We appreciate and thank the technical assistance of Xiaohong He, Ricardo Marius, Julia Petryk, Bradley Austin, and Christiano Tanese De Souza. We also thank Mina Ghahremani for Graphic Design. We would also like to thank all the individuals who participated and donated their blood samples for this study. DWC is supported in part by uOttawa Faculty and Department of Medicine.

NOTE: The protocol described below adheres to all ethics guidelines according to protocol code 20200371-01H.
1. Production and evaluation of the HiBiT-RBD bioreporter
<ol>
	<li>Producing a sufficient quantity of HiBiT-RBD bioreporter
	<ol>
		<li>Prepare for cell culture
		<ol>
			<li>Prepare complete Dulbecco&#39;s modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Then, warm the media in a 37 &#176;C water bath.</li>
			<li>Turn the biological safety cabinet (BSC) on, and use 70% v/v ethanol for sterilizing the cabinet surface.</li>
		</ol>
		</li>
		<li>Culture the cell line.
		<ol>
			<li>Take out the cell line from -80 &#176;C or liquid nitrogen, and thaw it in a 37 &#176;C water bath. 
			NOTE: An appropriate cell line is easy to maintain in culture, has high transfection efficiency, and is suitable for exogenous protein production. Human embryonic kidney, HEK293 cells were used for this protocol.</li>
			<li>Mix the thawed cells with at least 10 mL of complete medium, pipette the cell suspension to a 10 cm Petri dish, and swirl the plate to distribute cells in the dish uniformly. Place the dish in a cell culture incubator at 37 &#176;C, 5% CO2, and 85-95% humidity.</li>
			<li>Observe the cells under the microscope until the confluency level reaches 80-90%. At high confluency, remove the medium, wash the cells with warm phosphate-buffered saline (PBS), and add 1 mL of 0.25% trypsin-ethylenediamine tetraacetic acid to detach the cells from the surface. 
			NOTE: The HEK293 cells are fairly easily detached. Hence, the washing step should be done very gently to prevent accidental detachment and loss of cells.</li>
			<li>After approximately 5 min, look at the cells under a microscope. If all cells are floating, add at least 4 mL of medium, and transfer the cell suspension into a new sterile tube. Count the cells using a hemocytometer, and add 1 &#215; 106 cells into each well of a 6-well plate for transfection. 
			NOTE: After 24 h, cells should be at 80% or more confluent.</li>
		</ol>
		</li>
		<li>Transfection of the HiBiT-RBD plasmid
		<ol>
			<li>Use 1 &#181;g of the HiBiT-RBD expression plasmid with a suitable transfection reagent. Incubate for 10-15 min at room temperature, and then add the total volume to each well of the plate, drop-wise. 
			NOTE: Follow the manufacturer&#39;s transfection protocol. In this case, a mixture (a specified amount) of the transfection reagent with DMEM was added to the diluted plasmid (1 &#181;g) in DMEM (see the Table of Materials). Use a marker containing (e.g., green fluorescent protein [GFP]) plasmid as a control to monitor the transfection efficiency.</li>
			<li>On the next day, replace the medium containing the transfection mixture with complete medium. Observe the transfection control well 48 h after transfection. 
			NOTE: If the transfection was positive and efficient (more than 80% GFP-positive), the cells should be ready for harvesting the HiBiT-RBD bioreporter. The construct also contains His-tag, which can be used to obtain purified protein in place of the total supernatant.</li>
			<li>Collect the supernatant in 1.5 mL microtubes. Add 500 &#181;L of 1x passive lysis buffer (PLB) to the cells; incubate and shake the plate for 15 min at room temperature for cell lysis. 
			NOTE: The supernatant and the lysate solution can be preserved at -20 &#176;C with minor loss of integrity for at least 6 months. According to Azad et al.22, the reporter is stable at a wide range of pH (4-12) and temperature (4-42 &#176;C).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Evaluation of the luminescent signal from the bioreporter by luciferase assay
	<ol>
		<li>Preparing the reaction components
		<ol>
			<li>Use the supernatant as the source of the bioreporter. 
			NOTE: Both supernatant and lysate contain the HiBiT-RBD bioreporter and can be used for the assay. However, the supernatant is recommended as the source due to reasons explained in the following notes.</li>
			<li>Dilute the LgBiT and substrate to 1x before use (stock concentration is 100x). 
			NOTE: See the Table of Materials for details about the LgBiT.</li>
		</ol>
		</li>
		<li>Luciferase assay
		<ol>
			<li>Transfer 50 &#181;L of the supernatant from each well or tube to a 96-well plate, and add 50 &#181;L of 1x LgBiT to each well. Incubate for 5 min at room temperature.</li>
			<li>Open the luminometer software, add 50 &#181;L of 1x substrate (furimazine) to each well, place the plate in the luminometer, and run the software. 
			&#8203;NOTE: Add the substrate immediately before reading the plate to prevent consumption of the substrate by the active enzymes before signal measurement.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Detecting anti-RBD antibody with a fast and sensitive assay
<ol>
	<li>HiBiT-RBD antibody detection assay
	<ol>
		<li>Prepare the HiBiT-RBD bioreporter as described in section 1.1 of the protocol. 
		NOTE : It is recommended to use the supernatant for the following assay as it is simpler to collect and contains the mature glycosylated version of the protein. Moreover, the lysate has several other proteins that could interfere with the HiBiT-RBD-antibody interaction.</li>
		<li>Combine 50 &#181;L of the HiBiT-RBD-containing supernatant with 1 &#181;g of the commercial SARS-CoV-2-RBD antibody in a 1.5 mL microtube. Add 20 &#181;L of immunoglobulin-binding protein (protein G) to the solution. Bring up the total volume to 300 &#181;L by adding PBS. 
		NOTE: The total volume of the mixture can be decreased to 150 &#181;L. Lower total volumes are not recommended as it could result in inadequate mixing of antibodies with the bioreporter.</li>
		<li>Incubate the tube(s) on a tube shaker or rotator for 30 min. Centrifuge at 12,000 &#215; g for 30 s, discard the supernatant, and wash with PBS. Repeat the process three times to remove free HiBiT-RBD. Resuspend in 50 &#181;L of PBS and transfer to a 96-well plate.</li>
		<li>Add 50 &#181;L of 1x LgBiT and wait for 5 min. Then, add 50 &#181;L of 1x NanoLuc substrate. Immediately read the luminescent signal with a luminometer.</li>
	</ol>
	</li>
</ol>
3. High-throughput detection of the SARS-CoV-2-specific antibodies from patient serum samples
<ol>
	<li>Prepare larger quantities of the HiBiT-RBD bioreporter for a high-throughput assay by following section 1.1 of the protocol.</li>
	<li>Combine 20 &#181;L of magnetic protein G with 50 &#181;L of the HiBiT-RBD supernatant in a well of 96-well plate for each sample. Add 10 &#181;L of the serum sample to each well and bring up the total volume to 150 &#181;L by adding PBS. 
	NOTE: Use both nonspecific IgG (negative control) and neutralizing SARS-CoV-2 antibody (positive control) at 1 &#181;g/mL concentration as described in step 2.1.2. Moreover, serum samples from vaccinated mice can also be assessed for antibodies. In this test, serum samples were obtained from Ottawa Hospital General Campus under an approved procedure and with informed consent from individuals.</li>
	<li>Incubate for 30 min on a shaker at room temperature. Place the plate on a magnetic washer to precipitate the protein G-antibody complex. 
	NOTE: The specific structure of the magnetic washer will precipitate the complex on the side walls of each well.</li>
	<li>Discard the solution in the middle section of each well, and add PBS for washing. Repeat the washing step at least three times to remove excess HiBiT-RBD. Add 50 &#181;L of 1x PBS and 50 &#181;L of 1x LgBiT. Incubate for at least 5 min at room temperature.</li>
	<li>Prepare the luminometer software, and then add 50 &#181;L of 1x substrate. Place the plate in the machine, run the software, and record the signals. Compare the signals from serum samples, control samples, and background (empty wells).</li>
</ol>

<ol>
	<li>Ullah, H., Ullah, A., Gul, A., Mousavi, T., Khan, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+coronavirus+2019+(COVID-19)+pandemic+outbreak:+A+comprehensive+review+of+the+current+literature.">Novel coronavirus 2019 (COVID-19) pandemic outbreak: A comprehensive review of the current literature.</a> Vacunas. , (2020).</li><li>Coronavirus update (Live). Worldometer Available from: <a target="_blank" href="https://www.worldometers.info/coronavirus/">https://www.worldometers.info/coronavirus/</a> (2021)</li><li>Cacciapaglia, G., Cot, C., Sannino, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second+wave+COVID-19+pandemics+in+Europe:+a+temporal+playbook.">Second wave COVID-19 pandemics in Europe: a temporal playbook.</a> Scientific Reports. 10 (1), 15514 (2020).</li><li>COVID-19 vaccines. World Health Organization Available from: <a target="_blank" href="https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines">https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines</a> (2021)</li><li>Hueston, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+antibody+response+to+SARS-CoV-2+infection.">The antibody response to SARS-CoV-2 infection.</a> Open Forum Infectious Diseases. 7 (9), (2020).</li><li>Lan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+the+SARS-CoV-2+spike+receptor-binding+domain+bound+to+the+ACE2+receptor.">Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.</a> Nature. 581 (7807), 215-220 (2020).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implications+for+SARS-CoV-2+vaccine+design:+fusion+of+Spike+glycoprotein+transmembrane+domain+to+receptor-binding+domain+induces+trimerization.">Implications for SARS-CoV-2 vaccine design: fusion of Spike glycoprotein transmembrane domain to receptor-binding domain induces trimerization.</a> Membranes. 10 (9), 215 (2020).</li><li>Piccoli, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+neutralizing+and+immunodominant+sites+on+the+SARS-CoV-2+Spike+receptor-binding+domain+by+structure-guided+high-resolution+serology.">Mapping neutralizing and immunodominant sites on the SARS-CoV-2 Spike receptor-binding domain by structure-guided high-resolution serology.</a> Cell. 183 (4), 1024-1042 (2020).</li><li>Premkumar, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+receptor-binding+domain+of+the+viral+spike+protein+is+an+immunodominant+and+highly+specific+target+of+antibodies+in+SARS-CoV-2+patients.">The receptor-binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients.</a> Science Immunology. 5 (48), (2020).</li><li>Walls, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elicitation+of+potent+neutralizing+antibody+responses+by+designed+protein+nanoparticle+vaccines+for+SARS-CoV-2.">Elicitation of potent neutralizing antibody responses by designed protein nanoparticle vaccines for SARS-CoV-2.</a> Cell. 183 (5), 1367-1382 (2020).</li><li>Azad, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoluciferase+complementation-based+biosensor+reveals+the+importance+of+N-+linked+glycosylation+of+SARS-CoV-2+Spike+for+viral+entry.">Nanoluciferase complementation-based biosensor reveals the importance of N- linked glycosylation of SARS-CoV-2 Spike for viral entry.</a> Mol Ther. , 0074-0075 (2021).</li><li>Bastos, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+accuracy+of+serological+tests+for+covid-19:+systematic+review+and+meta-analysis.">Diagnostic accuracy of serological tests for covid-19: systematic review and meta-analysis.</a> BMJ. 370, 2516 (2020).</li><li>Bioluminescent Reporters | Reporter Gene Applications | An Introduction to Reporter Genes. Promega Available from: <a target="_blank" href="https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa">https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa</a> (2021)</li><li>Fleiss, A., Sarkisyan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+review+of+bioluminescent+systems.">A brief review of bioluminescent systems.</a> Current Genetics. 65 (4), 877-882 (2019).</li><li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+kinome-wide+screen+using+a+NanoLuc+LATS+luminescent+biosensor+identifies+ALK+as+a+novel+regulator+of+the+Hippo+pathway+in+tumorigenesis+and+immune+evasion.">A kinome-wide screen using a NanoLuc LATS luminescent biosensor identifies ALK as a novel regulator of the Hippo pathway in tumorigenesis and immune evasion.</a> The FASEB Journal. 33 (11), 12487-12499 (2019).</li><li>Boute, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoLuc+Luciferase+-+a+multifunctional+tool+for+high+throughput+antibody+screening.">NanoLuc Luciferase - a multifunctional tool for high throughput antibody screening.</a> Frontiers in Pharmacology. 7, 27 (2016).</li><li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+celastrol+as+a+novel+YAP-TEAD+inhibitor+for+cancer+therapy+by+high+throughput+screening+with+ultrasensitive+YAP/TAZ-TEAD+biosensors.">Identification of celastrol as a novel YAP-TEAD inhibitor for cancer therapy by high throughput screening with ultrasensitive YAP/TAZ-TEAD biosensors.</a> Cancers. 11 (10), 1596 (2019).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SARS-CoV-2+S1+NanoBiT:+A+nanoluciferase+complementation-based+biosensor+to+rapidly+probe+SARS-CoV-2+receptor+recognition.">SARS-CoV-2 S1 NanoBiT: A nanoluciferase complementation-based biosensor to rapidly probe SARS-CoV-2 receptor recognition.</a> Biosensors and Bioelectronics. 180, 113122 (2021).</li><li>Brown, E. E. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+critical+determinants+of+ACE2-SARS+CoV-2+RBD+interaction.">Characterization of critical determinants of ACE2-SARS CoV-2 RBD interaction.</a> International Journal of Molecular Sciences. 22 (5), 2268 (2021).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gain-of-functional+screen+identifies+the+Hippo+pathway+as+a+central+mediator+of+receptor+tyrosine+kinases+during+tumorigenesis.">A gain-of-functional screen identifies the Hippo pathway as a central mediator of receptor tyrosine kinases during tumorigenesis.</a> Oncogene. 39 (2), 334-355 (2020).</li><li>Schwinn, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Mediated+tagging+of+endogenous+proteins+with+a+luminescent+peptide.">CRISPR-Mediated tagging of endogenous proteins with a luminescent peptide.</a> ACS Chemical Biology. 13 (2), 467-474 (2018).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-throughput+NanoBiT-based+serological+assay+detects+SARS-CoV-2+seroconversion.">A high-throughput NanoBiT-based serological assay detects SARS-CoV-2 seroconversion.</a> Nanomaterials. 11 (3), 807 (2021).</li></ol>

The authors declare no conflict of interest.

The increasing number of people infected with the SARS-CoV-2 and the ongoing effort for global vaccination necessitates sensitive and fast serologic tests that can be used in large-scale serosurveys. Recent research shows that split nanoluciferase-based bioreporters can be used to develop such assays. We recently developed the HiBiT-RBD bioreporter to design a test that can be used to detect SARS-CoV-2-specific antibodies in patient serum in a fast and reliable fashion (Figure 4C).
There are a few critical steps in this assay. Because the system's efficiency depends on RBD protein expression, the protein levels should be validated by western blotting. Moreover, it is necessary to use a positive control, such as a commercial antibody against RBD, and a negative control antibody. Addition of a Nanoluciferase protein is recommended to be used as a positive control for bioluminescence detection. The protein product also contains a His-tag, which can be used for purification for a large number of serum samples. 
There are several advantages to using this bioreporter compared to other competing methods. First, an experienced user can perform the complete assay procedure in less than one hour, which is considerably faster than existing tests such as ELISA. Second, the minimum preparation and testing requirements make this test highly valuable for large-scale production at a low cost. Moreover, the detection limit of the assay is as low as 1 ng of the SARS-CoV-2-neutralizing antibody as described by Azad et al.22. A drawback of this approach is the inability to differentiate between different antibody isotypes. Moving forward, the sensitivity of the test should be compared to other routinely used serologic tests. 
Azad et al.22 had used serum samples from patients to evaluate the applicability of the assay. It is also essential that the system is tested for antibody detection in blood samples from patients. This tool could also be very impactful in the assessment of the correlation between the severity of COVID-19 and the presence of SARS-CoV-2-specific antibodies. Overall, such serologic tests could have a substantial impact in estimating the epidemiological impact of the SARS-CoV-2 and can be a convenient substitute for time-consuming and less sensitive detection methods.

The recent emergence of a new coronavirus, SARS-CoV21, has caused more than 2,800,000 fatalities and 128 million infections as of March 30th, 20212. Due to the lack of a reliable and well-established treatment procedure for SARS-CoV-2 clinical therapies, many endeavors have been made to restrict further viral transmission and more importantly, to develop an effective and robust treatment or a vaccine3. To date, there are more than 50 COVID-19 vaccine candidates in trials reported by the World Health Organization4. Detection of antibodies against SARS-CoV-2 is of paramount importance to determine the long-term stability of humoral response upon administration of the vaccine as well as in recovered patients of COVID-195. Some studies have demonstrated that there is a possibility that recovered SARS-CoV-2 patients lose most of the RBD-binding antibodies after 1 year5,6,7,8,9. Further investigation is required to better understand lasting immunity, and more sensitive antibody detection platforms can help further such work. Reports of sustained immunity of mild SARS-CoV-2 infections, which suggest long-term antibody responses, is also an interesting and worthwhile area of study. A fast and accurate method of detection is essential for monitoring antibodies in individuals&#39; sera to provide more information about immunity in the population.
Like other coronaviruses, SARS-CoV-2 uses protruding spike glycoprotein to bind to angiotensin-converting enzyme-2 (ACE2) to initiate a cascade of events that lead to the fusion of the viral and cell membranes6,7. Several studies have recently proved the RBD of the Spike protein to have a crucial role in eliciting powerful and specific antibody response against SARS-CoV28,9,10,11. In particular, correlations observed by Premkumar et al. between the titer of RBD-binding antibody and SARS-CoV-2 neutralization potency of patients&#39; plasma are consistent with RBD being an immunogenic compartment of the virus structure9. With that in mind, many diagnostic tests available for SARS-CoV-2 antibody detection are time and cost-intensive, require a lengthy procedure of incubation and washing (enzyme-linked immunosorbent assay [ELISA]), or lack sensitivity and accuracy (lateral flow immunoassay [LFIA])12. Therefore, a quantitative and rapid complementary serological method of COVID-19-derived antibody detection with high sensitivity, fast response, and relatively low cost would serve the need for a reliable serologic test for SARS-CoV-2 epidemiologic surveillance.
Collectively, the limitations of current serological assays prompted the investigation of the bioluminescent reporting system as a potential diagnostic agent in future serosurveys. Bioluminescence is a naturally occurring enzyme/substrate reaction, with light emission. Nanoluc luciferase is the smallest (19 kDa), yet the brightest system compared to Renilla and firefly luciferase (36 kDa and 61 kDa, respectively)13,14. Further, Nanoluc has the highest signal to noise ratio and stability among the previously mentioned systems. The high signal intensity of Nanoluc supports the detection of even very low amounts of reporter fusions15. Nanoluc Binary Technology (NanoBiT) is a split version of the Nanoluc system, which is comprised of two segments: small BiT (11 amino acids; SmBiT) and large BiT (LgBiT) with relatively low-affinity interactions (KD = 190 &#181;M ) to form a luminescent complex16. NanoBiT is extensively used in various studies involving the identification of protein-protein interactions15,17,18,19 and cellular signaling pathways11,20,21.
Recently, another small peptide with a distinctly higher affinity to LgBiT (KD = 0.7 nM ) was introduced, namely the HiBiT Nano-Glo system, in place of SmBiT. The high affinity and strong signal of the Nano-Glo &#34;add-mix-read&#34; assay makes HiBiT a suitable, quantitative, luminescent peptide tag. In this approach, the HiBiT tag is appended to the target protein by developing a construct imposing minimal structural interference. HiBiT-protein fusion would actively bind to the LgBiT counterpart, producing a highly active luciferase enzyme to generate detectable bioluminescence in the presence of detection reagents (Figure 1). Similarly, we developed a HiBiT Nano-Glo-based system to readily measure the neutralizing antibody titer in the sera of SARS-CoV-2 recovered individuals and recently developed a HiBiT-tagged SARS-CoV-2 RBD. This paper describes the protocol for producing the HiBiT-RBD bioreporter using standard laboratory procedures and equipment, and shows how this bioreporter can be used in a fast and efficient assay to detect SARS-CoV-2 RBD-targeting antibodies.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5x Passive Lysis Buffer</td>
			<td>Promega</td>
			<td>E194A</td>
			<td>30 mL</td>
		</tr>
		<tr>
			<td>Bio-Plex Handheld Magnetic Washer</td>
			<td>Bio-Rad</td>
			<td>171020100</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Sigma</td>
			<td>D6429-500ml</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td>100 mL kit</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Sigma</td>
			<td>F1051</td>
			<td></td>
		</tr>
		<tr>
			<td>HiBiT-RBD Plasmid</td>
			<td></td>
			<td></td>
			<td>gacggatcgggagatctcccgatcccctatggt
				gcactctcagtacaatctgctctgatgccgcata
				gttaagccagtatctgctccctgcttgtgtgttgg
				aggtcgctgagtagtgcgcgagcaaaattta
				agctacaacaaggcaaggcttgaccgacaa
				ttgcatgaagaatctgcttagggttaggcgttttg
				cgctgcttcgcgatgtacgggccagatatacgc
				gttgacattgattattgactagttattaatagt
				aatcaattacggggtcattagttcatagcccat
				atatggagttccgcgttacataacttacggtaa
				atggcccgcctggctgaccgcccaacgaccc
				ccgcccattgacgtcaataatgacgtatgttccc
				atagtaacgccaatagggactttccattgacgtc
				aatgggtggagtatttacggtaaactgcccact
				tggcagtacatcaagtgtatcatatgccaagta
				cgccccctattgacgtcaatgacggtaaatgg
				cccgcctggcattatgcccagtacatgaccttat
				gggactttcctacttggcagtacatctacgtat
				tagtcatcgctattaccatggtgatgcggtttt
				ggcagtacatcaatgggcgtggatagcggtttg
				actcacggggatttccaagtctccaccccattg
				acgtcaatgggagtttgttttggcaccaaaatc
				aacgggactttccaaaatgtcgtaacaactccg
				ccccattgacgcaaatgggcggtaggcgtgta
				cggtgggaggtctatataagcagagctctctgg
				ctaactagagaacccactgcttactggcttatcg
				aaattaatacgactcactatagggagacccaa
				gctggctagcgtttaaacttaagcttggtaccga
				gctcggatccgccaccATGGAGACAGA
				CACACTCCTGCTATGGGTACTGC
				TGCTCTGGGTTCCAGGTTCCAC
				TGGTGACtctggctctagcggctctggctct
				agcggcggcATGGTGAGCGGCTG
				GCGGCTGTTCAAGAAGATTAGC
				tctagcggcGACTACAAGGACC
				ACGACGGTGACTACAAGGACCA
				CGACATCGACTACAAGGACGAC
				GACGACAAGggcagcggctccggca
				gcagcggaggaggaggctctggaggagga
				ggctctagcggcggcaacatcacaaatctgtg
				cccattcggcgaggtgtttaacgccaccagat
				ttgccagcgtgtatgcctggaaccggaagaga
				atctctaattgcgtggccgactatagcgtgct
				gtacaatagcgcctccttctctacctttaagt
				gctatggcgtgtcccccacaaagctgaacgac
				ctgtgcttcaccaacgtgtacgccgactcttttgt
				gatcaggggcgatgaggtgcgccagatcgc
				acctggacagacaggcaagatcgccgactac
				aactataagctgccagacgatttcaccggct
				gcgtgatcgcctggaatagcaacaatctggatt
				ccaaagtgggcggcaactacaattatctgtac
				cggctgttcagaaagagcaacctgaagccctt
				tgagcgggatatcagcacagagatctaccag
				gcaggctccaccccttgcaacggagtggagg
				gcttcaattgttattttcccctgcagagctacggc
				ttccagcctacaaatggcgtgggctatcagcca
				tacagggtggtggtgctgtcctttgagctgctg
				cacgcacctgcaaccgtgtcctctggacacatc
				gagggccgccacatgctggagatgggccatc
				atcaccatcatcaccaccaccaccactgatag
				cggccgctcgagtctagagggcccgtttaaac
				ccgctgatcagcctcgactgtgccttctagtt
				gccagccatctgttgtttgcccctcccccgtg
				ccttccttgaccctggaaggtgccactcccac
				tgtcctttcctaataaaatgaggaaattgcat
				cgcattgtctgagtaggtgtcattctattctgggg
				ggtggggtggggcaggacagcaaggggga
				ggattgggaagacaatagcaggcatgctggg
				gatgcggtgggctctatggcttctgaggcggaa
				agaaccagctggggctctagggggtatcccca
				cgcgccctgtagcggcgcattaagcgcggcg
				ggtgtggtggttacgcgcagcgtgaccgctac
				acttgccagcgccctagcgcccgctcctttcg
				ctttcttcccttcctttctcgccacgttcgccggctt
				tccccgtcaagctctaaatcgggggctcccttta
				gggttccgatttagtgctttacggcacctcgacc
				ccaaaaaacttgattagggtgatggttcacgta
				gtgggccatcgccctgatagacggtttttcgcc
				ctttgacgttggagtccacgttctttaatagtg
				gactcttgttccaaactggaacaacactcaacc
				ctatctcggtctattcttttgatttataagggatttt
				gccgatttcggcctattggttaaaaaatgagctg
				atttaacaaaaatttaacgcgaattaattctgt
				ggaatgtgtgtcagttagggtgtggaaagtccc
				caggctccccagcaggcagaagtatgcaaag
				catgcatctcaattagtcagcaaccaggtgtgg
				aaagtccccaggctccccagcaggcagaagt
				atgcaaagcatgcatctcaattagtcagcaac
				catagtcccgcccctaactccgcccatcccgc
				ccctaactccgcccagttccgcccattctccgcc
				ccatggctgactaattttttttatttatgcagaggc
				cgaggccgcctctgcctctgagctattccagaa
				gtagtgaggaggcttttttggaggcctaggcttttg
				caaaaagctcccgggagcttgtatatccattttc
				ggatctgatcaagagacaggatgaggatcgttt
				cgcatgattgaacaagatggattgcacgcagg
				ttctccggccgcttgggtggagaggctattcggc
				tatgactgggcacaacagacaatcggctgctct
				gatgccgccgtgttccggctgtcagcgcagggg
				cgcccggttctttttgtcaagaccgacctgtccgg
				tgccctgaatgaactgcaggacgaggcagcg
				cggctatcgtggctggccacgacgggcgttcct
				tgcgcagctgtgctcgacgttgtcactgaagcg
				ggaagggactggctgctattgggcgaagtgcc
				ggggcaggatctcctgtcatctcaccttgctcctg
				ccgagaaagtatccatcatggctgatgcaatg
				cggcggctgcatacgcttgatccggctacctgc
				ccattcgaccaccaagcgaaacatcgcatcg
				agcgagcacgtactcggatggaagccggtct
				tgtcgatcaggatgatctggacgaagagcat
				caggggctcgcgccagccgaactgttcgcca
				ggctcaaggcgcgcatgcccgacggcgagg
				atctcgtcgtgacccatggcgatgcctgcttg
				ccgaatatcatggtggaaaatggccgctttt
				ctggattcatcgactgtggccggctgggtgt
				ggcggaccgctatcaggacatagcgttggct
				acccgtgatattgctgaagagcttggcggcg
				aatgggctgaccgcttcctcgtgctttacgg
				tatcgccgctcccgattcgcagcgcatcgcc
				ttctatcgccttcttgacgagttcttctgagcg
				ggactctggggttcgaaatgaccgaccaag
				cgacgcccaacctgccatcacgagatttcgat
				tccaccgccgccttctatgaaaggttgggctt
				cggaatcgttttccgggacgccggctggatga
				tcctccagcgcggggatctcatgctggagt
				tcttcgcccaccccaacttgtttattgcagctta
				taatggttacaaataaagcaatagcatcacaa
				atttcacaaataaagcatttttttcactgcatt
				ctagttgtggtttgtccaaactcatcaatgtat
				cttatcatgtctgtataccgtcgacctctagct
				agagcttggcgtaatcatggtcatagctgtttc
				ctgtgtgaaattgttatccgctcacaattccacac
				aacatacgagccggaagcataaagtgtaaag
				cctggggtgcctaatgagtgagctaactcacat
				taattgcgttgcgctcactgcccgctttccagtc
				gggaaacctgtcgtgccagctgcattaatgaa
				tcggccaacgcgcggggagaggcggtttgcg
				tattgggcgctcttccgcttcctcgctcactgactc
				gctgcgctcggtcgttcggctgcggcgagcggt
				atcagctcactcaaaggcggtaatacggttatc
				cacagaatcaggggataacgcaggaaagaa
				catgtgagcaaaaggccagcaaaaggccag
				gaaccgtaaaaaggccgcgttgctggcgtttt
				tccataggctccgcccccctgacgagcatcac
				aaaaatcgacgctcaagtcagaggtggcgaa
				acccgacaggactataaagataccaggcgtt
				tccccctggaagctccctcgtgcgctctcctgtt
				ccgaccctgccgcttaccggatacctgtccgcc
				tttctcccttcgggaagcgtggcgctttctcat
				agctcacgctgtaggtatctcagttcggtgtag
				gtcgttcgctccaagctgggctgtgtgcacgaa
				ccccccgttcagcccgaccgctgcgccttatcc
				ggtaactatcgtcttgagtccaacccggtaag
				acacgacttatcgccactggcagcagccactg
				gtaacaggattagcagagcgaggtatgtaggc
				ggtgctacagagttcttgaagtggtggcctaact
				acggctacactagaagaacagtatttggtatc
				tgcgctctgctgaagccagttaccttcggaaa
				aagagttggtagctcttgatccggcaaacaaa
				ccaccgctggtagcggtggtttttttgtttgca
				agcagcagattacgcgcagaaaaaaaggat
				ctcaagaagatcctttgatcttttctacggggt
				ctgacgctcagtggaacgaaaactcacgttaa
				gggattttggtcatgagattatcaaaaaggatct
				tcacctagatccttttaaattaaaaatgaagtt
				ttaaatcaatctaaagtatatatgagtaaactt
				ggtctgacagttaccaatgcttaatcagtgagg
				cacctatctcagcgatctgtctatttcgttcatcca
				tagttgcctgactccccgtcgtgtagataactac
				gatacgggagggcttaccatctggccccagtg
				ctgcaatgataccgcgagacccacgctcacc
				ggctccagatttatcagcaataaaccagccag
				ccggaagggccgagcgcagaagtggtcctg
				caactttatccgcctccatccagtctattaattgtt
				gccgggaagctagagtaagtagttcgccagtt
				aatagtttgcgcaacgttgttgccattgctacag
				gcatcgtggtgtcacgctcgtcgtttggtatgg
				cttcattcagctccggttcccaacgatcaaggc
				gagttacatgatcccccatgttgtgcaaaaaag
				cggttagctccttcggtcctccgatcgttgtca
				gaagtaagttggccgcagtgttatcactcatggt
				tatggcagcactgcataattctcttactgtcatg
				ccatccgtaagatgcttttctgtgactggtgagta
				ctcaaccaagtcattctgagaatagtgtatgcg
				gcgaccgagttgctcttgcccggcgtcaatacg
				ggataataccgcgccacatagcagaactttaa
				aagtgctcatcattggaaaacgttcttcggggc
				gaaaactctcaaggatcttaccgctgttgagat
				ccagttcgatgtaacccactcgtgcacccaact
				gatcttcagcatcttttactttcaccagcgtttc
				tgggtgagcaaaaacaggaaggcaaaatgc
				cgcaaaaaagggaataagggcgacacgga
				aatgttgaatactcatactcttcctttttcaat
				attattgaagcatttatcagggttattgtc
				tcatgagcggatacatatttgaatgtattt
				agaaaaataaacaaataggggttccgcgca
				catttccccgaaaagtgccacctgacgtc</td>
		</tr>
		<tr>
			<td>LgBiT</td>
			<td>Promega</td>
			<td>N3030</td>
			<td></td>
		</tr>
		<tr>
			<td>penicillin Streptomycin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Protein G Magnetic Beads</td>
			<td>Thermo Fisher Scientific</td>
			<td>88848</td>
			<td></td>
		</tr>
		<tr>
			<td>PolyJet In Vitro DNA Transfection Reagent</td>
			<td>Signagen</td>
			<td>SL100688.5</td>
			<td></td>
		</tr>
		<tr>
			<td>SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab</td>
			<td>SinoBiological</td>
			<td>40592-MM57</td>
			<td></td>
		</tr>
		<tr>
			<td>Synergy Mx Microplate Reader</td>
			<td>BioTek</td>
			<td></td>
			<td>96-well plate reader luminometer</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA</td>
			<td>Thermo Fisher Scientific</td>
			<td>2520056</td>
			<td>0.25%</td>
		</tr>
	</tbody>
</table>

detection of sars-cov-2 receptor-binding domain antibody using a hibit-based bioreporter

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The increasing number of SARS-CoV-2 infections raises the need for better antibody detection assays. Current antibody detection methods compromise sensitivity for speed or are sensitive but time-consuming. A large proportion of SARS-CoV-2-neutralizing antibodies target the receptor-binding domain (RBD), one of the primary immunogenic compartments of SARS-CoV-2. We have recently designed and developed a highly sensitive, bioluminescent-tagged RBD (NanoLuc HiBiT-RBD) to detect SARS-CoV-2 antibodies. The following text describes the procedure to produce the HiBiT-RBD complex and a fast assay to evaluate the presence of RBD-targeting antibodies using this tool. Due to the durability of the HiBiT-RBD protein product over a wide range of temperatures and the shorter experimental procedure that can be completed within 1 h, the protocol can be considered as a more efficient alternative to detect SARS-CoV-2 antibodies in patient serum samples.

The signals from both the HiBit-RBD-containing cell lysate and supernatant of the transfected cells were recorded (Figure 2) to evaluate the appropriate protein source. HiBiT-RBD and LgBit were separately used as controls, and the data showed low background compared to a strong signal when both parts were combined. Hence, HiBiT-RBD interaction with LgBiT is necessary to generate active enzyme for substrate digestion and bioluminescence activity (Figure 1).
The addition of protein G will help antibody precipitation (Figure 3). The assay was used to compare the signal from a commercial SARS-CoV-2-neutralizing antibody with a control IgG. The specific antibody signal was robust, while the control antibody had close to the luminescent background level (Figure 4A). Recombinant attenuated oncolytic vesicular stomatitis virus (VSV) with a mutation at position 51 of the M protein (&#916;51) expressing exogenous RBD was used to vaccinate mice. The serum collected from vaccinated mice produced a robust signal compared to no signal in mice injected with control VSV (Figure 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62488/62488fig01.jpg" /> 
Figure 1: LgBiT interaction with HiBiT connected to RBD. Upon interaction of the small portion of the nanoluciferase, HiBiT, with the large subunit of the enzyme, LgBiT, the active enzyme complex can produce a luminescent signal after substrate consumption. The RBD does not interfere with this process. Abbreviations: RBD = receptor-binding domain. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62488/62488fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62488/62488fig02.jpg" /> 
Figure 2: Robust reporter activity from both lysate and supernatant of transfected cells. The protein is present in both supernatant and lysate and produces a strong signal. Control groups&#39; luminescent signals were close to the background. Error bars represent Standard Deviation (SD). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62488/62488fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62488/62488fig03.jpg" /> 
Figure 3: Schematic of the HiBiT-RBD interaction with antibodies bound to protein G. The schematic depicts the antibody precipitation by protein G and interaction with HiBiT-RBD. The addition of the LgBit to the mixture will produce a robust signal when the antibody is specific for RBD. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62488/62488fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62488/62488fig04.jpg" /> 
Figure 4: HiBiT-RBD bioreporter generates strong bioluminescence with purified neutralizing antibodies, vaccinated mouse serum, and patient serum samples. (A) HiBiT-RBD interacts with RBD-specific neutralizing antibody and generates significantly high signal compared to the negligible signal for nonspecific IgG. (B) The bioreporter can detect SARS-CoV-2 antibodies in vaccinated mouse serum. Abbreviations: RBD = receptor-binding domain; IgG = immunoglobulin G; Ab = antibody; VSV = vesicular stomatitis virus; Fluc = firefly luciferase. (C) Detection of the SARS-CoV-2 antibodies in patient serum samples, reproduced from Azad et al.22. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62488/62488fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter at JoVE.com

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe ...

detection-sars-cov-2-receptor-binding-domain-antibody-using-hibit

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

3.0K Views.  Ottawa Hospital Research Institute. The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

Video: Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Methods for Quantitative Detection of Antibody-induced Complement Activation on Red Blood Cells

Antibodies against red blood cells (RBCs) can lead to complement activation resulting in an accelerated clearance via complement receptors in the liver (extravascular hemolysis) or leading to intravascular lysis of RBCs. Alloantibodies (e.g. ABO) or autoantibodies to RBC antigens (as seen in autoimmune hemolytic anemia, AIHA) leading to complement activation are potentially harmful and can be - especially when leading to intravascular lysis - fatal1. Currently, complement activation due to (auto)-antibodies on RBCs is assessed in vitro by using the Coombs test reflecting complement deposition on RBC or by a nonquantitative hemolytic assay reflecting RBC lysis1-4. However, to assess the efficacy of complement inhibitors, it is mandatory to have quantitative techniques. Here we describe two such techniques. First, an assay to detect C3 and C4 deposition on red blood cells that is induced by antibodies in patient serum is presented. For this, FACS analysis is used with fluorescently labeled anti-C3 or anti-C4 antibodies. Next, a quantitative hemolytic assay is described. In this assay, complement-mediated hemolysis induced by patient serum is measured making use of spectrophotometric&#160;detection of the released hemoglobin. Both of these assays are very reproducible and quantitative, facilitating studies of antibody-induced complement activation.

Here we describe two assays for measuring complement activation induced by antibodies against red blood cells. The major advantage over the current assays is their quantitative and easy-to-interpret nature.

Antibodies against red blood cells (RBCs) can lead to complement activation resulting in an accelerated clearance via complement receptors in the liver ...

Antibody Labeling with Fluorescent Dyes Using Magnetic Protein A and Protein G Beads

Antibodies labeled with small molecules like fluorescent dyes, cytotoxic drugs, and radioactive tracers are essential tools in biomedical research, immunodiagnostics and more recently as therapeutic agents. Traditional methods for labeling antibodies with small molecules require purified antibodies at relatively high concentration, involve multiple dialysis steps and have limited throughput. However, several applications, including the field of Antibody Drug Conjugates (ADCs), will benefit from new methods that will allow labeling of antibodies directly from cell media. Such methods may allow antibodies to be screened in biologically relevant assays, for example, the receptor-mediated antibody internalization assay in the case of ADCs. Here, we describe a method (on-bead method) that enables labeling of small amounts of antibodies directly from cell media. This approach utilizes high capacity magnetic Protein A and Protein G affinity beads to capture antibodies from the cell media followed by labeling with small molecules using either amine or thiol chemistry and subsequent elution of the labeled antibodies. Taking fluorescent dyes as surrogates for small molecules, we demonstrate the on-bead labeling of three different mouse antibodies directly from cell media using both amine and thiol labeling chemistry. The high binding affinity of antibodies to Protein A and Protein G ensures high recoveries as well as high purity of the labeled antibodies. In addition, use of magnetic beads allows multiple samples to be handled manually, thereby significantly improving labeling throughput.

The on-bead method for labeling antibodies with small molecules enables labeling of a small amount of antibodies directly from cell media. This method is compatible with amine and thiol chemistry, and can handle multiple samples in parallel, manually or using automated platforms.

Antibodies labeled with small molecules like fluorescent dyes, cytotoxic drugs, and radioactive tracers are essential tools in biomedical research, ...

Ultrasensitive Detection of Biomarkers by Using a Molecular Imprinting Based Capacitive Biosensor

The ability to detect and quantitate biomolecules in complex solutions has always been highly sought-after within natural science; being used for the detection of biomarkers, contaminants, and other molecules of interest. A commonly used technique for this purpose is the Enzyme-linked Immunosorbent Assay (ELISA), where often one antibody is directed towards a specific target molecule, and a second labeled antibody is used for the detection of the primary antibody, allowing for the absolute quantification of the biomolecule under study. However, the usage of antibodies as recognition elements limits the robustness of the method; as does the need of using labeled molecules. To overcome these limitations, molecular imprinting has been implemented, creating artificial recognition sites complementary to the template molecule, and obsoleting the necessity of using antibodies for initial binding. Further, for even higher sensitivity, the secondary labeled antibody can be replaced by biosensors relying on the capacitance for the quantification of the target molecule. In this protocol, we describe a method to rapidly and label-free detect and quantitate low-abundant biomolecules (proteins and viruses) in complex samples, with a sensitivity that is significantly better than commonly used detection systems such as the ELISA. This is all mediated by molecular imprinting in combination with a capacitance biosensor.

Here, we present a protocol for the detection and quantification of low abundant molecules in complex solutions using molecular imprinting in combination with a capacitance biosensor.

The ability to detect and quantitate biomolecules in complex solutions has always been highly sought-after within natural science; being used for the ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Visualization of SARS-CoV-2 using Immuno RNA-Fluorescence In Situ Hybridization

This manuscript provides a protocol for in situ hybridization chain reaction (HCR) coupled with immunofluorescence to visualize severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA in cell line&#160;and three-dimensional (3D) cultures of human airway epithelium. The method allows highly specific and sensitive visualization of viral RNA by relying on HCR initiated by probe localization. Split-initiator probes help amplify the signal by fluorescently labeled amplifiers, resulting in negligible background fluorescence in confocal microscopy. Labeling amplifiers with different fluorescent dyes facilitates the simultaneous recognition of various targets. This, in turn, allows the mapping of the infection in tissues to better understand viral pathogenesis and replication at the single-cell level. Coupling this method with immunofluorescence may facilitate better understanding of host-virus interactions, including alternation of the host epigenome and immune response pathways. Owing to sensitive and specific HCR technology, this protocol can also be used as a diagnostic tool. It is also important to remember that the technique may be modified easily to enable detection of any RNA, including non-coding RNAs and RNA viruses that may emerge in the future.

Here, we describe a simple method that combines RNA fluorescence in situ&#160;hybridization (RNA-FISH) with immunofluorescence to visualize severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA. This protocol may increase understanding of the molecular characteristics of SARS-CoV-2 RNA-host interactions at a single-cell level.

This manuscript provides a protocol for in situ hybridization chain reaction (HCR) coupled with immunofluorescence to visualize severe acute respiratory ...

Detection of SARS-CoV-2 Neutralizing Antibodies using High-Throughput Fluorescent Imaging of Pseudovirus Infection

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the presence of neutralizing antibodies against the virus may provide protection against future infection. Thus, as the creation and translation of effective COVID-19 vaccines continues at an unprecedented speed, the development of fast and effective methods to measure neutralizing antibodies against SARS-CoV-2 will become increasingly important to determine long-term protection against infection for both previously infected and immunized individuals. This paper describes a high-throughput protocol using vesicular stomatitis virus (VSV) pseudotyped with the SARS-CoV-2 spike protein to measure the presence of neutralizing antibodies in convalescent serum from patients who have recently recovered from COVID-19. The use of a replicating pseudotyped virus eliminates the necessity for a containment level 3 facility required for SARS-CoV-2 handling, making this protocol accessible to virtually any containment level 2 lab. The use of a 96-well format allows for many samples to be run at the same time with a short turnaround time of 24 h.

The protocol described here outlines a fast and effective method for measuring neutralizing antibodies against the SARS-CoV-2 spike protein by evaluating the ability of convalescent serum samples to inhibit infection by an enhanced green fluorescent protein-labeled vesicular stomatitis virus pseudotyped with spike glycoprotein.

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the ...

A Rapid, Multiplex Dual Reporter IgG and IgM SARS-CoV-2 Neutralization Assay for a Multiplexed Bead-Based Flow Analysis System

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel pathogens, such as SARS-CoV-2. Multiplex serological testing can be particularly useful because it can simultaneously analyze antibodies to multiple antigens that optimizes pathogen coverage, and controls for variability in the organism and the individual host response. Here we describe a SARS-CoV-2 IgG 3-plex fluorescent microsphere-based assay that can detect both IgM and IgG antibodies to three major SARS-CoV-2 antigens-the spike (S) protein, spike angiotensin-converting enzyme-2 (ACE2) receptor-binding domain (RBD), and nucleocapsid (Nc). The assay was shown to have comparable performance to a SARS-CoV-2 reference assay for IgG in serum obtained at &#8805;21 days from symptom onset but had higher sensitivity with samples collected at &#8804;5 days from symptom onset. Further, using soluble ACE2 in a neutralization assay format, inhibition of antibody binding was demonstrated for S and RBD.

A flow analysis system for bead-based multiplexed assays which provides a two-reporter readout was used for the development of multiplex serological and antibody neutralization assays that can simultaneously measure neutralizing IgG and IgM antibodies for SARS-CoV-2.

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel ...

Live Imaging and Quantification of Viral Infection in K18 hACE2 Transgenic Mice Using Reporter-Expressing Recombinant SARS-CoV-2

The coronavirus disease 2019 (COVID-19) pandemic has been caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To date, SARS-CoV-2 has been responsible for over 242 million infections and more than 4.9 million deaths worldwide. Similar to other viruses, studying SARS-CoV-2 requires the use of experimental methods to detect the presence of virus in infected cells and/or in animal models. To overcome this limitation, we generated replication-competent recombinant (r)SARS-CoV-2 that expresses bioluminescent (nanoluciferase, Nluc) or fluorescent (Venus) proteins. These reporter-expressing rSARS-CoV-2 allow tracking viral infections in vitro and in vivo based on the expression of Nluc and Venus reporter genes. Here the study describes the use of rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus to detect and track SARS-CoV-2 infection in the previously described K18 human angiotensin-converting enzyme 2 (hACE2) transgenic mouse model of infection using in vivo imaging systems (IVIS). This rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus show rSARS-CoV-2/WT-like pathogenicity and viral replication in vivo. Importantly, Nluc and Venus expression allow us to directly track viral infections in vivo and ex vivo, in infected mice. These rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus represent an excellent option to study the biology of SARS-CoV-2 in vivo, to understand viral infection and associated COVID-19 disease, and to identify effective prophylactic and/or therapeutic treatments to combat SARS-CoV-2 infection.

This protocol describes the dynamics of viral infections using luciferase- and fluorescence-expressing recombinant (r)SARS-CoV-2 and an in vivo imaging systems (IVIS) in K18 hACE2 transgenic mice to overcome the need of secondary approaches required to study SARS-CoV-2 infections in vivo.

The coronavirus disease 2019 (COVID-19) pandemic has been caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To date, SARS-CoV-2 has ...

Efficient SARS-CoV-2 Quantitative Reverse Transcriptase PCR Saliva Diagnostic Strategy utilizing Open-Source Pipetting Robots

The emergence of the recent SARS-CoV-2 global health crisis introduced key challenges for epidemiological research and clinical testing. Characterized by a high rate of transmission and low mortality, the COVID-19 pandemic necessitated accurate and efficient diagnostic testing, particularly in closed populations such as residential universities. Initial availability of nucleic acid testing, like nasopharyngeal swabs, was limited due to supply chain pressure which also delayed reporting of test results. Saliva-based reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) testing has shown to be comparable in sensitivity and specificity to other testing methods, and saliva collection is less physically invasive to participants. Consequently, we developed a multiplex RT-qPCR diagnostic assay for population surveillance of Clemson University and the surrounding community. The assay utilized open-source liquid handling robots and thermocyclers instead of complex clinical automation systems to optimize workflow and system flexibility. Automation of saliva-based RT-qPCR enables rapid and accurate detection of a wide range of viral RNA concentrations for both large- and small-scale testing demands. The average turnaround for the automated system was &#60; 9 h for 95% of samples and &#60; 24 h for 99% of samples. The cost for a single test was $2.80 when all reagents were purchased in bulk quantities.

The protocol describes a SARS-CoV-2 diagnostic method that utilizes open-source automation to perform RT-qPCR molecular testing of saliva samples. This scalable approach can be applied to clinical public health surveillance as well as to increase the capacity of smaller university laboratories.

The emergence of the recent SARS-CoV-2 global health crisis introduced key challenges for epidemiological research and clinical testing. Characterized by ...

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Detection of Bacteria Using Fluorogenic DNAzymes

Methods for Quantitative Detection of Antibody-induced Complement Activation on Red Blood Cells

Antibody Labeling with Fluorescent Dyes Using Magnetic Protein A and Protein G Beads

Ultrasensitive Detection of Biomarkers by Using a Molecular Imprinting Based Capacitive Biosensor

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Visualization of SARS-CoV-2 using Immuno RNA-Fluorescence In Situ Hybridization

Detection of SARS-CoV-2 Neutralizing Antibodies using High-Throughput Fluorescent Imaging of Pseudovirus Infection

A Rapid, Multiplex Dual Reporter IgG and IgM SARS-CoV-2 Neutralization Assay for a Multiplexed Bead-Based Flow Analysis System

Live Imaging and Quantification of Viral Infection in K18 hACE2 Transgenic Mice Using Reporter-Expressing Recombinant SARS-CoV-2

Efficient SARS-CoV-2 Quantitative Reverse Transcriptase PCR Saliva Diagnostic Strategy utilizing Open-Source Pipetting Robots