We thank Shelby Andersen, Abby McCullough, and Laurel Woods for their assistance with these techniques. This study was funded by startup funds from the University of Iowa Department of Microbiology and Immunology to Mary M. Weber.

1. Preparation of media and reagents
NOTE: Plates should be prepared before the day of the assay and are good for 1 month. Media and reagents can be made at any point and are good for 1 month.
<ol>
	<li>Prepare 1 L of the glucose solution (10% w/v) by dissolving 100 g of D-(+)-glucose in 800 mL of distilled water in a 1, 000 mL beaker. Adjust the volume to 1 L with distilled water. Filter through a 0.2 &#181;m sterile filter into a sterile 1 L media storage bottle.</li>
	<li>Prepare 1 L of the galactose solution (10% w/v) by dissolving 100 g of D-(+)- galactose in 800 mL of distilled water in a 1 L beaker. Adjust the volume to 1 mL using distilled water and filter through a 0.2 &#181;m sterile filter into a sterile 1,000 mL media storage bottle.</li>
	<li>Prepare 1 L of yeast extract peptone dextrose (YPD) agar by dissolving 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar in 1,000 mL of distilled water. Autoclave for 20 min and cool in 56 &#730;C water bath until cooled. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare 1 L of YPD broth by dissolving 10 g of yeast extract, 20 g of peptone, and 20 g of glucose in 1,000 mL of distilled water. Autoclave for 20 min.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) glucose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Mix well by gently swirling or place on stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or place on the stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids and 1.9 g of dropout supplement without uracil in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 ml of the glucose solution prepared in step 1.1.</li>
	<li>Prepare the synthetic dropout (SD) uracil (Ura-) leucine (Leu-) glucose agar. For 1 L, dissolve 6.7 g of the yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare synthetic dropout (SD) uracil (Ura-) leucine (Leu-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 &#730;C water bath until the temperature is ~50&#8722;60 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or placing on a stir plate. Pour into 100 mm plates using ~20 mL of media per plate.</li>
	<li>Prepare synthetic dropout (SD) uracil (Ura-) leucine (Leu-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, tryptophan; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56&#8722;60 &#730;C water bath until the temperature is ~50 &#730;C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1.</li>
	<li>Prepare polyethylene glycol (PEG) solution. Add 50% w/v of polyethylene glycol 3350 in distilled water. Sterilize by autoclaving.</li>
	<li>Prepare 1 M lithium acetate (LiAc) by dissolving 10.2 g of lithium acetate dehydrate in 200 mL of distilled water. Sterilize by autoclaving.</li>
	<li>Prepare herring sperm DNA. Dilute 10 mg/mL herring sperm DNA to 2 mg/mL using distilled water. Heat at 100 &#730;C for 5 min and immediately place on ice for 5 min.</li>
</ol>
2. Cloning the gene of interest into the yeast toxicity plasmid pYesNTA-Kan
NOTE: Currently, there are a variety yeast toxicity vectors available both commercially and academically. The yeast suppressor screen can be used in conjunction with many of these vectors provided the plasmid expressing the effector protein of interest uses a dropout selection other than uracil and an antibiotic marker other than BlaR. This work used a modified pYesNTA vector4,5 that includes a kanamycin resistance cassette for easier screening for potential suppressors. The cloning scheme must allow for the effector protein to be in-frame with the Gal promoter and His-Tag. The Chlamydia trachomatis inclusion membrane protein CT229 was used as a proof of principle for these assays.
<ol>
	<li>Use PCR to amplify CT229 from C. trachomatis genomic DNA following the manufacturer&#39;s instructions using CT229 +1 Kpn F (CCGGTACCAATGAGCTGTTCTAATGTTAATTCAGGT) and CT229 XhoI R (CCCTCGAGTTTTTTACGACGGGATGCC) primers. Use the following PCR conditions: (1) 98 &#176;C for 30 s; (2) 98 &#176;C for 10 s, 55 &#176;C for 30 s, 72 &#176;C for 2 min; (3) repeat step 2 for a total of 25x; (4) 72 &#176;C for 10 min; and (5) 4 &#176;C hold.</li>
	<li>Analyze 5 &#181;L of the PCR product on a 1% agarose gel (Figure 1).</li>
	<li>Purify the remaining 45 &#181;L of DNA using a PCR purification kit following the manufacturer&#39;s instructions.</li>
	<li>Digest the 50 &#181;L of purified PCR insert and pYesNTA-Kan (Figure 2) for 1 h at 37 &#176;C in a water bath using KpnI-HF and XhoI-HF. 
	NOTE: For pYesNTA-Kan, digest 5 &#181;g of plasmid using 5 &#181;L of KpnI-HF, 5 &#181;l of XhoI-HF, and 6 &#181;L of buffer in a total volume of 60 &#181;L. For the insert, digest the entire 50 &#181;L of purified PCR product using 2 &#181;L of KpnI-HF, 2 &#181;L of XhoI-HF, and 6 &#181;L of buffer.</li>
	<li>Run the entire plasmid digest on a 1% agarose gel. Perform purification of the digested plasmid using a gel extraction kit following the manufacturer&#39;s instructions.</li>
	<li>Purify the digested PCR insert using a PCR purification kit following the manufacturer&#39;s instructions.</li>
	<li>Clone the insert into pYesNTA-Kan using 2 &#181;L of pYesNTA-Kan (step 2.5), 2 &#181;L of DNA ligase buffer, 1 &#181;L of T4 ligase, and 15 &#181;L of insert (step 2.6). Incubate at room temperature for 1 h.</li>
	<li>Add the entire cloning reaction to 50 &#181;L of E. coli competent cells and perform the transformation reaction.</li>
	<li>Plate the entire transformation reaction on an LB plate containing 100 &#181;g/mL of carbenicillin.</li>
	<li>Inoculate 10 mL of the LB containing 100 &#181;g/mL of carbenicillin with three individual colonies. Incubate overnight at 37 &#730;C with shaking at 150 rpm.</li>
	<li>Isolate the plasmid using a plasmid miniprep kit following the manufacturer&#39;s instructions.</li>
	<li>Sequence the isolated plasmids using gene-specific primers (step 2.1).</li>
</ol>
3. Test the protein of interest for toxicity in yeast
<ol>
	<li>Streak Saccharomyces cerevisiae W303 on YPD agar (step 1.3) to obtain isolated colonies. Incubate at 30 &#176;C for 24 h.</li>
	<li>Inoculate 10 mL of YPD broth (step 1.4) with a single colony from the agar plate (step 3.1). Incubate at 30 &#176;C with shaking at 150 rpm overnight.</li>
	<li>Add 0.5 mL of the overnight culture to 10 mL of YPD broth (step 1.4) and incubate at 30 &#176;C with shaking at 150 rpm for 4 h.
	<ol>
		<li>Pellet the 10 mL of culture at 3,000 x g for 10 min at 4 &#176;C.</li>
		<li>Resuspend the pellet in 1 mL of sterile water, transfer to the microcentrifuge tube, and pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Resuspend the pellet in 1 mL of 1 mM lithium acetate (LiAc) and pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Repeat the LiAc wash 2x.</li>
		<li>Remove the wash. Resuspend the pellet in 2.4 mL of 50% PEG 3350. Add 360 &#181;L of 1M LiAc, 500 &#181;L of 2 mg/mL of herring sperm DNA, and 400 &#181;L of sterile water. 
		NOTE: This is sufficient for 20 transformations.</li>
		<li>Add 180 &#181;L of the transformation mix from step 3.3.5 to a microcentrifuge tube containing 5 &#181;L of pYesNTA-Kan CT229 plasmid DNA (100&#8722;500 ng) from step 2.12.</li>
		<li>Incubate in a water bath at 30 &#176;C for 30 min.</li>
		<li>Incubate in a water bath at 42 &#176;C for 30 min.</li>
		<li>Pellet at 3,000 x g for 1 min at room temperature.</li>
		<li>Remove the transformation mix with the pipette. Resuspend the pellet in 100 &#181;L of sterile water. Plate the transformation on SD Ura- agar with glucose (step 1.5).</li>
		<li>Incubate plates at 30 &#730;C for 48 h.</li>
	</ol>
	</li>
	<li>Inoculate 5 mL of SD Ura- broth containing glucose (step 1.7) with a single colony from the plate. Incubate overnight at 30 &#176;C with shaking at 150 rpm. Include yeast transformed with the vector alone as a negative control.
	<ol>
		<li>Add 180 &#181;L of sterile water to 5 wells of a 96 well plate (A2&#8722;A6).</li>
		<li>Vortex the overnight culture to mix.</li>
		<li>Add 180 &#181;L of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).</li>
		<li>Using a multichannel pipette, spot 5 &#181;L of each dilution on SD Ura- glucose (step 1.5) and Ura- galactose (step 1.6) agar plates. Incubate at 30 &#176;C for 48 h.</li>
	</ol>
	</li>
	<li>Assess the toxicity by comparing the growth of the yeast expressing the effector protein of interest grown on the galactose-containing media to the growth of yeast expressing the vector alone.</li>
	<li>Confirm the expression of the His-tag fusion protein by Western blotting.</li>
</ol>
4. Transform toxic yeast with the yeast genomic library
<ol>
	<li>Inoculate 100 mL of SD Ura- glucose broth (step 1.7) using 1 mL of the stock from step 3.4. Incubate for 16&#8722;24 h at 30 &#176;C with shaking at 150 rpm. Place 900 mL of SD Ura- glucose broth at 30 &#176;C overnight to prewarm the media.</li>
	<li>Add the entire 100 mL of the overnight culture to the prewarmed 1 L flask. Incubate for 4&#8722;5 h at 30 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Pellet the culture at 6,000 x g for 10 min at 4 &#176;C.</li>
		<li>Discard the supernatant. Resuspend the pellet in 250 mL of sterile water. Pellet the culture at 6,000 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant. Resuspend the pellet in 250 mL of 1 mM LiAc. Pellet the culture at 6,000 x g for 5 min at 4 &#176;C.</li>
		<li>Remove LiAc and resuspend the pellet in 9.6 mL of 50% PEG 3350. Add 1.44 mL of 1M LiAc, 2 mL of 2 mg/mL herring sperm DNA, 50 &#181;g of the pYep13 genomic library (ATCC 37323). Adjust the volume to 15 mL with sterile water. Mix gently by inversion.</li>
		<li>Incubate in a water bath at 30 &#176;C for 30 min.</li>
		<li>Add 750 &#181;L of dimethyl sulfoxide (DMSO) to enhance the transformation efficiency. Incubate in a water bath at 42 &#176;C for 30 min. Mix by gentle inversion every 10 min.</li>
		<li>Pellet the yeast at 3,000 x g for 5 min at room temperature.</li>
		<li>Discard the supernatant and resuspend the pellet in 10 mL of sterile water. Pellet at 3,000 x g for 5 min at room temperature.</li>
		<li>Resuspend the pellet in 8 mL of sterile water.</li>
		<li>To determine the transformation efficiency, dilute 1:10 and plate 100 &#181;L of each dilution on SD Ura- Leu- glucose agar (step 1.8).</li>
		<li>Plate 200 &#181;L of the sample on SD Ura- Leu- galactose agar (step 1.9) plates. Use 50 plates in total.</li>
		<li>Incubate at 30 &#176;C for 48&#8722;96 h or until colonies appear. 
		NOTE: Colonies generally appear on glucose agar plates at 48&#8722;72 h and galactose agar plates at 72&#8722;96 h.</li>
	</ol>
	</li>
	<li>Patch colonies (potential rescues) on SD Ura- Leu- galactose agar (step 1.9) to expand and make stock. Incubate at 30 &#176;C for 24&#8722;48h.</li>
	<li>Inoculate 5 mL of SD Ura- Leu- glucose broth (step 1.10) using the part of the patch. Incubate overnight at 26 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Add 180 &#181;L of the sterile water to 5 wells of a 96 well plate (A2&#8722;A6).</li>
		<li>Vortex the overnight culture to mix.</li>
		<li>Add 180 &#181;L of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).</li>
		<li>Using a multichannel pipette, spot 5 &#181;L of each dilution on SD Ura- glucose and SD Ura- galactose agar plates. Include toxic effector alone as a control.</li>
		<li>Incubate at 30 &#176;C for 48 h.</li>
	</ol>
	</li>
	<li>Compare the growth of the yeast expressing the toxic effector alone to yeast containing the potential suppressors. Only proceed with potential suppressors that have diminished toxicity compared to the yeast expressing the effector alone.</li>
</ol>
5. Identify and confirm suppressors
<ol>
	<li>Inoculate 5 mL of SD Ura- Leu- glucose broth (step 1.10) with 100 &#181;L of yeast from step 4.4 and incubate overnight at 30 &#176;C with shaking at 150 rpm.
	<ol>
		<li>Pellet the yeast at 3,000 x g for 2 min at room temperature. Gently discard the supernatant using a pipette.</li>
		<li>Isolate the plasmid with a yeast plasmid miniprep kit following the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Transform the isolated plasmid into the E. coli competent cells and plate the entire transformation on LB agar with 100 &#181;g/mL of carbenicillin. Incubate at 37 &#176;C for 24 h.</li>
	<li>Inoculate 10 mL of LB broth containing 100 &#181;g/mL of carbenicillin, with three colonies from the plate and incubate at 37 &#176;C overnight with shaking at 150 rpm.
	<ol>
		<li>Pellet cultures at 3,000 x g for 10 min at room temperature. Isolate plasmid using a miniprep kit following the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Retransform the toxic yeast with the isolated plasmids from step 5.3.1 following the steps in part 3 of the protocol.
	<ol>
		<li>Inoculate 5 mL of SD Ura- Leu- glucose broth with a colony from the transformation plate. Incubate overnight at 30 &#176;C with shaking at 150 rpm.</li>
		<li>Spot on Ura- Leu- glucose and galactose agar to confirm suppression of toxicity.</li>
	</ol>
	</li>
	<li>Sequence using pYep13 F (ACTACGCGATCATGGCGA) and pYep13 R (TGATGCCGGCCACGATGC) primers to identify yeast ORFs. </li>
</ol>

<ol>
	<li>Tan, Y., Luo, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Legionella+pneumophila+SidD+is+a+deAMPylase+that+modifies+Rab1.">Legionella pneumophila SidD is a deAMPylase that modifies Rab1.</a> Nature. 475 (7357), 506-509 (2011).</li><li>Guo, Z., Stephenson, R., Qiu, J., Zheng, S., Luo, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Legionella+effector+modulates+host+cytoskeletal+structure+by+inhibiting+actin+polymerization.">A Legionella effector modulates host cytoskeletal structure by inhibiting actin polymerization.</a> Microbes and Infection. 16 (3), 225-236 (2014).</li><li>Tan, Y., Arnold, R. J., Luo, Z. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Legionella+pneumophila+regulates+the+small+GTPase+Rab1+activity+by+reversible+phosphorylcholination.">Legionella pneumophila regulates the small GTPase Rab1 activity by reversible phosphorylcholination.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (52), 21212-21217 (2011).</li><li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+type+IV+secreted+effector+protein+CirA+stimulates+the+GTPase+activity+of+RhoA+and+is+required+for+virulence+in+a+mouse+model+of+Coxiella+burnetii+infection.">The type IV secreted effector protein CirA stimulates the GTPase activity of RhoA and is required for virulence in a mouse model of Coxiella burnetii infection.</a> Infection and Immunity. 84, (2016).</li><li>Faris, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chlamydia+trachomatis+CT229+subverts+Rab+GTPase-dependent+CCV+trafficking+pathways+to+promote+chlamydial+infection.">Chlamydia trachomatis CT229 subverts Rab GTPase-dependent CCV trafficking pathways to promote chlamydial infection.</a> Cell Reports. 26, 3380-3390 (2019).</li><li>Mumberg, D., M&#252;ller, R., Funk, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+vectors+for+the+controlled+expression+of+heterologous+proteins+in+different+genetic+backgrounds.">Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds.</a> Gene. 156, 119 (1995).</li><li>Hill, J., Donald, K. A. G., Griffiths, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO-enhanced+whole+cell+yeast+transformation.">DMSO-enhanced whole cell yeast transformation.</a> Nucleic Acids Research. 19 (20), 41070 (1991).</li><li>Kramer, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+Functional+Genomic+Screens+Lead+to+Identification+of+a+Role+for+a+Bacterial+Effector+in+Innate+Immunity+Regulation.">Yeast Functional Genomic Screens Lead to Identification of a Role for a Bacterial Effector in Innate Immunity Regulation.</a> PLoS Pathogens. 3 (2), 21 (2007).</li><li>H&#228;user, R. T. S., Rajagopala, S. V., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Yeast+Two-Hybrid+Screens:+A+Practical+Guide.">Array-Based Yeast Two-Hybrid Screens: A Practical Guide.</a> Two Hybrid Technologies: Methods and Protocols, Methods in Molecular Biology. , 21-38 (2012).</li><li>Mirrashidi, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+inc-human+interactome+reveals+that+retromer+restricts+chlamydia+infection.">Global mapping of the inc-human interactome reveals that retromer restricts chlamydia infection.</a> Cell Host and Microbe. 18 (1), 109-121 (2015).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+transformation+system+for+chlamydia+trachomatis:+Restoration+of+glycogen+biosynthesis+by+acquisition+of+a+plasmid+shuttle+vector.">Development of a transformation system for chlamydia trachomatis: Restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector.</a> PLoS Pathogens. 7 (9), 1002258 (2011).</li><li>Mueller, K. E., Wolf, K., Fields, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+deletion+by+fluorescence-reported+allelic+exchange+mutagenesis+in+Chlamydia+trachomatis.">Gene deletion by fluorescence-reported allelic exchange mutagenesis in Chlamydia trachomatis.</a> mBio. 7 (1), 1-9 (2016).</li><li>Johnson, C. M., Specific Fisher, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-Specific,+Insertional+Inactivation+of+incA+in+Chlamydia+trachomatis+Using+a+Group+II+Intron.">Site-Specific, Insertional Inactivation of incA in Chlamydia trachomatis Using a Group II Intron.</a> PLoS ONE. 8 (12), 83989 (2013).</li><li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+specific+Chlamydia+trachomatis+inclusion+membrane+proteins+triggers+premature+inclusion+membrane+lysis+and+host+cell+death.">Absence of specific Chlamydia trachomatis inclusion membrane proteins triggers premature inclusion membrane lysis and host cell death.</a> Cell Reports. 19 (7), 1406-1417 (2017).</li><li>Weber, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+core+of+IncA+is+required+for+Chlamydia+trachomatis+inclusion+fusion.">A functional core of IncA is required for Chlamydia trachomatis inclusion fusion.</a> Journal of Bacteriology. 198 (8), 1347-1355 (2016).</li></ol>

The authors declare that they have no competing financial interests.

This protocol outlines step-by-step procedures for identifying host biological pathways targeted by bacterial effector proteins using a modified yeast toxicity and suppressor screen. The yeast strain used, S. cerevisiae W303, is auxotrophic for both uracil and leucine. Uracil auxotrophy of the strain is used to select yeast carrying the protein of interest on the pYesNTA-Kan vector while leucine auxotrophy is used to select for the yeast genomic library vector pYep13. The yeast genomic library plasmids carry 3&#8722;13 ORFs, so each ORF should be individually cloned into the p415-ADH vector6 or a similar vector and retransformed into the toxic yeast to identify which is the true suppressor. It is typical to identify several suppressors representing a host biological pathway. Suppressors can sometimes be direct binding partners of the bacterial protein of interest, but not always.&#160;
Generating yeast clones carrying the bacterial protein of interest on pYesNTA-Kan is the first major step and great care should be taken to preserve the integrity of these clones as soon as possible because there is strong negative selection for yeast carrying toxic proteins, even without intentional galactose induction, and they may lose the plasmid. Occasionally there is plasmid loss even when the yeast is maintained under selection on dropout media. A method has been previously reported to decrease the occurrence of plasmid loss by linearizing the vector and integrating it within the yeast genome1.
A major drawback of these techniques is that the suppressor screen only yields meaningful data if overexpression of the bacterial effector protein triggers an observable and consistent growth defect in yeast. The primary difficulty in this method is when no suppressors are identified. It is hard to determine whether a failure to identify suppressors is due to biological reasons or technical issues. From a biological perspective, there could be several causes: the protein of interest could be so toxic that proteins from the genomic library are not able to significantly suppress toxicity, the targeted pathway may be incapable of rescue, or numerous co-expressed factors may be required to overcome the toxic effect. Approaching the biological explanation is challenging, as there are many undefined variables to dissect. Because there is an established protocol, exploring technical explanations is a much more tractable approach. From a technical standpoint, a failure to identify suppressors is likely the result of low transformation efficiency of the yeast genomic library. This protocol uses the ATCC S. cerevisiae AB320 partially digested genomic library in pYEp13. Other libraries may be sufficient as well as other vectors, but this protocol specifically uses the ATCC library and there are no studies currently published that report alternate library or vector sources. It is strongly recommended that coverage of the yeast genome should be at least 10x, or underrepresentation may hinder the identification of suppressors. Decreased transformation efficiency can bring these numbers under 1x. Thus, parts of the yeast genome may not be represented in the suppressor screen. Low transformation efficiency can be due to many issues, including bad reagents or poor library preparation. This method largely adheres to the DMSO/LiAc transformation method first put forth by Hill et al.7. It is recommended that new DMSO, 50% PEG, and fresh herring sperm DNA are purchased and prepared for the transformations and used exclusively for these assays to decrease contamination or degradation of the quality of the reagents. DMSO is highly hygroscopic and absorbs water from the atmosphere readily. Therefore, making many individual use aliquots is recommended to avoid repeated opening of a container&#39;s lid and exposure to the atmosphere. High quality herring sperm DNA can be stored at -20 &#176;C and remains fit for use for several years, although a fresh preparation should be prepared from the stock for each transformation. Once boiled and cooled, the herring sperm DNA should not be reboiled or reused, so it is best to only remove what is needed and avoid making more than is necessary for the current transformation. Attention to detail can greatly improve the transformation efficiency of yeast and improve the chances of identifying a suppressor.
Considering that the yeast pYep13 vector carries 3&#8722;13 different yeast ORFs, reducing the number of false-positive plasmids is paramount to identifying suppressors. Yeast can take up and harbor multiple copies of similar vectors, whereas the general wisdom associated with plasmid incompatibility traditionally dictates that E. coli only maintains one type of plasmid with the same origin of replication (ORI) at a time, although this is not always the case. This can become a major issue when attempting to identify suppressor candidates. If suppressor yeast clones are identified, the plasmids will be extracted and retransformed into E. coli for propagation and subsequent sequencing for identification. Once the candidate suppressor plasmid has been isolated and retransformed into E. coli, it is strongly recommended that at least five E. coli colonies are picked for sequencing, because it is possible that individual clones may be carrying different plasmids. Since E. coli should only be able to propagate one plasmid at a time, if the yeast isolation yields multiple plasmids, different E. coli clones on the plate should carry only one of them at a time. Therefore picking five colonies based on normal transformation efficiency in E. coli should show whether the clones are carrying the same or different plasmids. If multiple plasmids arise subsequent to sequencing of the plasmids from E. coli, then each one should be transformed into the toxic yeast clone and assessed for rescue of the growth defect. Furthermore, even if only a single suppressor plasmid is identified, for rigor and reproducibility retransformation of the plasmid into the toxic clone is encouraged.
The yeast suppressor assay is a very large experiment and appropriate time and materials should be planned accordingly. This protocol contains many details that must be adhered to strictly and it is recommended that the researcher conducting these assays carefully read and watch the protocol in full prior to starting an assay. This is a multipartite procedure including both bacteria and yeast that need to be cultivated at different temperatures. Isolation of plasmids from yeast can sometimes be difficult due to their tough cell wall and the use of DMSO helps achieve higher transformation efficiency.
One of the largest advantages of the yeast toxicity and suppressor screen is that the bacterial effector does not need to physically bind to the host substrates for any appreciable amount of time to detect the putative pathway targeted. Only a small handful of studies have reported using this or a similar technique1&#8211;5. However, there are reports of techniques that identify host pathways and many techniques to screen for binding partners of bacterial effector proteins. Kramer et al. reported a novel systems biology approach to identify pathways targeted by bacterial effector proteins8. The technique used a haploid deletion strain collection of S. cerevisiae to screen for mutants sensitive to the Shigella effector Osp4. Using this technique, Osp4 was linked to regulation of MAPK signaling and attenuation of innate immunity in host cells. Array-based, high-throughput, automated yeast-two hybrid screens can now rapidly identify putative bacterial effector binding partners by screening many at the same time against millions of host proteins9. Similarly, high-throughput immunoprecipitations coupled with mass spectrometry are being used to mass identify putative binding partners of entire families of bacterial effector proteins10. While many of these studies can accelerate the timetable of effector protein characterization, they rarely provide insight as to what physiological processes are being manipulated and what the holistic outcome of these interactions are. Thus, techniques such as the yeast toxicity and suppressor screen are essential for illuminating the cellular processes being manipulated by these effector proteins. At some point, observations identifying binding partners or pathways targeted by bacterial effector proteins need to return to cellular infection models to determine whether these in vitro findings hold true in physiologically relevant scenarios. Genetic manipulation of obligate intracellular pathogens like C. trachomatis has been a major hurdle until recently11&#8211;15 and generation of site-specific mutants to study effector proteins was not possible. In the last few years though, a revolution in generating chlamydial mutants, complementing them, and overexpressing target proteins has occurred. These recent advances have greatly enhanced the value of the information derived from studies using toxicity and suppressor screens as it is now possible to go from yeast directly into infection to probe the validity of the results.

The first report of procedures similar to those presented here characterized the Legionella pneumophila type IV effector SidD, a deAMPylase that modifies Rab11. Comparable techniques were used for the characterization of several L. pneumophila effectors1,2,3. The assay was adapted to characterize a Coxiella burnetii type IV effector protein4, and recently the utility of this technique was expanded for the characterization of Chlamydia trachomatis inclusion membrane proteins5.
This protocol can be broken into two major parts: 1) the yeast toxicity screen, in which the bacterial effector protein of interest is expressed in yeast and clones are screened for a toxic phenotype as evidenced by a growth defect, and 2) the yeast suppressor screen, in which the toxic phenotype is suppressed by expression of a yeast genomic library in the toxic strain. Thus, the toxicity screen is a screen for toxic phenotypes that manifest as growth defects when the bacterial effector of interest is overexpressed. Toxic clones, successfully transformed with and expressing the bacterial effector, are selected and saved for the next step. The second major step involves overexpressing a partially digested yeast genomic library in the toxic yeast clone. Plasmids making up the yeast genomic library suggested for the use in this protocol carry 5&#8722;20 kb inserts, usually corresponding to 3&#8722;13 yeast open reading frames (ORF) of an average gene size of ~1.5 kb across all plasmids, representing the whole yeast genome covered approximately 10x. This part of the assay is called the suppressor screen, as the goal is to suppress the toxicity of the bacterial effector protein. Potential suppressor plasmids are isolated from yeast, sequenced, and the suppressing ORFs identified. The rationale underlying the suppressor screen is that the effector protein binds, interacts with, and/or overwhelms components of the host pathway it targets, and that providing those host proteins back in excess can rescue the toxic effect on the pathway and thus, the growth defect. Thus, identified ORFs that suppress toxicity often represent multiple participants of a host pathway. Orthogonal experiments are then performed to verify that the bacterial effector indeed interacts with the implicated pathway. This is especially necessary if a binding partner such as clathrin or actin has been identified, because these proteins are involved in a multitude of host processes. Further experiments can then elucidate the physiological function of the effector protein during infection. The toxicity and suppressor screens are also powerful tools for deciphering the physiological function of bacterial effector proteins that do not physically bind host proteins with affinities sufficient to detect by immunoprecipitation or that interact with the host in enzymatic hit-and-run interactions that may not be detected by a yeast-two hybrid screen.
Although the suppressor screen can be a powerful method to reveal potential physiological interactions between bacterial effector proteins and host pathways, the bacterial effector protein must induce a growth defect in yeast, otherwise using it in the suppressor screen will be of little use. Furthermore, the toxic phenotype must result in at least a 2&#8722;3 log10 deficit in growth or it will be difficult to identify suppressors. If a laboratory is set up for cell culture, screening effector proteins for toxicity in common cell lines such as HeLa can often give insight as to whether it is worth the effort to proceed with the yeast toxicity screen. Ectopic expression of the effector protein in HeLa cells sometimes results in toxicity that correlates very strongly with toxicity in the yeast strain used for these screens4. Observable hallmarks of stress in HeLa cells include loss of stress fibers, cell detachment from the plate, and nuclear condensation indicating apoptosis. Any visual indication of stress in HeLa cells make the protein of interest a good candidate for inducing a growth defect in yeast, which replicate much more rapidly and are thus more responsive to perturbation of essential pathways.
It should be noted that the suppressor screen does not always identify host binding partners as suppressors, but it can still implicate critical components of the host pathway(s) targeted, yielding a holistic view of the biological processes being hijacked by the bacterial effector protein. On the surface, this seems counterintuitive, because providing the binding partner of the effector protein in excess would be expected to rescue the growth defect. In efforts to identify pathways targeted by the C. trachomatis effector protein CT229 (CpoS), which binds to at least 10 different Rab GTPases during infection5, none of the Rab binding partners suppressed the toxicity of CT229. However, numerous suppressors involved in clathrin-coated vesicle (CCV) trafficking were identified, which led to further work demonstrating that CT229 specifically subverts Rab-dependent CCV trafficking. Similarly, when investigating the C. burnetii effector protein Cbu0041 (CirA) several Rho GTPases that rescued the yeast growth defect were identified, and it was later found that CirA functions as a GTPase activating protein (GAP) for RhoA4.
The usefulness of the yeast suppressor screen for elucidating host pathways targeted by bacterial effector proteins cannot be overstated, and other researchers attempting to characterize intracellular bacterial effector proteins can greatly benefit from these techniques. These assays are of value if immunoprecipitations and/or yeast-two hybrid screens have failed to find a binding partner and can elucidate which pathways are targeted by the bacterial effector protein. Here, detailed protocols for the toxicity and suppressor screens to identify host biological pathways targeted by intracellular bacterial effector proteins are provided, as well as some of the common obstacles experienced when using these assays and their corresponding solutions.

<table><tbody><tr><td>Agar</td><td>Fisher Scientific</td><td>BP2641500</td><td></td></tr><tr><td>Galactose</td><td>MilliporeSigma</td><td>G0750-1KG</td><td></td></tr><tr><td>GeneJet Gel extraction kit</td><td>ThermoFisher Scientific</td><td>K0691</td><td></td></tr><tr><td>GeneJet PCR purification kit</td><td>ThermoFisher Scientific</td><td>K0701</td><td></td></tr><tr><td>GeneJet plasmid miniprep kit</td><td>Thermo</td><td>K0503</td><td></td></tr><tr><td>Glucose</td><td>MilliporeSigma</td><td>G8270-1KG</td><td></td></tr><tr><td>Herring Sperm DNA</td><td>Promega</td><td>D1811</td><td></td></tr><tr><td>KpnI-HF</td><td>New England Biolabs</td><td>R3142S</td><td></td></tr><tr><td>Lithium acetate dihydrate</td><td>MilliporeSigma</td><td>L6883-250G</td><td></td></tr><tr><td>Peptone</td><td>Fisher Scientific</td><td></td><td></td></tr><tr><td>Phusion High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>Poly(ethylene glycol) 3350</td><td>MilliporeSigma</td><td>1546547-1G</td><td></td></tr><tr><td>pYep13</td><td>ATCC</td><td>37323</td><td></td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>Tryptophan</td><td>MilliporeSigma</td><td>470031-1G</td><td></td></tr><tr><td>XhoI-HF</td><td>New England Biolabs</td><td>R0146S</td><td></td></tr><tr><td>Yeast extract</td><td>Fisher Scientific</td><td>BP1422-500</td><td></td></tr><tr><td>Yeast miniprep kit</td><td>Zymo</td><td>D2001</td><td></td></tr><tr><td>Yeast nitrogen base without amino acids</td><td>MilliporeSigma</td><td>Y0626-250G</td><td></td></tr><tr><td>Yeast Synthetic Drop-out Medium Supplements</td><td>MilliporeSigma</td><td>Y1501-20G</td><td>without uracil</td></tr><tr><td>Yeast Synthetic Drop-out Medium Supplements</td><td>MilliporeSigma</td><td>Y1771-20G</td><td>without uracil, leucine, tryptophan</td></tr></tbody></table>

identification of host pathways targeted by bacterial effector proteins using yeast toxicity and suppressor screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Before the actual yeast suppressor screen can be performed, the effector protein of interest must be tested for toxicity in yeast. This is accomplished by expressing the protein of interest in yeast under the control of a galactose-inducible promoter. Growth on glucose (noninducing conditions) should first be compared to ensure toxicity is specifically due to the expression of the protein of interest and is not a general defect. As shown in Figure 3, toxicity manifests as smaller colonies and/or reduced growth. A 2&#8722;3 log decrease in yeast growth is ideal for the yeast suppressor screens.
As shown in Figure 4, the toxicity and suppressor screen can be accomplished in eight steps using the methods described in the protocol section. The gene of interest is cloned into a suitable vector1, and the resulting constructs are transformed into yeast to assess toxicity. This study used CT229 as the gene of interest and pYesNTA-Kan as the vector. Additionally, the expression of the His-tagged fusion protein was confirmed by Western blotting. Ideally, a 2&#8722;3 log reduction in yeast grown on galactose-containing media should be observed. If the protein of interest is toxic to yeast (Figure 3 and Figure 4), the suppressor screen can be conducted by transforming the toxic strain with the yeast genomic library pYep13. Transformants are plated on glucose agar to determine transformation efficiency and galactose agar to identify potential suppressors. Using this protocol, a minimum transformation efficiency of 5 x 105 was &#160;achieved with a total of 10&#8722;250 colonies on galactose agar. Patching these colonies on SD Ura- Leu- galactose agar (Figure 4) aided in identification of true suppressors, because many false positives will not grow when patched. Here, 50 colonies were patched and eight clones that suppressed effector toxicity were obtained (Figure 4). Spotting suppressors on SD Ura- Leu- galactose agar was done to confirm suppression of toxicity. As shown in Figure 4, pSup1 and pSup 2 suppressed the toxicity of the effector protein, whereas pSup3 did not. Therefore, pSup3 was discarded. Plasmids were subsequently isolated from the suppressors and transformed into E. coli to increase the plasmid yield. The plasmid can then be retransformed into the toxic yeast to confirm that the isolated plasmid definitely suppresses effector toxicity (Figure 4). While most of the isolated plasmids should rescue toxicity, occasionally a plasmid that does not suppress toxicity when retransformed into the toxic yeast strain is obtained. Those plasmids are discarded, and only those that suppress toxicity following retransformation should be sequenced.
The isolated plasmid will contain multiple yeast ORFs4. To identify which is the true suppressor, each ORF can be individually cloned and expressed in the toxic yeast strain as previously described1,2,3,4.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60488/60488fig1.jpg" /> 
Figure 1: PCR amplification of target gene. CT229 from Chlamydia trachomatis serovar L2 was PCR amplified from genomic DNA. PCR products were analyzed on a 1% agarose gel stained with ethidium bromide. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60488/60488fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60488/60488fig2.jpg" /> 
Figure 2: pYesNTA-Kan plasmid map. The target gene of interest was cloned into the multiple cloning site (MCS) of pYesNTA-Kan. Kanamycin was used for selection in E. coli and uracil dropout was used for selection in S. cerevisiae. Expression of the His-tagged fusion protein was verified by Western blotting. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60488/60488fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60488/60488fig3.jpg" /> 
Figure 3: Representative yeast toxicity results. Effector proteins of interest were cloned into pYesNTA-Kan. Sequence-verified plasmids were transformed into S. cerevisiae and transformants were serially diluted and spotted on Ura- glucose and galactose agar to assess toxicity. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60488/60488fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60488/60488fig4.jpg" /> 
Figure 4: Overview of the yeast suppressor screen. The target gene of interest was cloned into pYesNTA-Kan and plasmids were transformed into S. cerevisiae. Transformants were serially diluted and spotted on Ura- glucose and galactose agar to assess toxicity. To identify the pathway targeted by the toxic effector protein, the yeast strain expressing the toxic protein was transformed with a yeast genomic library. Colonies were patched on Ura- Leu- galactose agar and spotted to assess toxicity. Plasmids were isolated from those that suppress the toxicity of the effector protein. Plasmids were retransformed into the toxic yeast strain to confirm that the isolated plasmid is a suppressor. Plasmids from suppressors were sequenced to identify the yeast ORFs present. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60488/60488fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens at JoVE.com

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...

identification-host-pathways-targeted-bacterial-effector-proteins

Nanyang Technological University

Research

JoVE Journal

Genetics

5.9K Views.  University of Iowa. Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Video: Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Identification of Growth Inhibition Phenotypes Induced by Expression of Bacterial Type III Effectors in Yeast

Many Gram-negative pathogenic bacteria use a type III secretion system to translocate a suite of effector proteins into the cytosol of host cells. Within the cell, type III effectors subvert host cellular processes to suppress immune responses and promote pathogen growth. Numerous type III effectors of plant and animal bacterial pathogens have been identified to date, yet only a few of them are well characterized. Understanding the functions of these effectors has been undermined by a combination of functional redundancy in the effector repertoire of a given bacterial strain, the subtle effects that they may exert to increase virulence, roles that are possibly specific to certain infection stages, and difficulties in genetically manipulating certain pathogens. Expression of type III effectors in the budding yeast Saccharomyces cerevisiae may allow circumventing these limitations and aid to the functional characterization of effector proteins. Because type III effectors often target cellular processes that are conserved between yeast and other eukaryotes, their expression in yeast may result in growth inhibition phenotypes that can be exploited to elucidate effector functions and targets. Additional advantages to using yeast for functional studies of bacterial effectors include their genetic tractability, information on predicted functions of the vast majority of their ORFs, and availability of numerous tools and resources for both genome-wide and small-scale experiments. Here we discuss critical factors for designing a yeast system for the expression of bacterial type III effector proteins. These include an appropriate promoter for driving expression of the effector gene(s) of interest, the copy number of the effector gene, the epitope tag used to verify protein expression, and the yeast strain. We present procedures to induce expression of effectors in yeast and to verify their expression by immunoblotting. In addition, we describe a spotting assay on agar plates for the identification of effector-induced growth inhibition phenotypes. The use of this protocol may be extended to the study of pathogenicity factors delivered into the host cell by any pathogen and translocation mechanism.

In this video, we describe a procedure for the expression of bacterial type III effectors in yeast and the identification of effector-induced growth inhibition phenotypes. Such phenotypes can be subsequently exploited to elucidate effector functions and targets.

Many Gram-negative pathogenic bacteria use a type III secretion system to translocate a suite of effector proteins into the cytosol of host cells. Within ...

Biology

Unravelling the Function of a Bacterial Effector from a Non-cultivable Plant Pathogen Using a Yeast Two-hybrid Screen

Unravelling the molecular mechanisms of disease manifestations is important to understand pathologies and symptom development in plant science. Bacteria have evolved different strategies to manipulate their host metabolism for their own benefit. This bacterial manipulation is often coupled with severe symptom development or the death of the affected plants. Determining the specific bacterial molecules responsible for the host manipulation has become an important field in microbiological research. After the identification of these bacterial molecules, called &#34;effectors,&#34; it is important to elucidate their function. A straightforward approach to determine the function of an effector is to identify its proteinaceous binding partner in its natural host via a yeast two-hybrid (Y2H) screen. Normally the host harbors numerous potential binding partners that cannot be predicted sufficiently by any in silico algorithm. It is thus the best choice to perform a screen with the hypothetical effector against a whole library of expressed host proteins. It is especially challenging if the causative agent is uncultivable like phytoplasma. This protocol provides step-by-step instructions for DNA purification from a phytoplasma-infected woody host plant, the amplification of the potential effector, and the subsequent identification of the plant&#39;s molecular interaction partner with a Y2H screen. Even though Y2H screens are commonly used, there is a trend to outsource this technique to biotech companies that offer the Y2H service at a cost. This protocol provides instructions on how to perform a Y2H in any decently equipped molecular biology laboratory using standard lab techniques.

Bacterial effector proteins are important for establishing successful infections. This protocol describes the experimental identification of proteinaceous binding partners of a bacterial effector protein in its natural plant host. Identifying these effector interactions via yeast two-hybrid screens has become an important tool in unravelling molecular pathogenicity strategies.

Unravelling the molecular mechanisms of disease manifestations is important to understand pathologies and symptom development in plant science. Bacteria ...

Immunology and Infection

High-throughput Yeast Plasmid Overexpression Screen

The budding yeast, Saccharomyces cerevisiae, is a powerful model system for defining fundamental mechanisms of many important cellular processes, including those with direct relevance to human disease. Because of its short generation time and well-characterized genome, a major experimental advantage of the yeast model system is the ability to perform genetic screens to identify genes and pathways that are involved in a given process. Over the last thirty years such genetic screens have been used to elucidate the cell cycle, secretory pathway, and many more highly conserved aspects of eukaryotic cell biology 1-5. In the last few years, several genomewide libraries of yeast strains and plasmids have been generated 6-10. These collections now allow for the systematic interrogation of gene function using gain- and loss-of-function approaches 11-16. Here we provide a detailed protocol for the use of a high-throughput yeast transformation protocol with a liquid handling robot to perform a plasmid overexpression screen, using an arrayed library of 5,500 yeast plasmids. We have been using these screens to identify genetic modifiers of toxicity associated with the accumulation of aggregation-prone human neurodegenerative disease proteins. The methods presented here are readily adaptable to the study of other cellular phenotypes of interest.

Here we describe a plasmid overexpression screen in Saccharomyces cerevisiae, using an arrayed plasmid library and a high-throughput yeast transformation protocol with a liquid handling robot.

The budding yeast, Saccharomyces cerevisiae, is a powerful model system for defining fundamental mechanisms of many important cellular processes, ...

Competitive Genomic Screens of Barcoded Yeast Libraries

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment.

We have developed comprehensive, unbiased genome-wide screens to understand gene-drug and gene-environment interactions. Methods for screening these mutant collections are presented.

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic lateral sclerosis, and &#945;-synuclein, implicated in Parkinson&#8217;s disease, are toxic and form cytoplasmic aggregates in yeast. These features recapitulate protein pathologies observed in patients with these disorders. Thus, yeast are an ideal platform for isolating toxicity suppressors from libraries of protein variants. We are interested in applying protein disaggregases to eliminate misfolded toxic protein conformers. Specifically, we are engineering Hsp104, a hexameric AAA+ protein from yeast that is uniquely capable of solubilizing both disordered aggregates and amyloid and returning the proteins to their native conformations. While Hsp104 is highly conserved in eukaryotes and eubacteria, it has no known metazoan homologue. Hsp104 has only limited ability to eliminate disordered aggregates and amyloid fibers implicated in human disease. Thus, we aim to engineer Hsp104 variants to reverse the protein misfolding implicated in neurodegenerative disorders. We have developed methods to screen large libraries of Hsp104 variants for suppression of proteotoxicity in yeast. As yeast are prone to spontaneous nonspecific suppression of toxicity, a two-step screening process has been developed to eliminate false positives. Using these methods, we have identified a series of potentiated Hsp104 variants that potently suppress the toxicity and aggregation of TDP-43, FUS, and &#945;-synuclein. Here, we describe this optimized protocol, which could be adapted to screen libraries constructed using any protein backbone for suppression of toxicity of any protein that is toxic in yeast.

Yeast proteinopathy models are valuable tools to assess the toxicity and aggregation of proteins implicated in disease. Here, we present methods for screening Hsp104 variant libraries for toxicity suppressors. This protocol could be adapted to screen any protein library for toxicity suppressors of any protein that is toxic in yeast.

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Determining the mode of action of bioactive chemicals is of interest to a broad range of academic, pharmaceutical, and industrial scientists. Saccharomyces cerevisiae, or budding yeast, is a model eukaryote for which a complete collection of ~6,000 gene deletion mutants and hypomorphic essential gene mutants are commercially available. These collections of mutants can be used to systematically detect chemical-gene interactions, i.e. genes necessary to tolerate a chemical. This information, in turn, reports on the likely mode of action of the compound. Here we describe a protocol for the rapid identification of chemical-genetic interactions in budding yeast. We demonstrate the method using the chemotherapeutic agent 5-fluorouracil (5-FU), which has a well-defined mechanism of action. Our results show that the nuclear TRAMP RNA exosome and DNA repair enzymes are needed for proliferation in the presence of 5-FU, which is consistent with previous microarray based bar-coding chemical genetic approaches and the knowledge that 5-FU adversely affects both RNA and DNA metabolism. The required validation protocols of these high-throughput screens are also described.

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Here we present a cost-effective method for defining chemical-genetic interactions in budding yeast. The approach is built on fundamental techniques in yeast molecular biology and is well suited for the mechanistic interrogation of small to medium collections of chemicals and other media environments.

Determining the mode of action of bioactive chemicals is of interest to a broad range of academic, pharmaceutical, and industrial scientists. ...

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

Identification of genetic interactions is a powerful tool to decipher the functions of gene(s) by providing insights into their functional relationships with other genes and organization into biological pathways and processes. Although the majority of the genetic screens were initially developed in Saccharomyces cerevisiae, a complementary platform for carrying out these genetic screens has been provided by Schizosaccharomyces pombe. One of the common approaches used to identify genetic interactions is by overexpression of clones from a genome-wide, high-copy-number plasmid library in a loss-of-function mutant, followed by selection of clones that suppress the mutant phenotype.
This paper describes a protocol for carrying out this &#39;multicopy suppression&#39;-based genetic screen in S. pombe. This screen has helped identify multicopy suppressor(s) of the genotoxic stress-sensitive phenotype associated with the absence of the Ell1 transcription elongation factor in S. pombe. The screen was initiated by transformation of the query ell1 null mutant strain with a high-copy-number S. pombe cDNA plasmid library and selecting the suppressors on EMM2 plates containing 4-nitroquinoline 1-oxide (4-NQO), a genotoxic stress-inducing compound. Subsequently, plasmid was isolated from two shortlisted suppressor colonies and digested by restriction enzymes to release the insert DNA. Plasmids releasing an insert DNA fragment were retransformed into the ell1 deletion strain to confirm the ability of these suppressor plasmid clones to restore growth of the ell1 deletion mutant in the presence of 4-NQO and other genotoxic compounds. Those plasmids showing a rescue of the deletion phenotype were sequenced to identify the gene(s) responsible for suppression of the ell1 deletion-associated genotoxic stress-sensitive phenotype.

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

This work describes a protocol for a multicopy suppressor genetic screen in Schizosaccharomyces pombe. This screen uses a genome-wide plasmid library to identify suppressor clone(s) of a loss-of-function phenotype associated with a query mutant strain. Novel genetic suppressors of the ell1 null mutant were identified using this screen.

Identification of genetic interactions is a powerful tool to decipher the functions of gene(s) by providing insights into their functional relationships ...

Identifying Drugs that Affect Polymerization of Bacterial Cytoskeletal Proteins

Fission Yeast as a Platform for Antibacterial Drug Screens Targeting Bacterial Cytoskeleton Proteins

Bacterial cytoskeletal proteins such as FtsZ and MreB perform essential functions such as cell division and cell shape maintenance. Further, FtsZ and MreB have emerged as important targets for novel antimicrobial discovery. Several assays have been developed to identify compounds targeting nucleotide binding and polymerization of these cytoskeletal proteins, primarily focused on FtsZ. Moreover, many of the assays are either laborious or cost-intensive, and ascertaining whether these proteins are the cellular target of the drug often requires multiple methods. Finally, the toxicity of the drugs to eukaryotic cells also poses a problem. Here, we describe a single-step cell-based assay to discover novel molecules targeting bacterial cytoskeleton and minimize hits that might be potentially toxic to eukaryotic cells. Fission yeast is amenable to high-throughput screens based on microscopy, and a visual screen can easily identify any molecule that alters the polymerization of FtsZ or MreB. Our assay utilizes the standard 96-well plate and relies on the ability of the bacterial cytoskeletal proteins to polymerize in a eukaryotic cell such as the fission yeast. While the protocols described here are for fission yeast and utilize FtsZ from Staphylococcus aureus and MreB from Escherichia coli, they are easily adaptable to other bacterial cytoskeletal proteins that readily assemble into polymers in any eukaryotic expression hosts. The method described here should help facilitate further discovery of novel antimicrobials targeting bacterial cytoskeletal proteins.

Author Spotlight: Exploring Cytoskeletal Dynamics to Unveil Novel Antibiotics Through Innovative Cell-Based Assays

Fission yeast is used here as a heterologous host to express bacterial cytoskeletal proteins such as FtsZ and MreB as translational fusion proteins with GFP to visualize their polymerization. Also, compounds that affect polymerization are identified by imaging using a fluorescence microscope.

Bacterial cytoskeletal proteins such as FtsZ and MreB perform essential functions such as cell division and cell shape maintenance. Further, FtsZ and MreB ...

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Mating-based Overexpression Library Screening in Yeast

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

Identification of Growth Inhibition Phenotypes Induced by Expression of Bacterial Type III Effectors in Yeast

Unravelling the Function of a Bacterial Effector from a Non-cultivable Plant Pathogen Using a Yeast Two-hybrid Screen

High-throughput Yeast Plasmid Overexpression Screen

Competitive Genomic Screens of Barcoded Yeast Libraries

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

Fission Yeast as a Platform for Antibacterial Drug Screens Targeting Bacterial Cytoskeleton Proteins