imunofluorescência combinados e FISH DNA em 3D preservado núcleos interfásicos para estudar mudanças na organização nuclear 3D

Fluorescent in situ hybridization using DNA probes  on 3-dimensionally preserved nuclei followed by 3D confocal microscopy (3D DNA  FISH) represents the ...

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within cells. Neurochemical phenotyping of functionally identified neurons usually requires concurrent labelling with multiple antibodies (targeting protein) using immunohistochemistry (IHC) and optimization of in situ hybridization (targeting RNA), in tandem. A &#34;neurochemical signature&#34; to characterize particular neurons may be achieved however complicating factors include the need to verify FISH and IHC targets before combining the methods, and the limited number of RNAs and proteins that may be targeted simultaneously within the same tissue section.
Here we describe a protocol, using both fresh frozen and fixed mouse brain preparations, which detects multiple mRNAs and proteins in the same brain section using RNAscope FISH followed by fluorescence immunostaining, respectively. We use the combined method to describe the expression pattern of low abundance mRNAs (e.g., galanin receptor 1) and high abundance mRNAs (e.g., glycine transporter 2), in immunohistochemically identified brainstem nuclei.
Key considerations for protein labelling downstream of the FISH assay extend beyond tissue preparation and optimization of FISH probe labelling. For example, we found that antibody binding and labelling specificity can be detrimentally affected by the protease step within the FISH probe assay. Proteases catalyze hydrolytic cleavage of peptide bonds, facilitating FISH probe entry into cells, however they may also digest the protein targeted by the subsequent IHC assay, producing off target binding. The subcellular location of the targeted protein is another factor contributing to IHC success following FISH probe assay. We observed IHC specificity to be retained when the targeted protein is membrane bound, whereas IHC targeting cytoplasmic protein required extensive troubleshooting. Finally, we found handling of slide-mounted fixed frozen tissue more challenging than fresh frozen tissue, however IHC quality was overall better with fixed frozen tissue, when combined with RNAscope.

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

This protocol describes a method for combining fluorescence in situ hybridization (FISH) and fluorescence immunohistochemistry (IHC) in both fresh frozen and fixed mouse brain sections, with the goal of achieving multilabel FISH and fluorescence IHC signal. IHC targeted cytoplasmic and membrane attached proteins.

Combinando Hibridização In Situ por Fluorescência Multiplex com Imunohistoquímica Fluorescente em Seções Cerebrais de Camundongos Frescos Congelados ou Fixos

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within ...

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected.

Combined DNA-RNA Fluorescent In situ Hybridization FISH to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) allows the detection of nucleic acids in their native environment within cells. We here describe a protocol for the combined, simultaneous detection of RNA and DNA by means of FISH, which can be used to study X chromosome inactivation in mouse embryonic stem cells.

DNA-RNA combinado fluorescente<em&gt; Em situ</em&gt; A hibridização (FISH) para estudar inativação do cromossomo X em Diferenciada Feminino Rato Células-Tronco Embrionárias

Fluorescent Rápida

Resumo

Explore mais vídeos

Capítulos neste vídeo