R.H. is supported by US National Institutes of Health grants (R01HL116546 and R01 AR064241).

The animals used in this protocol were maintained at The Ohio State University Laboratory Animal Resources in accordance with animal use guidelines. All animal studies were authorized by the Institutional Animal Care, Use, and Review Committee of the Ohio State University.
1. Design and Cloning of gRNAs into the CRISPR Vector
<ol>
	<li>Select 2 gRNAs targeting dystrophin intron 20 and intron 23 (i20 and i23) for SaCas9: i20: 5&#39;-GGGCGTTGAAATTCTCATTAC CAGAGT and i23: 5&#39;-CACCGATGAGAGGGAAAGGTC CTGAAT (the PAM sequence is underlined and italicized). 
	NOTE: The target sites for i20 and i23 are about 23 kilo base pair (kbp) away. To disrupt a coding gene, two gRNAs targeting the common exons with the NNGRRT PAM sequence for SaCas9 (preferably NNGAAT, NNGGGT and NNGAGT) and distance within 20 kbp are recommended.</li>
	<li>Use the following PCR parameters to anneal the gRNA oligos (100 &#181;mol/L) in 1x annealing buffer (the 5x annealing buffer stock contains 0.5 mol/L K-acetate, 150 mmol/L HEPES-KOH, 10 mmol/L Mg-acetate, pH7.4): 95 &#176;C 10 min, 90 cycles of 95 to 59 &#176;C with a 0.4 &#176;C decrease per cycle for 20 s, 90 cycles of 59 to 32 &#176;C with a 0.3 &#176;C decrease per cycle for 20 s, 20 cycles of 32 to 26 &#176;C with a 0.3 &#176;C decrease per cycle for 20 s.</li>
	<li>Ligate the annealed gRNA oligos into the pX601-CMV-SaCas9-mPA-U6-gRNA using BsaI and T4 DNA ligase in one reaction (1 &#181;L 50 ng/&#181;L pX601-CMV-SaCas9-mPA-U6-gRNA, 1 &#181;L annealed oligos, 1.5 &#181;L 10x T4 DNA ligase buffer, 0.5 &#181;L T4 DNA ligase, 1 &#181;L BsaI, 10 &#181;L ddH2O), with the following reaction condition in a PCR cycler: 5 cycles of [37 &#176;C 5 min and 16 &#176;C 10 min]; 37 &#176;C 20 min; 80 &#176;C 5 min.</li>
	<li>Transform the 15 &#181;L ligation product into 30 &#181;L competent cells, plate the cells in agar plate with 100 &#181;g/mL Ampicillin, and culture at 37 &#176;C for 24 h.</li>
	<li>Pick up 5-10 colonies and culture in LB medium containing 100 &#181;g/mL Ampicillin at 37 &#176;C, 250 rpm in a shaker incubator for 3-4 h.</li>
	<li>Screen the colonies by PCR: 10 &#181;L 2x PCR master mix, 8 &#181;L ddH2O, 1 &#181;L E. Coli culture, 1 &#181;L 10 &#181;mol/L U6-forward primer, 1 &#181;L i20 or i23 gRNA reverse primer. The PCR cycling parameters: 95 &#176;C 5 min, 35 cycles of 95 &#176;C 30 s, 61 &#176;C 30 s, 72 &#176;C 30 s.</li>
	<li>Prepare 5 mL culture of the positive clones by adding 4 mL fresh LB medium containing100 &#181;g/mL Ampicillin, and culture overnight at 37 &#176;C, 250 rpm.</li>
	<li>Purify the plasmid DNA using the appropriate plasmid extraction kit, and verify the plasmid by Sanger sequencing with the U6-forward primer.</li>
	<li>Culture C2C12 cells in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~70% confluency for testing the gene editing efficacy of the plasmids.</li>
	<li>Electroporate a total of 5 &#181;g SaCas9/gRNA plasmid mixture in 1:1 molar ratio into 1 x 106 C2C12 cells according to the manufacturer&#39;s protocol.</li>
	<li>After 48 h post-transfection, harvest the C2C12 cells and extract genomic DNA.</li>
	<li>Use 100 ng genomic DNA as template to perform the PCR reaction for mouse dystrophin locus: forward primer 5&#39;-GGCCAAAGCAAACTCTGGTA (1 &#181;L 10 &#181;mol/L), reverse primer 5&#39;-TTTAATCCCACGTCATGCAA (1 &#181;L 10 &#181;mol/L), 10 &#181;L 2x the green PCR master mix, 7 &#181;L ddH2O, 1 &#181;L genomic DNA (100 ng). Use PCR cycling conditions as 95 &#176;C 5 min, 35 cycles of [95 &#176;C 30 s, 61 &#176;C 30 s, 72 &#176;C 30 s], 72 &#176;C 2 min.</li>
</ol>
2. rAAV Production
<ol>
	<li>To culture the cells, seed AD293 cells onto 20 to 40 of 15-cm dishes and maintain in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~90% confluency for transfection.</li>
	<li>Dilute 3 plasmids with 200 &#181;L reduced serum medium (per dish): 1)10 &#181;g pHelper; 2) 5 &#181;g pXR(rh.74 or other serotypes) and 3) A total of 5 &#181;g of pX601-i20 and pX601-i23 mixture (1:1 ratio). Perform polyethylenimine (PEI) transfection by mixing with 80 &#181;L PEI and incubate at room temperature for 10 min. Add the mixture on to the AD293 cell cultures in a dropwise manner.</li>
	<li>For AAV virus production, after 72 h post transfection, use a cell scraper to collect both the media and the AD293 cell pellets by centrifugation at 1100 x g for 10 mins.</li>
	<li>Resuspend the cell pellets in 15 mL rAAV lysis buffer (50 mmol/L Tris Base, 150 mmol/L NaCl, pH 8.5) followed by 3 freeze-thaw cycles with alternating incubation in liquid nitrogen and a 42 &#176;C water bath. Store the cell lysates in -80 &#176;C for future processing if they are not being processed immediately.</li>
	<li>Filter the culture media with a 0.45-&#181;m filter and add a 40% PEG8000 in 2.5 mol/L NaCl to a final concentration of 8%. Incubate the mixture at 4 &#176;C for 1 h and centrifuge at 1100 x g for 15 min.</li>
	<li>Resuspend the pellets in rAAV lysis buffer and combine with the cell lysates from step 2.3, followed by benzonase (50 U/mL) treatment at 37 &#176;C for 1 h.</li>
	<li>Centrifuge the benzonase-treated rAAV containing mixture 1100 x g for 15 min at 4 &#176;C, and save the supernatant (the crude rAAV preparation).</li>
</ol>
3. rAAV Purification and Concentration
<ol>
	<li>Load the crude rAAV preparation onto an iodixanol gradient in an ultracentrifuge tube in the following order from the top to the bottom: crude AAV lysate (~15 mL), 8 mL 15% Iodixanol, 6 mL 25% Iodixanol, 5 mL 40% Iodixanol, 5 mL 58% Iodixanol. Fill the remaining empty volume of the tube to the top using 1x DPBS.</li>
	<li>Centrifuge the samples at 230,000 x g in an ultracentrifuge rotor for 120 min at 10 &#176;C and collect 3 - 4 mL of the 40% gradient fraction containing the rAAV particles with an 18 G needle.</li>
	<li>Dilute the rAAV particles with 1x DPBS and centrifuge using the centrifugal filter unit (MWCO 100 kDa). Repeat this step for 3-5 times and finally concentrate the rAAV preparation to 300-500 &#181;L.</li>
</ol>
4. rAAV Titering
<ol>
	<li>Extract the genomic DNA from 2 &#181;L concentrated rAAV, precipitate with 3 M NaOAc in ethanol, and resuspend in 20 &#181;L ddH2O.</li>
	<li>Obtain the standard curve for rAAV quantitation by serial dilution of the pX601 plasmid: 1 x 109, 1 x 108, 1 x 107, 1 x 106, 1 x 105 copies in each 10 &#181;L ddH2O. Dilute the DNAase-treated rAAV samples as 1:10, 1:50, 1:100, and 1:1000.</li>
	<li>Determine rAAV titer by quantitative real-time PCR (qPCR) using qPCR Kit according to manufacturer&#39;s instruction in a Real-Time PCR system: 1 &#181;L 10 &#181;mol/L of each primer (5&#39;-GGATTTCCAAGTCTCCACCC and 5&#39;-TCCCACCGT ACACGCCTAC), 5 &#181;L 2x PCR master mix, 1 &#181;L diluted rAAV samples and 2 &#181;L ddH2O. Run the reaction with the following cycling parameters: 95 &#176;C 3 min, 45 cycles of [95 &#176;C 5 sec and 61 &#176;C 20 sec].</li>
</ol>
5. Intravenous and Intraperitoneal Injection of rAAVrh.74-CRISPR into Neonatal mdx/utrophin+/- Mice
<ol>
	<li>Immobilize the mdx/utrophin+/- mouse pups (day 3) by placing on ice for 1 min, and then administer with 1 x 1012 viral particles in 50 &#181;L per mouse systemically via a retro-orbital approach or an intraperitoneal injection.</li>
	<li>Allow the mice to recover and place back into their home cages. At ten weeks after rAAV administration, euthanize the mice by CO2 exposure for tissue collection.</li>
	<li>Snap-freeze tissues for genomic DNA and RNA extraction, and use cooling isopentane in liquid nitrogen to freeze tissues with optimal cutting temperature compound for cryosectioning.</li>
</ol>
6. Analysis of Target Gene Editing Outcomes
<ol>
	<li>Genomic DNA PCR analysis
	<ol>
		<li>Isolate the total genomic DNA from the heart tissues of mdx/utrophin+/- mice treated with or without rAAV.</li>
		<li>Use the same protocol in Step 1.12 for PCR analysis.</li>
	</ol>
	</li>
	<li>RT-PCR analysis of dystrophin expression
	<ol>
		<li>Extract total RNA from the heart tissues with the RNA extraction kit following the manufacturer&#39;s manual.</li>
		<li>To perform reverse transcription, pre-treat the total RNA with an RNase-free DNase and use 5 &#181;g of treated RNA as the template for first-strand cDNA synthesis with the reverse transcription kit.</li>
		<li>Use the reverse transcription product for RT-PCR analysis of dystrophin expression with the dystrophin cDNA primers: 5&#39;-GGCTAGAGTATCAAACCAACATCAT and 5&#39;- TGGAGGCTTACGGTTTTATCC.</li>
	</ol>
	</li>
	<li>Estimate the gene editing efficacy by qPCR analysis
	<ol>
		<li>Estimate the gene editing efficacy by quantitative RT-PCR to detect the reduction of exon 22-containing transcripts using the forward primer (exon 21): 5&#39;-TTGTCAGCTCTTCAGCCTCAAA, and the reverse primer (exon 23): 5&#39;-AAACTCTCCTTCACAGTGTCACT. Use Gapdh as a reference gene with the forward primer: 5&#39;- AGGTTGTCTCCTGCGACTTC and the reverse primer: 5&#39;- GGTGGTCCAGGGTTTCTTACT.</li>
		<li>Run the quantitative real-time PCR (qPCR) using the qPCR Kit according to manufacturer&#39;s instruction in a Real-Time PCR system and the 2-step reaction conditions: 95 &#176;C 3 min, 45 cycles of 95 &#176;C 5 sec and 61 &#176;C 30 sec.</li>
	</ol>
	</li>
	<li>Immunofluorescence staining to analyze dystrophin expression
	<ol>
		<li>Cut the frozen tissues using a cryostat at a thickness of 10 &#181;m. Fix the frozen sections with 4% paraformaldehyde at room temperature for 15 min.</li>
		<li>Wash 2x with PBS and incubate with blocking solution (10% horse serum) for 1 h.</li>
		<li>Incubate the anti-dystrophin primary antibody, at 4 &#176;C overnight.</li>
		<li>Wash the slides with PBS 3 x 5 min and incubate with fluorescent secondary antibodies (1:500) at room temperature for 1 h.</li>
		<li>Mount the slides using the mounting medium with DAPI and imaging with an inverted confocal microscope.</li>
	</ol>
	</li>
</ol>
7. Off-target analysis by T7E1 assay
<ol>
	<li>Predict the potential off-target sites using the online CRISPR design tools such as &#60;http://crispr.mit.edu&#62;.</li>
	<li>Amplify the genomic regions covering the top 5-10 potential off-target sites by PCR: genomic DNA 200 ng, 1 &#181;L high-fidelity DNA polymerase, 5 &#181;L 10x PCR Buffer mix, 1.5 &#181;L 10 &#181;mol/L of site-specific forward and reverse primers, adjusting the total volume to 50 &#181;L with ddH2O.</li>
	<li>Run the PCR products by electrophoresis, extract and purify the DNA using a gel extraction kit. Measure the concentration using spectrophotometers.</li>
	<li>Promote heteroduplex formation by denaturing and re-annealing the purified amplicons slowly in the Buffer 2.1 using a PCR cycler. Use the same cycling conditions as detailed in step 1.2.</li>
	<li>Digest the re-annealed products for 30 min at 37 &#176;C with 0.5 &#181;L T7E1 enzyme, and analyze the reaction by electrophoresis using 1-2% agarose gel. 
	NOTE: The amplicons can also be analyzed by targeted deep sequencing.</li>
</ol>

<ol>
	<li>Makarova, K. S., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+and+Classification+of+CRISPR-Cas+Systems.">Annotation and Classification of CRISPR-Cas Systems.</a> Methods Mol Biol. 1311, 47-75 (2015).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163, 759-771 (2015).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li><li>Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+double-strand+DNA+break+repair+by+the+nonhomologous+DNA+end-joining+pathway.">The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway.</a> Annual review of biochemistry. 79, 181-211 (2010).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature protocols. 8, 2281-2308 (2013).</li><li>Zhang, X., Wang, J., Cheng, Q., Zheng, X., Zhao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+regulation+by+CRISPR-ddCpf1.">Multiplex gene regulation by CRISPR-ddCpf1.</a> Cell discovery. 3, 17018 (2017).</li><li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+Effects+in+CRISPR/Cas9-mediated+Genome+Engineering.">Off-target Effects in CRISPR/Cas9-mediated Genome Engineering.</a> Molecular therapy. Nucleic acids. 4, e264 (2015).</li><li>Xu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+genome+editing+restores+dystrophin+expression+and+function+in+mdx+mice.">CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice.</a> Mol Ther. 24, 564-569 (2015).</li><li>Long, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+genome+editing+partially+restores+dystrophin+expression+in+a+mouse+model+of+muscular+dystrophy.">Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy.</a> Science. 351, 400-403 (2016).</li><li>Long, C. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+muscular+dystrophy+in+mice+by+CRISPR/Cas9-mediated+editing+of+germline+DNA.">Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA.</a> Science. 345, 1184-1188 (2014).</li><li>Nelson, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome+editing+improves+muscle+function+in+a+mouse+model+of+Duchenne+muscular+dystrophy.">In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy.</a> Science. 351, 403-407 (2016).</li><li>Ousterout, D. G. K., Thakore, A. M., Majoros, P. I., Reddy, T. E. W. H., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+CRISPR/Cas9-based+genome+editing+for+correction+of+dystrophin+mutations+that+cause+Duchenne+muscular+dystrophy.">Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy.</a> Nat Commun. 6, 6244 (2015).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+gene+editing+in+dystrophic+mouse+muscle+and+muscle+stem+cells.">In vivo gene editing in dystrophic mouse muscle and muscle stem cells.</a> Science. 351, 407-411 (2016).</li><li>Bengtsson, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle-specific+CRISPR/Cas9+dystrophin+gene+editing+ameliorates+pathophysiology+in+a+mouse+model+for+Duchenne+muscular+dystrophy.">Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy.</a> Nat Commun. 8, 14454 (2017).</li><li>Hoffman, E. P., Brown, R. H., Kunkel, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dystrophin:+the+protein+product+of+the+Duchenne+muscular+dystrophy+locus.">Dystrophin: the protein product of the Duchenne muscular dystrophy locus.</a> Cell. 51, 919-928 (1987).</li><li>Nowak, K. J., Davies, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duchenne+muscular+dystrophy+and+dystrophin:+pathogenesis+and+opportunities+for+treatment.">Duchenne muscular dystrophy and dystrophin: pathogenesis and opportunities for treatment.</a> EMBO reports. 5, 872-876 (2004).</li><li>Mendell, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence-based+path+to+newborn+screening+for+Duchenne+muscular+dystrophy.">Evidence-based path to newborn screening for Duchenne muscular dystrophy.</a> Annals of neurology. 71, 304-313 (2012).</li><li>Mendell, J. R., Lloyd-Puryear, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Report+of+MDA+muscle+disease+symposium+on+newborn+screening+for+Duchenne+muscular+dystrophy.">Report of MDA muscle disease symposium on newborn screening for Duchenne muscular dystrophy.</a> Muscle Nerve. 48, 21-26 (2013).</li><li>Spurney, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyopathy+of+Duchenne+muscular+dystrophy:+current+understanding+and+future+directions.">Cardiomyopathy of Duchenne muscular dystrophy: current understanding and future directions.</a> Muscle Nerve. 44, 8-19 (2011).</li><li>Moriuchi, T., Kagawa, N., Mukoyama, M., Hizawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autopsy+analyses+of+the+muscular+dystrophies.">Autopsy analyses of the muscular dystrophies.</a> Tokushima J Exp Med. 40, 83-93 (1993).</li><li>McNally, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+approaches+in+the+therapy+of+cardiomyopathy+in+muscular+dystrophy.">New approaches in the therapy of cardiomyopathy in muscular dystrophy.</a> Annual review of medicine. 58, 75-88 (2007).</li><li>Baker, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approvals,+Submission,+and+Important+Labeling+Changes+for+US+Marketed+Pharmaceuticals.">Approvals, Submission, and Important Labeling Changes for US Marketed Pharmaceuticals.</a> Hosp Pharm. 52, 306-307 (2013).</li><li>Baker, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen.">Eteplirsen.</a> Hosp Pharm. 52, 302-305 (2017).</li><li>Sicinski, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+muscular+dystrophy+in+the+mdx+mouse:+a+point+mutation.">The molecular basis of muscular dystrophy in the mdx mouse: a point mutation.</a> Science. 244, 1578-1580 (1989).</li><li>Xu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+Genome+Editing+Restores+Dystrophin+Expression+and+Function+in+mdx+Mice.">CRISPR-mediated Genome Editing Restores Dystrophin Expression and Function in mdx Mice.</a> Molecular therapy : the journal of the American Society of Gene Therapy. 24, 564-569 (2016).</li><li>El Refaey, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Genome+Editing+Restores+Dystrophin+Expression+and+Cardiac+Function+in+Dystrophic+Mice.">In Vivo Genome Editing Restores Dystrophin Expression and Cardiac Function in Dystrophic Mice.</a> Circ Res. 121, 923-929 (2017).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+gene+editing+in+dystrophic+mouse+muscle+and+muscle+stem+cells.">In vivo gene editing in dystrophic mouse muscle and muscle stem cells.</a> Science. 351, 407-411 (2016).</li><li>Pozsgai, E. R., Griffin, D. A., Heller, K. N., Mendell, J. R., Rodino-Klapac, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=beta-Sarcoglycan+gene+transfer+decreases+fibrosis+and+restores+force+in+LGMD2E+mice.">beta-Sarcoglycan gene transfer decreases fibrosis and restores force in LGMD2E mice.</a> Gene therapy. 23, 57-66 (2016).</li><li>Chicoine, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmapheresis+eliminates+the+negative+impact+of+AAV+antibodies+on+microdystrophin+gene+expression+following+vascular+delivery.">Plasmapheresis eliminates the negative impact of AAV antibodies on microdystrophin gene expression following vascular delivery.</a> Mol Ther. 22, 338-347 (2014).</li><li>Chicoine, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+delivery+of+rAAVrh74.MCK.GALGT2+to+the+gastrocnemius+muscle+of+the+rhesus+macaque+stimulates+the+expression+of+dystrophin+and+laminin+alpha2+surrogates.">Vascular delivery of rAAVrh74.MCK.GALGT2 to the gastrocnemius muscle of the rhesus macaque stimulates the expression of dystrophin and laminin alpha2 surrogates.</a> Mol Ther. 22, 713-724 (2014).</li><li>Vouillot, L., Thelie, A., Pollet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+T7E1+and+surveyor+mismatch+cleavage+assays+to+detect+mutations+triggered+by+engineered+nucleases.">Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases.</a> G3. 5, 407-415 (2015).</li><li>Tsai, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GUIDE-seq+enables+genome-wide+profiling+of+off-target+cleavage+by+CRISPR-Cas+nucleases.">GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.</a> Nat Biotechnol. 33, 187-197 (2015).</li></ol>

No conflict of interest exists.

In this protocol, we detail all the steps necessary to achieve in vivo cardiac gene editing in postnatal mice using rAAVrh.74-mediated delivery of SaCas9 and two gRNAs. As previously noted, this approach can be used to restore dystrophin expression in dystrophic mice as described in our work27, but it could also enable rapid reverse genetics studies of cardiac-related genes in mice without the lengthy process of the traditional knockout approach to generate and breed knockout mouse models.
In order to achieve high gene editing efficiency in the target tissue, there are several critical steps to keep in mind: 1) the efficacy of the SaCas9/gRNA to induce the deletion of targeted genomic DNA needs to be validated using appropriate cell lines; 2) it is very crucial to select a proper AAV serotype that can mediate a high level of gene transduction into the target tissue and 3) determine the optimal delivery route of AAV vectors for gene transfer to the desired tissue.
In the current protocol, the designed SaCas9/gRNAs were packaged into AAVrh.74 rather than previously reported AAV8 and AAV9 to edit Dmd gene12,28. AAVrh.74 exhibits about 93% homology to AAV829 and has been shown to be non-pathogenic and effective in transducing skeletal muscle following isolated limb delivery29,30,31. In this protocol, we use retro-orbital and intraperitoneal injection of rh.74 into neonatal mice for cardiac gene transfer. We found that the neonate administration of rAAVrh.74 is highly efficient for the restoration of dystrophin expression in about 30-40% of cardiomyocytes in the mice receiving a high dosage of rAAVrh.74 (1 x 1012 vg). Interestingly, we found that the skeletal muscle dystrophin expression was not effectively rescued. This is likely due to the low skeletal muscle tropism of rh.74 serotype when administered via intravenous or intraperitoneal injection, although previous studies showed that isolated limb delivery of rAAVrh.74 can effectively transduce mouse and monkey skeletal muscle29,30,31. Also, when the rAAVrh.74 was administered into adult mice, we observed very low efficiency in restoring dystrophin expression. It would be interesting to determine the minimum dosage which is required to achieve the highest dystrophin rescue. Furthermore, other serotypes and delivery methods can be tested and compared for achieving optimal cardiac gene editing.
Successful deletion of a large genomic DNA piece requires simultaneous delivery of two gRNAs. We found it is not necessary to make two separate rAAV preparations for delivering two gRNAs. In this protocol, we simply mixed the two gRNA plasmids in an equal amount during transfection for rAAV production, and this combined production of rAAV was found to be effective in delivering both gRNAs. This combined approach is, therefore, cost- and labor-saving and recommended when simultaneous delivery of two gRNAs are required.
In many cases, it may be necessary to analyze the gene editing efficiency by genetic approaches when a good antibody is not available for the target gene product. However, it is technically challenging to accurately quantify the gene editing efficacy with two gRNAs targeting the same locus since the gene editing products would include target sequence deletion, target sequence inversion, and small indels at only one target site. Instead, it is more meaningful and feasible to quantify the efficiency of the desired targeted sequence deletion as in our case where the reduction of the transcripts containing exons 21-23 can be quantified by real-time RT-PCR.
In this protocol, we also describe the use of T7E1 assay and computational prediction to analyze the potential off-target activity. For the assay to work well, it is necessary to use a high-fidelity DNA polymerase. Also, it is always a good idea to prepare for a negative control experiment (e.g. control DNA products amplified from the cells/tissues without gene editing, and treated the same way as the test samples) and a positive control experiment (e.g. a known sample with well-characterized gene editing). However, it is of note that the detection limit of the T7E1 assay is about 5%32, and thus it may not be detectable by the T7E1 assay if the off-target activity is below 5%. GUIDE-seq33 can be used to unbiasedly analyze the off-target activity of the SaCas9/gRNA-mediated gene editing. The identified off-target sites from T7E1 assay, computational prediction and/or GUIDE-seq approaches can further be quantified for indel frequencies following in vivo gene editing by high-throughput sequencing.
Taken together, we have provided an optimized cardiac gene editing approach using rAAVrh.74. This established protocol can be further tested for therapeutic applications and reverse genetic studies.

The clustered, regularly interspaced, short palindromic repeat (CRISPR) technology represents the most recent advancement in genome engineering and has revolutionized the current practice of genetics in cells and organisms. CRISPR-based genome editing utilizes a single guide RNA (gRNA) to direct a CRISPR-associated endonuclease such as CRISPR-associated protein 9 (Cas9) and Cpf1 to a genomic DNA target that is complementary in sequence to the protospacer encoded by the gRNA with a specific protospacer adjacent motif (PAM)1,2. The PAM varies depending on the bacterial species of the Cas9 or Cpf1 gene. The most commonly used Cas9 nuclease derived from Streptococcus pyogenes (SpCas9) recognizes a PAM sequence of NGG that is found directly downstream of the target sequence in the genomic DNA, on the non-target strand. At the target site, the Cas9 and Cpf1 proteins generate a double-strand break (DSB), which is then repaired via intrinsic cellular DNA repair mechanisms including non-homologous end joining (NHEJ) and homology-directed repair (HDR) pathways3,4. In the absence of a DNA template for homologous recombination, the DSB is primarily repaired by the error-prone NHEJ pathway, which can result in insertions or deletions (indels) of nucleotides causing frameshift mutations if the DSB were created in the coding region of a gene5,6. Thus, the CRISPR system has been widely used to engineer loss-of-function mutations in various cellular models and whole organisms, in order to investigate the function of a gene. Moreover, the catalytically inactive Cas9 and Cpf1 have been developed to transcriptionally and epigenetically modulate the expression of target genes7,8.
More recently, both SpCas9 and SaCas9 (derived from Staphylococcus aureus) have been packaged into recombinant adeno-associated virus (rAAV) vectors for postnatal gene correction in the animal model of human diseases, particularly, Duchenne muscular dystrophy (DMD)9,10,11,12,13,14,15. DMD is a fatal X-linked recessive disease caused by mutations in the DMD gene, which encodes dystrophin protein16,17, affecting approximately one in 3500 male births according to newborn screening18,19. It is characterized by progressive muscle weakness and wasting. The DMD patients usually lose the ability to walk between 10 and 12 years of age and die of respiratory and/or cardiac failure by the age of 20-30 years20. Notably, cardiomyopathy develops in &#62;90% of DMD patients and represents the leading cause of death in DMD patients21,22. Although Deflazacort (an anti-inflammation drug) and Eteplirsen (an exon skipping medicine for skipping exon 51) have recently been approved for DMD by Food and Drug Administration (FDA)23,24, none of these treatments correct the genetic defect at the genomic DNA level. The mdx mouse, which carries a point mutation at exon 23 of the dystrophin gene, has been widely used as a DMD model25. Furthermore, we previously demonstrated that the functional dystrophin expression was restored by in-frame deletion of the genomic DNA covering exons 21, 22 and 23 in skeletal muscles of mdx mice using intramuscular Ad-SpCas9/gRNA delivery9, and in the heart muscles of mdx/utrophin+/- mice using intravenous and intraperitoneal rAAVrh.74-SaCas9/gRNA delivery26.
In this protocol, we describe in detail every step in postnatal cardiac gene editing to restore dystrophin in mdx/utrophin+/- mice using rAAVrh.74-SaCas9/gRNA vectors, from gRNA design to dystrophin analysis in the heart muscle sections.

<table><tbody><tr><td>Alexa Fluor 555 goat anti-rabbit IgG</td><td>Thermo Fisher Scientific</td><td>A-21428</td><td></td></tr><tr><td>Benzonase Nuclease</td><td>Sigma-Aldrich</td><td>E1014</td><td></td></tr><tr><td>Bio Safety Cabinets</td><td>Thermo Fisher Scientific</td><td>1347</td><td>1300 Series A2 Class II, Type A2</td></tr><tr><td>BsaI</td><td>New England BioLabs Inc</td><td>RO535S</td><td></td></tr><tr><td>Competent cells</td><td>Agilent Technologies</td><td>200314</td><td></td></tr><tr><td>Cell culture dishes, 150mm</td><td>Nest Scientific USA</td><td>715001</td><td></td></tr><tr><td>Cryostat</td><td>Leica Biosystems</td><td></td><td>Leica CM3050S</td></tr><tr><td>DMEM</td><td>Thermo Fisher Scientific</td><td>MT10017CV</td><td>Corning cellgro</td></tr><tr><td>Dystrophin antibody</td><td>Spring Bioscience</td><td>E2660</td><td></td></tr><tr><td>Fast-Ion Midi Plasmdi Kits</td><td>IBI Scientific</td><td>IB47111</td><td></td></tr><tr><td>FBS</td><td>Thermo Fisher Scientific</td><td>26-140-079</td><td></td></tr><tr><td>Filter Unit, 0.45&amp;mu;m</td><td>Thermo Fisher Scientific</td><td>166-0045</td><td></td></tr><tr><td>GoTaq Master Mixes</td><td>Promega</td><td>M7122</td><td></td></tr><tr><td>High-speed plasmid mini kit</td><td>IBI Scientific</td><td>IB47102</td><td></td></tr><tr><td>Horse serum</td><td>Abcam</td><td>ab139501</td><td></td></tr><tr><td>Isotemp 2239 Water Bath</td><td>Thermo Fisher Scientific</td><td>15-460-11Q</td><td></td></tr><tr><td>Isotemp Heat Block</td><td>Thermo Fisher Scientific</td><td>11-718</td><td></td></tr><tr><td>Inverted confocal microscope</td><td>Carl Zeiss Microscopy, LLC</td><td></td><td>LSM 780</td></tr><tr><td>LightCycler 480 instrument</td><td>Roche</td><td>5015243001</td><td>LightCycler 480 Instrument II</td></tr><tr><td>Large Capacity Centrifuge</td><td>Thermo Fisher Scientific</td><td>46-910</td><td>Thermo Scientific Sorvall RC 6 Plus</td></tr><tr><td>Microcentrifuge</td><td>Thermo Fisher Scientific</td><td>75002445</td><td>Sorvall Legend Micro 21R</td></tr><tr><td>Nanodrop spectrophotometers</td><td>Thermo Scientific</td><td>ND2000CLAPTOP</td><td>NanoDrop&amp;trade; 2000/2000c</td></tr><tr><td>Oligos for i20-F</td><td>Integrated DNA Technologies</td><td></td><td>CACCgGGCGT&lt;br/&gt;TGAAATTCTCATTAC</td></tr><tr><td>Oligos for i20-R</td><td>Integrated DNA Technologies</td><td></td><td>AAAC GTAATGAGAATTTCAACGCCc;</td></tr><tr><td>Oligos for i23-F</td><td>Integrated DNA Technologies</td><td></td><td>CACCgCACCGATGAGAGGG&lt;br/&gt;AAAGGTC</td></tr><tr><td>Oligos for i23-R</td><td>Integrated DNA Technologies</td><td></td><td>GACCTTTCCCTCTCATCGGTGc</td></tr><tr><td>Oligos</td><td>Integrated DNA Technologies</td><td></td><td></td></tr><tr><td>OptiPrep Density Gradient Medium</td><td>Sigma-Aldrich</td><td>D1556-250ML</td><td></td></tr><tr><td>OptiMEM</td><td>Thermo Fisher Scientific</td><td>31985070</td><td></td></tr><tr><td>PEG8000</td><td>Sigma-Aldrich</td><td>89510-1kg-F</td><td></td></tr><tr><td>Polyethylenimine</td><td>Polysciences</td><td>23966</td><td></td></tr><tr><td>Proteinase K</td><td>Sigma-Aldrich</td><td>P2308</td><td></td></tr><tr><td>Quick-Seal centrifuge tube</td><td>Beckman Coulter Inc</td><td>342414</td><td></td></tr><tr><td>QIAquick Gel Extraction kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>Radiant SYBR Green Hi-ROX qPCR Kits</td><td>Alkali Scientific</td><td>QS2005</td><td></td></tr><tr><td>RevertAid RT Reverse Transcription Kit</td><td>Thermo Fisher Scientific</td><td>K1691</td><td></td></tr><tr><td>Rotor</td><td>Beckman Coulter Inc</td><td>337922</td><td>Type 70Ti</td></tr><tr><td>T4 DNA ligase</td><td>New England BioLabs Inc</td><td>M0202S</td><td></td></tr><tr><td>Thermal Cycler</td><td>Bio-rad</td><td>1861096</td><td></td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific</td><td>15596026</td><td></td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter Inc</td><td>8043-30-1192</td><td>Optima le-80k</td></tr><tr><td>Ultra centrifugal filter unit</td><td>MilliporeSigma</td><td>UFC510096</td><td></td></tr><tr><td>VECTASHIELD Mounting Medium with DAPI</td><td>Vector Laboratories, Inc</td><td>H-1200</td><td></td></tr></tbody></table>

adeno-associated virus-mediated delivery of crispr for cardiac gene editing in mice

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

The efficacy of the gRNAs to induce the deletion of the target genomic DNA region should be evaluated in cell cultures before packaging into rAAV for in vivo studies. To this end, the gRNAs and SaCas9-expressing constructs were electroporated into C2C12 cells and the genomic DNA was analyzed by PCR with the primers flanking the target sites (Figure 1). A PCR product of ~500 bp indicates successful deletion of the target genomic DNA resulting from gene editing while the control cells should not yield a band due to the large size of the genomic DNA.
Once the efficacy of the gRNAs has been confirmed in cell cultures, they can be packaged into rAAVrh.74 or other serotypes (such as AAV6, 8 or 9, all showing robust cardiac gene delivery) by using the three plasmids co-transfection into AAV293 cells. We found that it is not necessary to make two individual rAAV preparation for the two gRNAs, instead, we mixed the two gRNA constructs in an equal molar ratio and produced a single rAAV preparation. The rAAV viral particles were purified using density gradient ultracentrifugation and the purity was analyzed by SDS-PAGE. The highly purified rAAV preparation would yield only three bands corresponding to the capsid proteins VP1, VP2, and VP3, respectively, on SDS-PAGE as shown in Figure 2.
The purified rAAVrh.74 viral particles were injected into day 1-3 neonates of mdx/utrophin+/- mice via retro-orbital or intraperitoneal injection. We found both methods worked well for cardiac delivery of the rAAVrh.74-CRISPR. The injected mice can be analyzed for dystrophin expression by immunofluorescence staining (Figure 3) at 10 weeks of age.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57560/57560fig1.jpg" /> 
Figure 1: Validation of the gRNAs for SaCas9-mediated gene editing in C2C12 cells. The representative agarose gel electrophoresis showed the PCR products of genomic DNA extracted from electroporated C2C12 with or without SaCas9/gRNAs. The arrow indicates the PCR product resulted from gene editing. Gapdh served as a reference. <a href="/files/ftp_upload/57560/57560fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57560/57560fig2.jpg" /> 
Figure 2: Analysis of rAAVrh.74 particles by SDS-PAGE. Purified rAAVrh.74 viral particles run on SDS-PAGE showed three bands, corresponding to the three capsid proteins of AAV, VP1 (87 kDa), VP2 (72 kDa) and VP3 (62 kDa), respectively. The presence of only these 3 bands indicates the high purity of the rAAV preparation without contaminating other cellular proteins. <a href="/files/ftp_upload/57560/57560fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57560/57560fig3.jpg" /> 
Figure 3: Immunofluorescence staining of the heart sections from mdx/utrophin+/- mice at 10 weeks following AAV-SaCas9/gRNAs treatment. The representative immunofluorescence images showed the expression of dystrophin (red) and caveolin-3 (green) in the heart sections of WT, mdx/utrophin+/- and mdx/utrophin+/- mice treated with 1 x 1012 vg AAV-SaCas9/gRNA systemically. DAPI was used to label the nuclei (blue). Scale bar: 100 &#181;m. <a href="/files/ftp_upload/57560/57560fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice at JoVE.com

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and ...

adeno-associated-virus-mediated-delivery-crispr-for-cardiac-gene

Nanyang Technological University

Research

JoVE Journal

Medicine

8.1K Views.  Ohio State University Wexner Medical Center. Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

Video: Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

Genetics

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Cancer Research

CRISPR-Cas9 Genome Editing of Rat Embryos using Adeno-Associated Virus (AAV) and 2-Cell Embryo Electroporation

Genome editing technology is widely used to produce genetically modified animals, including rats. Cytoplasmic or pronuclear injection of DNA repair templates and CRISPR-Cas reagents is the most common delivery method into embryos. However, this type of micromanipulation necessitates access to specialized equipment, is laborious, and requires a certain level of technical skill. Moreover, microinjection techniques often result in lower embryo survival due to the mechanical stress on the embryo. In this protocol, we developed an optimized method to deliver large DNA repair templates to work in conjunction with CRISPR-Cas9 genome editing without the need for microinjection. This protocol combines AAV-mediated DNA delivery of single-stranded DNA donor templates along with the delivery of CRISPR-Cas9 ribonucleoprotein (RNP) by electroporation to modify 2-cell embryos. Using this novel strategy, we have successfully produced targeted knock-in rat models carrying insertion of DNA sequences from 1.2 to 3.0 kb in size with efficiencies between 42% and 90%.

CRISPR-Cas9 Genome Editing of Rat Embryos using Adeno-Associated Virus AAV and 2-Cell Embryo Electroporation

This protocol presents an optimized approach for producing genetically modified rat models. Adeno-associated virus (AAV) is used to deliver a DNA repair template, and electroporation is used to deliver CRISPR-Cas9 reagents to complete the genome editing process in 2-cell embryo.

Genome editing technology is widely used to produce genetically modified animals, including rats. Cytoplasmic or pronuclear injection of DNA repair ...

Efficient Genome Editing of Mice by CRISPR Electroporation of Zygotes

With exceptional efficiency, accuracy, and ease, the CRISPR/Cas9 system has significantly improved genome editing in cell culture and lab animal experiments. When generating animal models, the electroporation of zygotes offers higher efficiency, simplicity, cost, and throughput as an alternative to the gold standard method of microinjection. Electroporation is also gentler, with higher viability, and reliably delivers Cas9/single-guide RNA (sgRNA) ribonucleoproteins (RNPs) into the zygotes of common laboratory mouse strains (e.g., C57BL/6J and C57BL/6N) that approaches 100% delivery efficiency. This technique enables insertion/deletion (indels) mutations, point mutations, the deletion of whole genes or exons, and small insertions in the range of 100-200 bp to insert LoxP or short tags like FLAG, HA, or V5. While constantly being improved, here we present the current state of CRISPR-EZ in a protocol that includes sgRNA production through in vitro transcription, embryo processing, RNP assembly, electroporation, and the genotyping of preimplantation embryos. A graduate-level researcher with minimal experience manipulating embryos can obtain genetically edited embryos in less than 1 week using this protocol. Here, we offer a straightforward, low-cost, efficient, high-capacity method that could be used with mouse embryos.

Here, we describe a simple technique intended for the efficient generation of genetically modified mice called CRISPR RNP Electroporation of Zygotes (CRISPR-EZ). This method delivers editing reagents by electroporation into embryos at an efficiency approaching 100%. This protocol is effective for point mutations, small genomic insertions, and deletions in mammalian embryos.

With exceptional efficiency, accuracy, and ease, the CRISPR/Cas9 system has significantly improved genome editing in cell culture and lab animal ...

Developmental Biology

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

Neuroscience

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Immunology and Infection

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. In vivo cardiac-specific gene delivery is commonly achieved by either systemic or local delivery. Systemic injection via tail vein is easy and efficient in manipulating cardiac gene expression by using recombinant adeno-associated virus 9 (AAV9). However, this method requires a relatively high amount of vector for efficient transduction, and may result in nontarget organ gene transduction. Here, we describe a simple, efficient, and time-saving method of intramyocardial injection for in vivo cardiac-specific gene manipulation in mice. Under anesthesia (without ventilation), the pectoral major and minor muscles were bluntly dissected, and the mouse heart was quickly exposed by manual externalization through a small incision at the fourth intercostal space. Subsequently, adenovirus encoding luciferase (Luc) and vitamin D receptor (VDR), or short hairpin RNA (shRNA) targeting VDR, was injected with a Hamilton syringe into the myocardium. Subsequent in vivo imaging demonstrated that luciferase was successfully overexpressed specifically in the heart. Moreover, Western blot analysis confirmed the successful overexpression or silencing of VDR in the mouse heart. Once mastered, this technique can be used for gene manipulation, as well as injection of cells or other materials such as nanogels in the mouse heart.

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Here we present a protocol for cardiac-specific gene manipulation in mice. Under anesthesia, the mouse hearts were externalized through the fourth intercostal space. Subsequently, adenoviruses encoding specific genes were injected with a syringe into the myocardium, followed by protein expression measurement via in vivo imaging and Western blot analysis.

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. ...

Biology

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

CRISPR-Cas9-Mediated Precise Knock-In Edits in Zebrafish Hearts

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological phenomena. Zebrafish have been used as an effective genetic model to study numerous questions related to heritable disease, development, and toxicology at the whole-organ and -organism level. Due to the well-annotated and mapped zebrafish genome, numerous tools for gene editing have been developed. However, the efficacy of generating and ease of detecting precise knock-in edits using CRISPR is a limiting factor. Described here is a CRISPR-Cas9-based knock-in approach with the simple detection of precise edits in a gene responsible for cardiac repolarization and associated with the electrical disorder, Long QT Syndrome (LQTS). This two-single-guide RNA (sgRNA) approach excises and replaces the target sequence and links a genetically encoded reporter gene. The utility of this approach is demonstrated by describing non-invasive phenotypic measurements of cardiac electrical function in wild-type and gene-edited zebrafish larvae. This approach enables the efficient study of disease-associated variants in a whole organism. Furthermore, this strategy offers possibilities for the insertion of exogenous sequences of choice, such as reporter genes, orthologs, or gene editors.

This protocol describes an approach to facilitate precise knock-in edits in zebrafish embryos using CRISPR-Cas9 technology. A phenotyping pipeline is presented to demonstrate the applicability of these techniques to model a Long QT Syndrome-associated gene variant.

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological ...

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive molecules. The creation of BAT-specific knockout mice is one of the most popular approaches for understanding the contribution of a gene of interest to BAT-mediated energy regulation. The conventional gene targeting strategy utilizing the Cre-LoxP system has been the principal approach to generate tissue-specific knockout mice. However, this approach is time-consuming and tedious. Here, we describe a protocol for the rapid and efficient knockout of a gene of interest in BAT using a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The interscapular BAT is located in the deep layer between the muscles. Thus, the BAT must be exposed in order to inject the AAV precisely and directly into the BAT within the visual field. Appropriate surgical handling is crucial to prevent damage to the sympathetic nerves and vessels, such as the Sultzer's vein that connects to the BAT. To minimize tissue damage, there is a critical need to understand the three-dimensional anatomical location of the BAT and the surgical skills required in the technical steps. This protocol highlights the key technical procedures, including the design of sgRNAs targeting the gene of interest, the preparation of AAV-sgRNA particles, and the surgery for the direct microinjection of AAV into both BAT lobes for generating BAT-specific knockout mice, which can be broadly applied to study the biological functions of genes in BAT.

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive ...

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

CRISPR-Cas9 Genome Editing of Rat Embryos using Adeno-Associated Virus (AAV) and 2-Cell Embryo Electroporation

Efficient Genome Editing of Mice by CRISPR Electroporation of Zygotes

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

CRISPR-Cas9-Mediated Precise Knock-In Edits in Zebrafish Hearts

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System