We thank Karyn Esser, Nobuya Koike and Noheon Park for helpful advice. This work was in part supported by NIH/NIGMS (R01GM114424) to S.-H.Y., and the Robert A. Welch Foundation (AU-1731) and NIH/NIA (R01AG045828) to Z.C.

Animal care was performed under Institutional Animal Care and Use Committee (IACUC) guidelines, and the procedures were conducted according to an animal protocol approved by the University of Texas Health Science Center at Houston.
1. Nuclei Isolation from Cross-linked Skeletal Muscle
<ol>
	<li>Weigh and mince hind limb skeletal muscle, isolated from approximately 20-week old C57BL/6 male mice, in ice-cold phosphate buffered saline (PBS) as described in detail previously22. 
	NOTE: We usually obtain 1.0 - 1.5 g of skeletal muscle from one mouse.
	<ol>
		<li>Place minced skeletal muscle tissue in a 50-mL conical tube containing 10 mL PBS on ice.</li>
	</ol>
	</li>
	<li>Centrifuge at 300 x g at 4 &#176;C for 5 min.</li>
	<li>Carefully remove PBS supernatant by aspiration.</li>
	<li>Estimate pellet volume in each 50-mL tube by using reference tubes with 1, 2, 3 and 4 mL of water.</li>
	<li>Add 7 volumes of ice-cold 1% formaldehyde in PBS and homogenize the samples on ice using a probe tissue homogenizer (see Table of Materials). 
	NOTE: Optional: The homogenization procedure can be conducted in a cold room.</li>
	<li>Cross-link the sample by incubating at room temperature for 10 min.</li>
	<li>Quench the cross-linking reaction by the addition of 1 M glycine to a final concentration of 0.125 M and incubate for 5 min at room temperature.</li>
	<li>Centrifuge the samples at 3,000 x g for 5 min at 4 &#176;C. Remove the supernatant via aspiration.</li>
	<li>Rinse with 10 mL of ice-cold base buffer (10 mM HEPES-KOH at pH 7.3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl2, 0.5 mM DTT) containing freshly added protease inhibitors (0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 10 &#181;g/mL leupeptin). Centrifuge at 3,000 g for 5 min at 4 &#176;C and carefully remove the supernatant by aspiration.</li>
	<li>Resuspend the pellet in 6 mL of lysis buffer (10 mM HEPES-KOH at pH 7.3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl2, 0.5 mM DTT, 1% Triton X-100) containing freshly added protease inhibitors (0.2 mM PMSF, and 10 &#181;g/mL leupeptin).</li>
	<li>Transfer the sample to a prechilled 15 mL Dounce homogenizer and incubate for 10 min on ice.Dounce homogenize each sample on ice with 15 slow strokes using loose pestle followed by 15 strokes with tight pestle to release the nuclei.</li>
	<li>Filter the homogenate (6 mL) through cell strainer (pore size: 100 &#181;m) and rinse with 4 mL of lysis buffer. Centrifuge the samples at 1,000 x g for 10 min at 4 &#176;C. Resuspend into 5 mL of ice-cold base buffer and dounce 10 times with tight pestle to release nuclei.
	<ol>
		<li>Remove an aliquot of 20 &#181;L for DNA concentration measurement with a spectrophotometer (OD260/OD280) and microscopic observation with trypan blue if necessary (see below) (Figure 1A).</li>
	</ol>
	</li>
	<li>Filter the suspension through a cell strainer (Pore size: 70 &#181;m), rinse the tube and filter again with 2 mL base buffer as above.</li>
	<li>Repeat the filtration as in step 1.13 with cell strainers of gradually reduced pore size (40 &#181;m, 30 &#181;m, 20 &#181;m and 10 &#181;m). 
	NOTE: In total, strainers of 6 pore sizes were used in steps 1.12-1.14.</li>
	<li>Centrifuge at 1,000 g at 4 &#176;C for 10 min. Remove supernatant and resuspend the pellet in 500 &#181;L base buffer.</li>
	<li>Measure DNA concentration as above. 
	NOTE: Approximately 200 &#181;g of nucleic DNA was obtained from combining both hind limbs from one animal. Optionally, save 20 &#181;L for microscopic observation with trypan blue staining (stock concentration 0.4%, 1:5 dilution); nuclei will stain blue (Figure 1B).</li>
	<li>Centrifuge at 1,000 g at 4 &#176;C for 10 min, and discard the supernatant. Store pellet at -80 &#176;C.</li>
</ol>
2. Sonication
<ol>
	<li>Thaw samples in 500 &#181;L of SDS lysis buffer and resuspend with gentle pipetting.</li>
	<li>Transfer the nuclei DNA suspension to a glass vial on ice.</li>
	<li>Run the sonication with focused bursts of ultrasonic acoustic energy from a dish-shaped transducer. See Table of Materials for equipment details. Use the following setting: cycles per burst: 200; intensity: 5; duty cycle: 20; temperature 4 - 6 &#176;C; 30 s on/off. 
	NOTE: An example for evaluating sonication efficacy is shown in Figure 2.</li>
	<li>Transfer the sonicated chromatin to a 1.5 mL tube. Centrifuge at 12,000 x g for 15 min and transfer the supernatant to a new tube. Transfer 50 &#181;L of sonicated samples (~ 7 - 10 &#181;g/muscle sample) into a new 1.5 mL tube for reverse crosslinking overnight at 65 &#176;C. Freeze the remaining samples at -80 &#176;C.</li>
</ol>
3. Evaluation of Sonication and Quantitation
<ol>
	<li>Add 1.0 &#181;L of RNase A (500 U/mL RNase A: 20,000 U/mL RNase T1) to the saved 50 &#181;L sonicated samples and incubate for 30 min at 37 &#176;C.</li>
	<li>Add 8 &#181;L of protease K (10 mg/mL) and incubate 30 min at 55 &#176;C.</li>
	<li>Harvest the DNA by using a DNA extraction kit.
	<ol>
		<li>Add 5 volumes of binding buffer, apply it to spin column, and centrifuge at 4,000 x g, 10 min.</li>
		<li>Apply the pass-through onto the same column and centrifuge again.</li>
		<li>Wash with washing buffer two times at 13,000 x g, 1 min.</li>
		<li>Centrifuge again at 13,000 x g, 1 min to dry the column.</li>
		<li>Add 50 &#181;L of H2O and centrifuge at 13,000 x g, 1 min to elute DNA.</li>
		<li>Apply the pass-through onto the same column and centrifuge again.</li>
	</ol>
	</li>
	<li>Quantify the amount of DNA with a spectrophotometer (OD260/OD280). Run samples on 0.8% gels to evaluate the size and amount (1 &#181;g) of the sonicated products (Figure 2). 
	NOTE: The average chromatin yield is approximately ~ 20%.</li>
</ol>
4. ChIP
<ol>
	<li>Thaw the previously saved chromatin at -80 &#176;C and aliquot the chromatin to ~ 100 - 120 &#181;g per tube. Dilute 1:10 with radioimmunoprecipitation assay (RIPA) buffer (20mM Tris-HCl (pH 7.4), 150mM NaCl, 1mM EDTA, 1mM NaF, 1mM Na3VO4, 1mM PMSF, 1x Protease inhibitor cocktail (PIC), 0.1% Na-deoxycholate (w/v), 1% Triton X-100).
	<ol>
		<li>If there are multiple samples in each group, combine equal amounts of chromatin DNA to the final amount of ~ 100 - 120 &#181;g/sample. Save 10% as input.</li>
	</ol>
	</li>
	<li>Add 40 &#181;L (50% v/v slurry in RIPA buffer) of BSA-pre-blocked (~ 2 h, 4 &#176;C) Protein A/G agarose (non-Chicken antibody) or IgY beads (Chicken antibody) and incubate on a rotator for 3 h at 4 &#176;C.</li>
	<li>Centrifuge at 1,000 x g, 10 min and carefully transfer the supernatant to new tubes.</li>
	<li>Add antibodies at 1 &#181;g antibody per ~ 25 - 100 &#181;g chromatin DNA.</li>
	<li>Rotate gently at 4 &#176;C overnight at approximately 15 rpm.</li>
	<li>Add 10 &#181;L of BSA-pre-blocked (~2 h, 4 &#176;C) Protein A/G agarose (non-Chicken antibody) or IgY beads (Chicken antibody) mix and rotate in the cold room for 2 h.</li>
	<li>Wash beads as follows. Wash with 1 mL of RIPA buffer for 3 min twice, wash with 1 mL of high salt buffer&#160;(20mM Tris-HCl (pH 7.4), 500mM NaCl, 2mM EDTA, 1mM PMSF, 1% Triton X-100) for 3 min twice, wash with 1 mL of LiCl buffer&#160;(20mM Tris-HCl (pH 7.4), 250mM LiCl, 2mM EDTA, 1mM PMSF, 1% Na-deoxycholate, 0.5% NP40) for 3 min twice.
	<ol>
		<li>Wash with 1 mL of Tris-EDTA (TE) buffer&#160;(10mM Tris-HCl (pH 7.4), 1mM EDTA) for 3 min once. Then elute DNA with elution buffer (20 mM Tris-HCl, 5 mM EDTA and 0.5% SDS).</li>
	</ol>
	</li>
	<li>Centrifuge at 1,000 g, 1 min and carefully remove the supernatant.</li>
	<li>Resuspend the bead with 50 &#181;L of elution buffer.</li>
	<li>Incubate for 10 min at 65 &#176;C.</li>
	<li>Centrifuge at 12,000 g for 5 min.</li>
	<li>Transfer the supernatant to a new tube, add another 50 &#181;L and centrifuge once again at 12,000 g for 5 min. The final elution volume will be 100 &#181;L.</li>
	<li>Reverse crosslinking and DNA elution.
	<ol>
		<li>Incubate the eluted chromatin overnight at 65 &#176;C.</li>
		<li>Add 1.0 &#181;L of RNase A and incubate for 30 min at 37 &#176;C.</li>
		<li>Add 8 &#181;L of protease K (10 mg/mL) and incubate 30 min at 55 &#176;C.</li>
		<li>Harvest the DNA by using a PCR cleanup kit with elution volume at 50 &#181;L according to the manufacturer&#39;s protocol.</li>
	</ol>
	</li>
	<li>Analyze the profiles by Real-time qPCR as previously described25,26. 
	NOTE: The primer sequences are listed in Figure 3 Legend. Data are presented as mean &#177; SEM (Figure 3).</li>
</ol>

<ol>
	<li>Bouzakri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA-based+gene+silencing+reveals+specialized+roles+of+IRS-1/Akt2+and+IRS-2/Akt1+in+glucose+and+lipid+metabolism+in+human+skeletal+muscle.">siRNA-based gene silencing reveals specialized roles of IRS-1/Akt2 and IRS-2/Akt1 in glucose and lipid metabolism in human skeletal muscle.</a> Cell Metab. 4 (1), 89-96 (2006).</li><li>Boucher, J., Kleinridders, A., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+receptor+signaling+in+normal+and+insulin-resistant+states.">Insulin receptor signaling in normal and insulin-resistant states.</a> Cold Spring Harb Perspect Biol. 6 (1), (2014).</li><li>Green, C. B., Takahashi, J. S., Bass, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+meter+of+metabolism.">The meter of metabolism.</a> Cell. 134 (5), 728-742 (2008).</li><li>Liu, A. C., Lewis, W. G., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+circadian+signaling+networks+and+therapeutic+targets.">Mammalian circadian signaling networks and therapeutic targets.</a> Nat Chem Biol. 3 (10), 630-639 (2007).</li><li>Harfmann, B. D., Schroder, E. A., Esser, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circadian+rhythms,+the+molecular+clock,+and+skeletal+muscle.">Circadian rhythms, the molecular clock, and skeletal muscle.</a> J Biol Rhythms. 30 (2), 84-94 (2015).</li><li>Nohara, K., Yoo, S. H., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulating+the+circadian+and+sleep+cycles+to+protect+against+metabolic+disease.">Manipulating the circadian and sleep cycles to protect against metabolic disease.</a> Front Endocrinol (Lausanne). 6, 35 (2015).</li><li>Harfmann, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle-specific+loss+of+Bmal1+leads+to+disrupted+tissue+glucose+metabolism+and+systemic+glucose+homeostasis.">Muscle-specific loss of Bmal1 leads to disrupted tissue glucose metabolism and systemic glucose homeostasis.</a> Skelet Muscle. 6, 12 (2016).</li><li>Pedersen, B. K., Febbraio, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscles,+exercise+and+obesity:+skeletal+muscle+as+a+secretory+organ.">Muscles, exercise and obesity: skeletal muscle as a secretory organ.</a> Nat Rev Endocrinol. 8 (8), 457-465 (2012).</li><li>Solomon, M. J., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde-mediated+DNA-protein+crosslinking:+a+probe+for+in+vivo+chromatin+structures.">Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures.</a> Proc Natl Acad Sci U S A. 82 (19), 6470-6474 (1985).</li><li>Jackson, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+histone+organization+in+the+nucleosome+using+formaldehyde+as+a+reversible+cross-linking+agent.">Studies on histone organization in the nucleosome using formaldehyde as a reversible cross-linking agent.</a> Cell. 15 (3), 945-954 (1978).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Takahashi, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+RNA-seq+methods+to+study+circadian+control+of+transcription+in+mammals.">ChIP-seq and RNA-seq methods to study circadian control of transcription in mammals.</a> Methods Enzymol. 551, 285-321 (2015).</li><li>Kuo, M. H., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+cross-linking+and+immunoprecipitation+for+studying+dynamic+Protein:DNA+associations+in+a+chromatin+environment.">In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment.</a> Methods. 19 (3), 425-433 (1999).</li><li>Chen, Z., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Core+promoter+elements+and+TAFs+contribute+to+the+diversity+of+transcriptional+activation+in+vertebrates.">Core promoter elements and TAFs contribute to the diversity of transcriptional activation in vertebrates.</a> Mol Cell Biol. 23 (20), 7350-7362 (2003).</li><li>Menet, J. S., Abruzzi, K. C., Desrochers, J., Rodriguez, J., Rosbash, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+PER+repression+mechanisms+in+the+Drosophila+circadian+clock:+from+on-DNA+to+off-DNA.">Dynamic PER repression mechanisms in the Drosophila circadian clock: from on-DNA to off-DNA.</a> Genes Dev. 24 (4), 358-367 (2010).</li><li>Miki, T., Matsumoto, T., Zhao, Z., Lee, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p53+regulates+Period2+expression+and+the+circadian+clock.">p53 regulates Period2 expression and the circadian clock.</a> Nat Commun. 4, 2444 (2013).</li><li>Furey, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+beyond:+new+and+improved+methodologies+to+detect+and+characterize+protein-DNA+interactions.">ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions.</a> Nat Rev Genet. 13 (12), 840-852 (2012).</li><li>Koike, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+and+chromatin+landscape+of+the+core+circadian+clock+in+mammals.">Transcriptional architecture and chromatin landscape of the core circadian clock in mammals.</a> Science. 338 (6105), 349-354 (2012).</li><li>Zhou, J., Yu, W., Hardin, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPping+away+at+the+Drosophila+clock.">ChIPping away at the Drosophila clock.</a> Methods Enzymol. 551, 323-347 (2015).</li><li>Takahashi, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+of+the+mammalian+circadian+clock.">Transcriptional architecture of the mammalian circadian clock.</a> Nat Rev Genet. , (2016).</li><li>Edelman, J. C., Edelman, P. M., Kniggee, K. M., Schwartz, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+skeletal+muscle+nuclei.">Isolation of skeletal muscle nuclei.</a> J Cell Biol. 27 (2), 365-377 (1965).</li><li>Ohkawa, Y., Mallappa, C., Vallaster, C. S., Imbalzano, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+nuclei+from+skeletal+muscle+satellite+cells+and+myofibers+for+use+in+chromatin+immunoprecipitation+assays.">Isolation of nuclei from skeletal muscle satellite cells and myofibers for use in chromatin immunoprecipitation assays.</a> Methods Mol Biol. 798, 517-530 (2012).</li><li>Wilkie, G. S., Schirmer, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+nuclei+and+preparation+of+nuclear+envelopes+from+skeletal+muscle.">Purification of nuclei and preparation of nuclear envelopes from skeletal muscle.</a> Methods Mol Biol. 463, 23-41 (2008).</li><li>Hahn, C. G., Covault, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+transcriptionally+active+nuclei+from+striated+muscle+using+Percoll+density+gradients.">Isolation of transcriptionally active nuclei from striated muscle using Percoll density gradients.</a> Anal Biochem. 190 (2), 193-197 (1990).</li><li>Jeong, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+attenuation+of+proteasomal+and+autophagic+BMAL1+degradation+in+Clock+Delta19/++mice+contributes+to+improved+glucose+homeostasis.">Dual attenuation of proteasomal and autophagic BMAL1 degradation in Clock Delta19/+ mice contributes to improved glucose homeostasis.</a> Scientific reports. 5, 12801 (2015).</li><li>Nohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonia-lowering+activities+and+carbamoyl+phosphate+synthetase+1+(Cps1)+induction+mechanism+of+a+natural+flavonoid.">Ammonia-lowering activities and carbamoyl phosphate synthetase 1 (Cps1) induction mechanism of a natural flavonoid.</a> Nutrition &amp; metabolism. 12, 23 (2015).</li><li>Zhang, L., Rubins, N. E., Ahima, R. S., Greenbaum, L. E., Kaestner, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Foxa2+integrates+the+transcriptional+response+of+the+hepatocyte+to+fasting.">Foxa2 integrates the transcriptional response of the hepatocyte to fasting.</a> Cell Metab. 2 (2), 141-148 (2005).</li><li>Gade, P., Kalvakolanu, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+assay+as+a+tool+for+analyzing+transcription+factor+activity.">Chromatin immunoprecipitation assay as a tool for analyzing transcription factor activity.</a> Methods Mol Biol. 809, 85-104 (2012).</li><li>Kondratov, R. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMAL1-dependent+circadian+oscillation+of+nuclear+CLOCK:+posttranslational+events+induced+by+dimerization+of+transcriptional+activators+of+the+mammalian+clock+system.">BMAL1-dependent circadian oscillation of nuclear CLOCK: posttranslational events induced by dimerization of transcriptional activators of the mammalian clock system.</a> Genes Dev. 17 (15), 1921-1932 (2003).</li><li>Ripperger, J. A., Schibler, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhythmic+CLOCK-BMAL1+binding+to+multiple+E-box+motifs+drives+circadian+Dbp+transcription+and+chromatin+transitions.">Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions.</a> Nat Genet. 38 (3), 369-374 (2006).</li><li>Laplante, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DEPTOR+cell-autonomously+promotes+adipogenesis,+and+its+expression+is+associated+with+obesity.">DEPTOR cell-autonomously promotes adipogenesis, and its expression is associated with obesity.</a> Cell Metab. 16 (2), 202-212 (2012).</li><li>Blechman, J., Amir-Zilberstein, L., Gutnick, A., Ben-Dor, S., Levkowitz, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+metabolic+regulator+PGC-1alpha+directly+controls+the+expression+of+the+hypothalamic+neuropeptide+oxytocin.">The metabolic regulator PGC-1alpha directly controls the expression of the hypothalamic neuropeptide oxytocin.</a> J Neurosci. 31 (42), 14835-14840 (2011).</li></ol>

The authors have nothing to disclose.

Here we describe a robust method where cross-linked skeletal muscle tissues were used to isolate high-quality nuclei. Sequential filtration was carried out to effectively separate nuclei from debris, and ultrasonic acoustic energy from dish-shaped transducer sheared the chromatin for ChIP analysis. The results showed circadian time-specific binding of BMAL1 to target promoters.
ChIP can be employed to capture real-time protein occupancy on genomic DNA when cross-linking takes place. To take advantage of this potential, we aimed to develop a method to allow cross-linking of skeletal muscle at the time of tissue dissection and to streamline the nuclei isolation without gradient ultracentrifugation. Due to the difficulty of homogenizing fiber-rich skeletal muscle compared with soft tissues such as liver, we minced muscle tissue in ice-cold PBS and then homogenized the sample in a formaldehyde buffer. After quenching, tissue suspension was centrifuged and rinsed with ice-cold base buffer to rinse out any remaining formaldehyde. Nuclei were released by Dounce homogenization, and the homogenates were sequentially filtered to gradually remove cell debris and myofibrils. We devised the series of filtration to minimize filter clogging which could adversely impact yield. Only very short myofibrils remained when the sequential filtration was completed.
The sonication and ChIP procedures were adapted from a previous report12 with modifications including sonication timing and SDS buffer amount. The dish-shaped sonicator allows exposure to centralized ultrasonic wave for samples in glass vials in a cold water bath. Compared with probe sonicators, this sonicator controls the sample temperature to avoid overheating, and also prevents sample cross-contamination. If probe sonicators are used, optimal sonication conditions need to be determined empirically. We also reduced the amount of SDS buffer since the yield of muscle chromatin is lower than that in liver12. Several protocols28,31,32 include incubation on ice or at room temperature prior to sonication. However, in our experience, pre-incubation on ice did not improve the sonication efficiency. In fact, in some instances the sonication was compromised. It is possible that residual myofibrils entangled the chromatin DNA during incubation and attenuated sonication efficacy. With immediate sonication after nuclei suspension in SDS lysis buffer, we succeeded in obtaining progressive chromatin fragmentation with increasing sonication cycles (Figure 2).
We validated the quality of chromatin with ChIP qPCR. As shown in Figure 3, the BMAL1 promoter occupancy was robust at ZT6 and minimal at ZT18, consistent with previously shown BMAL1 circadian promoter binding18. This functional assay confirmed the quality of nuclei and chromatin. In recent years, rapid development in NGS opened up a new horizon for ChIP application where ChIP-seq can quantitatively interrogate genomic binding with high sensitivity17. Particularly for ChIP-seq, high-quality nuclei and chromatin are required to consistently capture protein-DNA interaction. The procedure described herein may constitute a valuable resource for ChIP-seq studies using skeletal muscle. Of note, ChIP-seq library preparation requires additional measures to improve signal resolution, such as PAGE-based size selection18.
In conclusion, we developed a filtration-based protocol to prepare high-quality nuclei from cross-linked skeletal muscle. We remove the need for ultracentrifugation, making it easily applicable. In addition to ChIP for genes of interest, the nuclei and chromatin prepared as described can be broadly applicable to ChIP-seq studies.

Skeletal muscle plays important roles in physiology and behavior. The multi-nucleated muscle fiber consists of myofibrils where actin and myosin form functional units called sarcomeres to generate contractile force. Skeletal muscle is also the largest metabolic organ in the body, accounting for &#62;80% postprandial glucose intake and regulating insulin response and metabolic homeostasis1,2. Muscle physiology and metabolism are closely regulated by the circadian clock, an intrinsic biological timer3,4,5,6. For example, the skeletal muscle-specific deletion of Bmal1, one of the core circadian clock components, resulted in insulin resistance and diminished glucose uptake in skeletal muscle, and the animals were found to develop type 2 diabetes7. In addition, skeletal muscle is also increasingly being appreciated as an endocrine organ8, secreting myokines to regulate systemic metabolism and physiology. Mechanistic studies are required to fully understand these regulatory functions in skeletal muscle.
ChIP is a powerful approach to delineate promoter recruitment of DNA binding proteins. ChIP was initially developed to identify nucleosome organization on chromatin DNA9,10. A variety of methods have since been reported to cross-link proteins and chromatin DNA using formaldehyde, dimethyl sulfate or ultraviolet irradiation (UV)11,12. Formaldehyde cross-linking is the most commonly used, preserving chromatin structure and DNA-protein interactions9,13,14. Cross-linked chromatin is shredded by sonication and immunoprecipitated with antibody against the particular DNA binding protein of interest15,16. In recent years, ChIP-sequencing (ChIP-seq), a method combining ChIP with NGS, has been developed to interrogate genome-wide transcription factor binding17, and in some cases to monitor dynamic changes over a time course18,19,20. For example, circadian ChIP-seq studies have revealed a highly orchestrated sequence of genomic binding of circadian clock components and histone markers, which drives temporally precise gene expression throughout the ~ 24 h circadian cycle18.
Most available ChIP protocols are designed for soft tissues (e.g. liver, brain, etc.), and very few have been published for hard tissues including skeletal muscle. It is technically challenging to homogenize fiber-rich skeletal muscle and isolate high-quality nuclei21, especially for ChIP experiments which require cross-linking. In a recent muscle ChIP study22, satellite cells were separated from myofibers, and nuclei were prepared from both cell types through a prolonged procedure involving tissue digestion. The entire process took approximately three hours to complete before formaldehyde cross-linking was performed on isolated nuclei. While this procedure avoided cross-linking muscle fiber, which makes muscle tissue even more refractory to efficient homogenization, and was able to produce high-quality nuclei, the significant time-lag from tissue collection to nuclei cross-linking incurs the risk of altered DNA-protein interaction. In contrast, most studies performed cross-linking immediately after experimental treatment or tissue collection in order to preserve the real-time DNA-protein binding12. A second drawback of nuclei isolation before cross-linking is that it precludes time-sensitive applications such as circadian sample collection which typically occurs at 3 - 4 h intervals. Without cross-linking the nuclei, the isolation needs to proceed immediately after dissection, whereas cross-linked samples can be processed together after the entire time course is completed, thus ensuring greater experimental consistency.
Other protocols for nuclei isolation from uncrosslinked skeletal muscle have also been reported. Two studies described the use of gradient ultracentrifugation to separate nuclei from remaining myofibrils and cell debris23,24. While sucrose or colloidal gradient ultracentrifugation is effective with uncrosslinked muscle tissues, our experiments revealed that after crosslinking, gradient ultracentrifugation failed to separate nuclei from cell debris on the gradient.
We therefore developed a procedure to isolate high-quality nuclei using cross-linked mouse skeletal muscle tissues. Rather than gradient ultracentrifugation, we devised a serial filtration method to effectively separate nuclei from debris. Following ultrasonication, the chromatin samples were successfully applied for ChIP studies which showed a circadian pattern of BMAL1 protein binding to target promoters. Our method can be broadly applicable to various mechanistic studies of muscle tissues.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Materials</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td style="width:288px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Formaldehyde solution</td>
			<td style="width:143px;">Sigma Aldrich</td>
			<td style="width:119px;">F8775&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Glycine</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">BP381-5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Trypan Blue solution (0.4%)</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">15250061</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">RNase A</td>
			<td style="width:143px;">Sigma Aldrich</td>
			<td style="width:119px;">10109142001</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Protease K</td>
			<td style="width:143px;">Sigma Aldrich</td>
			<td style="width:119px;">3115887001</td>
			<td></td>
		</tr>
		<tr height="57">
			<td height="57" style="height:57px;width:216px;">Chicken Anti-BMAL1 antibody</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td style="width:288px;">Generated in chicken (Cocalico Biologicals) against antigen aa 318-579, and IgY was affinity purified using the same antigen.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Chicken IgY Precipitating Resin</td>
			<td style="width:143px;">GenScript</td>
			<td style="width:119px;">L00405</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;"></td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Equipment</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:216px;">KINEMATICA&#160;Polytron PT2100 Benchtop Homogenizer</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">08-451-178</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">15mL Dounce tissue grinder</td>
			<td style="width:143px;">Whearton</td>
			<td style="width:119px;">357544</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Falcon Cell Strainers 100&#181;m</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">08-771-19</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Falcon Cell Strainers 70&#181;m</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">08-771-1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Falcon Cell Strainers 40&#181;m</td>
			<td style="width:143px;">Fisher Scientific</td>
			<td style="width:119px;">08-771-2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">pluriStrainer 30 &#181;m</td>
			<td style="width:143px;">PluriSelect</td>
			<td style="width:119px;">43-50030-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">pluriStrainer 20 &#181;m</td>
			<td style="width:143px;">PluriSelect</td>
			<td style="width:119px;">43-50020-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">pluriStrainer 10 &#181;m</td>
			<td style="width:143px;">PluriSelect</td>
			<td style="width:119px;">43-50010-03</td>
			<td></td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:216px;">Covaris S2 Focused-ultrasonicator</td>
			<td style="width:143px;">Covaris</td>
			<td style="width:119px;">Model S2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Labquake&#160;</td>
			<td>Thermo Scientific</td>
			<td>C415110</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCD Microscope Camera</td>
			<td>&#160;Leica Microsystems</td>
			<td>DFC3000 G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;"></td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Reagent Kit</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">DNA extraction kit</td>
			<td style="width:143px;">Thermo Scientific</td>
			<td style="width:119px;">K0691</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;"></td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Buffers</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="76">
			<td height="76" style="height:76px;width:216px;">All buffer components are discribed in the protocol. Each component was purchased from Sigma Aldrich</td>
			<td style="width:143px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

a filtration-based method of preparing high-quality nuclei from cross-linked skeletal muscle for chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.

Here we performed formaldehyde cross-linking immediately after tissue collection to preserve real-time DNA-protein interaction. However, we found that sucrose or colloidal gradient, commonly used for nuclei isolation23,24, was not effective in separating nuclei from myofibrils (data not shown). The reason may be that cross-linking conferred similar gravity for nuclei and myofibrils. Therefore, we developed a serial filtration process to effectively remove large myofibrils and other debris from the nuclei fraction. After 100 &#181;m filtration, there were still large tissue debris and myofibrils (Figure 1A). In comparison, at the end of the sequential filtration, the majority of large tissue debris, intact cells and large myofibrils were successfully removed (Figure 1B).
Those nuclei were used for dish-shaped ultrasonication. Nuclei stored at -80 &#176;C were suspended in SDS lysis buffer and immediately subjected to sonication. Although incubation of nuclei in SDS lysis buffer on ice or room temperature may improve sonication for some tissue such as liver27 or mouse embryonic fibroblast (MEF)28, in our experience it interfered with sonication of skeletal muscle nuclei and resulted in broad smearing, indicating ineffective sonication. Using the current protocol with immediate sonication after suspension in SDS lysis buffer we observed efficient sonication with chromatin gradually shredded in a cycle-dependent manner and eventually producing ~ 500 bp DNA fragments (Figure 2). Pre-incubation in the lysis buffer detectably compromised the sonication efficiency.
To confirm the quality of chromatin preparation for ChIP, we examined DNA binding of the circadian transcription factor BMAL1, which showed binding peak and trough at Zeitgeber time (ZT)6 and ZT18, respectively18,29. Skeletal muscle samples from C57B/6J mice were collected at ZT6 and ZT18, and chromatin samples were prepared as above. Briefly, after sonication, shredded chromatin samples were pre-cleared with IgY beads that have been pre-blocked with BSA followed by incubation with anti-BMAL1 antibody at 4 &#176;C overnight. After elution and purification of chromatin, we performed RT-qPCR to detect BMAL1 binding on E-Box elements of two target genes, Nr1d1 and Dbp30. We detected robust binding of BMAL1 to the E-box elements at ZT6 and minimal binding at ZT18 (Nr1d1: 0.452 &#177; 0.022 vs. 0.039 &#177; 0.002, Dbp -0.4: 0.627 &#177; 0.013 vs. 0.062 &#177; 0.009, Dbp +0.8: 0.176 &#177; 0.013 vs. 0.008 &#177; 0.001, Dbp +2.4: 0.466 &#177; 0.010 vs. 0.122 &#177; 0.014; all values are mean &#177; SEM) (Figure 3), validating the protocol for time-sensitive transcription factor binding analysis in skeletal muscle.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56013/56013fig1.jpg" /> 
Figure 1: Sequential Filtration Effectively Removed Tissue Debris. (A) Representative images showing samples after 100 &#181;m filtration. Large tissue and fiber debris are observed. (B) Representative images showing samples after serial filtration. Large fiber debris were cleared. Only isolated nuclei and small myofibril fragments are observed. Pictures were taken by using a light microscope at 10X, 20X and 40X magnifications. Scale bars are shown on the right hand side panels. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56013/56013fig2.jpg" /> 
Figure 2: Progressive Chromatin Shredding Through 10 Cycles of Sonication. Ten cycles of sonication with digested chromatin DNA to ~ 500 bp, as revealed in a 0.8 % agarose gel, run at 150 V for 60 min. The right panel indicates a lower sonication efficiency after pre-incubation in ice-cold SDS lysis buffer for 1 h. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56013/56013fig3.jpg" /> 
Figure 3: Representative qPCR Results for BMAL1 ChIP with Mouse Skeletal Muscle Samples Collected at ZT6 and ZT18. Data are presented as mean &#177; SEM. Dbp -0.4, +0.8 and +2.4 indicate locations of the E-Box elements on the Dbp gene. NC: negative control with IgY. The temporal pattern of BMAL1 binding is consistent with previous results showing BMAL1 binding peak at around ZT618. The forward and reverse primers are as follows. Rev-erba: 5&#39;-GTAGACTACAAATCCCAACAATCCTG, and 5&#39;-TGGAGCAGGTACCATGTGATTC; Dbp -0.4: 5&#39;-ACACCCGCATCCGATAGC, and 5&#39;-CCACTTCGGGCCAATGAG; Dbp +0.8: 5&#39;- ATGCTCACACGGTGCAGACA, and 5&#39;- CTGCTCAGGCACATTCCTCAT; Dbp +2.4: 5&#39;- TGGGACGCCTGGGTACAC, and 5&#39;- GGGAATGTGCAGCACTGGTT. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation at JoVE.com

A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

We present a filtration-based protocol to isolate high-quality nuclei from cross-linked mouse skeletal muscle wherein we removed the need for ultracentrifugation, making it easily applicable. We show that chromatin prepared from the nuclei is suitable for chromatin immunoprecipitation and likely chromatin immunoprecipitation sequencing studies.

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a ...

a-filtration-based-method-preparing-high-quality-nuclei-from-cross

Nanyang Technological University

Research

JoVE Journal

Biochemistry

8.8K Views.  University of Texas Health Science Center at Houston. We present a filtration-based protocol to isolate high-quality nuclei from cross-linked mouse skeletal muscle wherein we removed the need for ultracentrifugation, making it easily applicable. We show that chromatin prepared from the nuclei is suitable for chromatin immunoprecipitation and likely chromatin immunoprecipitation sequencing studies.

Video: A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

A Facile and Efficient Approach for the Production of Reversible Disulfide Cross-linked Micelles

Nanomedicine is an emerging form of therapy that harnesses the unique properties of particles that are nanometers in scale for biomedical application. Improving drug delivery to maximize therapeutic outcomes and to reduce drug-associated side effects are some of the cornerstones of present-day nanomedicine. Nanoparticles in particular have found a wide application in cancer treatment. Nanoparticles that offer a high degree of flexibility in design, application, and production based on the tumor microenvironment are projected to be more effective with rapid translation into clinical practice. The polymeric micellar nano-carrier is a popular choice for drug delivery applications.
In this article, we describe a simple and effective protocol for synthesizing drug-loaded, disulfide cross-linked micelles based on the self-assembly of a well-defined amphiphilic linear-dendritic copolymer (telodendrimer, TD). TD is composed of polyethylene glycol (PEG) as the hydrophilic segment and a thiolated cholic acid cluster as the core-forming hydrophobic moiety attached stepwise to an amine-terminated PEG using solution-based peptide chemistry. Chemotherapy drugs, such as paclitaxel (PTX), can be loaded using a standard solvent evaporation method. The O2-mediated oxidation was previously utilized to form intra-micellar disulfide cross-links from free thiol groups on the TDs. However, the reaction was slow and not feasible for large-scale production. Recently, an H2O2-mediated oxidation method was explored as a more feasible and efficient approach, and it was 96 times faster than the previously reported method. Using this approach, 50 g of PTX-loaded, disulfide cross-linked nanoparticles have been successfully produced with narrow particle size distribution and high drug loading efficiency. The stability of the resulting micelle solution is analyzed using disrupting conditions such as co-incubation with a detergent, sodium dodecyl sulfate, with or without a reducing agent. The drug-loaded, disulfide cross-linked micelles demonstrated less hemolytic activity when compared to their non-cross-linked counterparts.

To deliver cancer drugs to tumor sites with high specificity and reduced side effects, new methods based on nanoparticles are required. Here, we describe disulfide cross-linked micelles that can be easily prepared by hydrogen peroxide-mediated oxidation and are able to dissociate efficiently under a reducing tumor environment to release payloads.

Nanomedicine is an emerging form of therapy that harnesses the unique properties of particles that are nanometers in scale for biomedical application. ...

An Efficient Method for the Isolation of Highly Purified RNA from Seeds for Use in Quantitative Transcriptome Analysis

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as industrial materials. Gene expression profiles are powerful tools for investigating metabolic regulation in plant cells. Therefore, detailed, accurate gene expression profiles during seed development are required for crop breeding. Acquiring highly purified RNA is essential for producing these profiles. Efficient methods are needed to isolate highly purified RNA from seeds. Here, we describe a method for isolating RNA from seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method enables highly purified RNA to be obtained from seeds without the use of phenol, chloroform, or additional processes for RNA purification. This method is applicable to Arabidopsis, rapeseed, and soybean seeds. Our method will be useful for monitoring the expression patterns of low level transcripts in developing and mature seeds.

We have succeeded in establishing a method for RNA isolation from plant seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method is suitable for monitoring the expression of genes with low level transcripts in seeds.

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually determined by transcriptomic, proteomic, metabolomics and lipidomic measurements. In this protocol, we introduce a simple method for the reproducible extraction of metabolites, lipids and proteins from biological tissues using a single aliquot per sample. The extraction method is based on a methyl tert-butyl ether: methanol: water system for liquid: liquid partitioning of hydrophobic and polar metabolites into two immiscible phases along with the precipitation of proteins and other macromolecules as a solid pellet. This method, therefore, provides three different fractions of specific molecular composition, which are fully compatible with common high throughput 'omics' technologies such as liquid chromatography (LC) or gas chromatography (GC) coupled to mass spectrometers. Even though the method was initially developed for the analysis of different plant tissue samples, it has proved to be fully compatible for the extraction and analysis of biological samples from systems as diverse as algae, insects, and mammalian tissues and cell cultures.

A protocol for comprehensive extraction of lipids, metabolites and proteins from biological tissues using one sample is presented.

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a high content of structural proteins. Dissected limb muscles from adult mice are physically disrupted by mechanical homogenisation, or a combination of mincing and douncing, in a hypotonic buffer before formaldehyde fixation of the cell lysate. The fixed nuclei are purified by further cycles of mechanical homogenisation or douncing and sequential filtrations to remove cell debris. The purified nuclei can be sonicated immediately or at a later stage after freezing. The chromatin can be efficiently sonicated and is suitable for chromatin immunoprecipitation experiments, as illustrated by the profiles obtained for transcription factors, RNA polymerase II, and covalent histone modifications. The binding events detected using chromatin prepared by this protocol are predominantly those taking place in the muscle fiber nuclei despite the presence of chromatin from other fiber-associated satellite and endothelial cells. This protocol is therefore adapted to study gene regulation in the adult mouse skeletal muscle.

A novel protocol for the preparation of chromatin from adult mouse skeletal muscle adapted to the study of gene regulation in muscle fibers by chromatin immunoprecipitation is presented.

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a ...

Method for Efficient Refolding and Purification of Chemoreceptor Ligand Binding Domain

Identification of natural ligands of chemoreceptors and structural studies aimed at elucidation of the molecular basis of the ligand specificity can be greatly facilitated by the production of milligram amounts of pure, folded ligand binding domains. Attempts to heterologously express periplasmic ligand binding domains of bacterial chemoreceptors in Escherichia coli (E. coli) often result in their targeting into inclusion bodies. Here, a method is presented for protein recovery from inclusion bodies, its refolding and purification, using the periplasmic dCACHE ligand binding domain of Campylobacter jejuni (C. jejuni) chemoreceptor Tlp3 as an example. The approach involves expression of the protein of interest with a cleavable His6-tag, isolation and urea-mediated solubilisation of inclusion bodies, protein refolding by urea depletion, and purification by means of affinity chromatography, followed by tag removal and size-exclusion chromatography. The circular dichroism spectroscopy is used to confirm the folded state of the pure protein. It has been demonstrated that this protocol is generally useful for production of milligram amounts of dCACHE periplasmic ligand binding domains of other bacterial chemoreceptors in a soluble and crystallisable form.

A procedure is presented for the refolding of the dCACHE periplasmic ligand binding domain of Campylobacter jejuni chemoreceptor Tlp3 from inclusion bodies and the purification to yield milligram quantities of protein.

Identification of natural ligands of chemoreceptors and structural studies aimed at elucidation of the molecular basis of the ligand specificity can be ...

A Colorimetric Method for Measuring Iron Content in Plants

Iron, one of the most important micronutrients in living organisms, is involved in basic processes, such as respiration and photosynthesis. Iron content is rather low in all organisms, amounting in plants to about 0.009% of dry weight. To date, one of the most accurate methods for measuring iron concentration in plant tissues is flame absorption atomic spectroscopy. However, this approach is time-consuming and expensive and requires specific equipment not commonly found in plant laboratories. Therefore, a simpler, yet accurate method that can be routinely used is needed. The colorimetric Prussian Blue method is regularly used for qualitative iron staining in animal and plant histological sections. In this study, we adapted the Prussian Blue method for quantitative measurements of iron in tobacco leaves. We validated the accuracy of this method using both atomic spectroscopy and Prussian Blue staining to measure iron content in the same samples and found a linear regression (R2 = 0.988) between the two procedures. We conclude that the Prussian Blue method for quantitative iron measurement in plant tissues is precise, simple, and inexpensive. However, the linear regression presented here may not be appropriate for other plant species, due to potential interactions between the sample and the reagent. Establishment of a regression curve is thus needed for different plant species.

We present a simple and reliable protocol for measuring iron content in plant tissues using the colorimetric Prussian Blue method.

Iron, one of the most important micronutrients in living organisms, is involved in basic processes, such as respiration and photosynthesis. Iron content ...

Activated Cross-linked Agarose for the Rapid Development of Affinity Chromatography Resins - Antibody Capture as a Case Study

The purification of monoclonal antibodies (mAbs) is commonly achieved by Protein A affinity chromatography, which can account for up to 25% of the overall process costs. Alternative, cost-effective capture steps are therefore valuable for industrial-scale manufacturing, where large quantities of a single mAb are produced. Here we present a method for the immobilization of a DsRed-based epitope ligand to a cross-linked agarose resin allowing the selective capture of the HIV-neutralizing antibody 2F5 from crude plant extracts without using Protein A. The linear epitope ELDKWA was first genetically fused to the fluorescent protein DsRed and the fusion protein was expressed in transgenic tobacco (Nicotiana tabacum) plants before purification by immobilized metal-ion affinity chromatography. Furthermore, a method based on activated cross-linked agarose was optimized for high ligand density, efficient coupling and low costs. The pH and buffer composition and the soluble ligand concentration were the most important parameters during the coupling procedure, which was improved using a design-of-experiments approach. The resulting affinity resin was tested for its ability to selectively bind the target mAb in a crude plant extract and the elution buffer was optimized for high mAb recovery, product activity and affinity resin stability. The method can easily be adapted to other antibodies with linear epitopes. The new resins allow gentler elution conditions than Protein A and could also reduce the costs of an initial capture step for mAb production.

In this procedure, a DsRed-based epitope ligand is immobilized to produce a highly selective affinity resin for the capture of monoclonal antibodies from crude plant extracts or cell culture supernatants, as an alternative to Protein A.

The purification of monoclonal antibodies (mAbs) is commonly achieved by Protein A affinity chromatography, which can account for up to 25% of the overall ...

Quantification of Protein Interaction Network Dynamics using Multiplexed Co-Immunoprecipitation

Dynamic protein-protein interactions control cellular behavior, from motility to DNA replication to signal transduction. However, monitoring dynamic interactions among multiple proteins in a protein interaction network is technically difficult. Here, we present a protocol for Quantitative Multiplex Immunoprecipitation (QMI), which allows quantitative assessment of fold changes in protein interactions based on relative fluorescence measurements of Proteins in Shared Complexes detected by Exposed Surface epitopes (PiSCES). In QMI, protein complexes from cell lysates are immunoprecipitated onto microspheres, and then probed with a labeled antibody for a different protein in order to quantify the abundance of PiSCES. Immunoprecipitation antibodies are conjugated to different MagBead spectral regions, which allows a flow cytometer to differentiate multiple parallel immunoprecipitations and simultaneously quantify the amount of probe antibody associated with each. QMI does not require genetic tagging and can be performed using minimal biomaterial compared to other immunoprecipitation methods. QMI can be adapted for any defined group of interacting proteins, and has thus far been used to characterize signaling networks in T cells and neuronal glutamate synapses. Results have led to new hypothesis generation with potential diagnostic and therapeutic applications. This protocol includes instructions to perform QMI, from the initial antibody panel selection through to running assays and analyzing data. The initial assembly of a QMI assay involves screening antibodies to generate a panel, and empirically determining an appropriate lysis buffer. The subsequent reagent preparation includes covalently coupling immunoprecipitation antibodies to MagBeads, and biotinylating probe antibodies so they can be labeled by a streptavidin-conjugated fluorophore. To run the assay, lysate is mixed with MagBeads overnight, and then beads are divided and incubated with different probe antibodies, and then a fluorophore label, and read by flow cytometry. Two statistical tests are performed to identify PiSCES that differ significantly between experimental conditions, and results are visualized using heatmaps or node-edge diagrams.

Quantitative Multiplex Immunoprecipitation (QMI) uses flow cytometry for sensitive detection of differences in the abundance of targeted protein-protein interactions between two samples. QMI can be performed using a small amount of biomaterial, does not require genetically engineered tags, and can be adapted for any previously defined protein interaction network.

Dynamic protein-protein interactions control cellular behavior, from motility to DNA replication to signal transduction. However, monitoring dynamic ...

Preparation of High-Quality Fermented Fish Product

This protocol provides a method for preparation of industrialized fermented fish product with sturgeon (Aquilaria sinensis) meat product. The procedures were: (1) pretreatment of farmed sturgeon including decapitation, evisceration, skinning-off, cleaning and cutting; (2) marinating fish cubes in 6-12% (w/v) salt solution (1:1, fish cube mass to solution volume); (3) drying fish cubes to a water content of 50-60% by hot air (40-60 &#176;C) or by vacuum; (4) fermentation involving inoculating fish cubes with 0.4-1.6% (w/w) S. cerevisiae in flavor solution to fish cubes and fermenting at 25-35 &#176;C for 6-10 h; (5) sealing fish cubes in vacuum packages with marinating and fermenting solutions; (6) sterilizing at 115-121 &#176;C for 10-20 min. The sturgeon meat product prepared by this method has delicious taste which is mellow and thick, has various types and large amounts of volatile flavor compounds such as alcohols and esters which could mask musty and unpleasant odor from fish, has moderate salt content but good texture properties such as high springiness, gumminess and chewiness, and has bright russet color and attractive appearance. This new technique could also be applied in the processing of other fish to provide convenient fish snack foods which could be stored at room temperature. It is appropriate for both marine and freshwater fish.

The goal of the protocol is to provide an industrialized fish fermentation technique based on inoculation of Saccharomyces cerevisiae.

This protocol provides a method for preparation of industrialized fermented fish product with sturgeon (Aquilaria sinensis) meat product. The procedures ...

Label-Free Immunoprecipitation Mass Spectrometry Workflow for Large-scale Nuclear Interactome Profiling

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This publication presents a complete interaction proteomics workflow designed for identifying low abundance protein-protein interactions from the nucleus that could also be applied to other subcellular compartments. This workflow includes subcellular fractionation, immunoprecipitation, sample preparation, offline cleanup, single-shot label-free mass spectrometry, and downstream computational analysis and data visualization. Our protocol is optimized for detecting compartmentalized, low abundance interactions that are difficult to identify from whole cell lysates (e.g., transcription factor interactions in the nucleus) by immunoprecipitation of endogenous proteins from fractionated subcellular compartments. The sample preparation pipeline outlined here provides detailed instructions for the preparation of HeLa cell nuclear extract, immunoaffinity purification of endogenous bait protein, and quantitative mass spectrometry analysis. We also discuss methodological considerations for performing large-scale immunoprecipitation in mass spectrometry-based interaction profiling experiments and provide guidelines for evaluating data quality to distinguish true positive protein interactions from nonspecific interactions. This approach is demonstrated here by investigating the nuclear interactome of the CMGC kinase, DYRK1A, a low abundance protein kinase with poorly defined interactions within the nucleus.

Described is a proteomics workflow for identifying protein interaction partners from a nuclear subcellular fraction using immunoaffinity enrichment of a given protein of interest and label-free mass spectrometry. The workflow includes subcellular fractionation, immunoprecipitation, filter aided sample preparation, offline cleanup, mass spectrometry, and a downstream bioinformatics pipeline.

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This ...