We are grateful to the Environmental Services Association Education Trust, the Synthetic Biology in Cambridge SynBio fund and the Ministry of Social Justice and Empowerment, Government of India, for financial support.

<ol>
	<li>Zwirglmaier, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+phylogeography+of+marine+Synechococcus+and+Prochlorococcus+reveals+a+distinct+partitioning+of+lineages+among+oceanic+biomes.">Global phylogeography of marine Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among oceanic biomes.</a> Environ Microbiol. 10, 147-161 (2008).</li><li>Galloway, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nitrogen+cycles:+past,+present,+and+future.">Nitrogen cycles: past, present, and future.</a> Biogeochemistry. 70, 153-226 (2004).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+cyanobacterial+alkane+production+to+the+ocean+hydrocarbon+cycle.">Contribution of cyanobacterial alkane production to the ocean hydrocarbon cycle.</a> Proc Natl Acad Sci U S A. , (2015).</li><li>Howe, C. J., Barbrook, A. C., Nisbet, R. E. R., Lockhart, P. J., Larkum, A. W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+origin+of+plastids.">The origin of plastids.</a> Philos Trans R Soc Lond B Biol Sci. 363, 2675-2685 (2008).</li><li>Lea-Smith, D. J., Bombelli, P., Vasudevan, R., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photosynthetic,+respiratory+and+extracellular+electron+transport+pathways+in+cyanobacteria.">Photosynthetic, respiratory and extracellular electron transport pathways in cyanobacteria.</a> Biochim Biophys Acta. , (2015).</li><li>McCormick, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydrogen+production+through+oxygenic+photosynthesis+using+the+cyanobacterium+Synechocystis+sp+PCC+6803+in+a+bio-photoelectrolysis+cell+(BPE)+system.">Hydrogen production through oxygenic photosynthesis using the cyanobacterium Synechocystis sp PCC 6803 in a bio-photoelectrolysis cell (BPE) system.</a> Energy Environ. Sci. 6, 2682-2690 (2013).</li><li>Bradley, R. W., Bombelli, P., Lea-Smith, D. J., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+oxidase+mutants+of+the+cyanobacterium+Synechocystis+sp.+PCC+6803+show+increased+electrogenic+activity+in+biological+photo-voltaic+systems.">Terminal oxidase mutants of the cyanobacterium Synechocystis sp. PCC 6803 show increased electrogenic activity in biological photo-voltaic systems.</a> Phys Chem Chem Phys. 15, 13611-13618 (2013).</li><li>Ducat, D. C., Way, J. C., Silver, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+cyanobacteria+to+generate+high-value+products.">Engineering cyanobacteria to generate high-value products.</a> Trends Biotechnol. 29, 95-103 (2011).</li><li>Dismukes, G. C., Carrieri, D., Bennette, N., Ananyev, G. M., Posewitz, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquatic+phototrophs:+efficient+alternatives+to+land-based+crops+for+biofuels.">Aquatic phototrophs: efficient alternatives to land-based crops for biofuels.</a> Curr Opin Biotechnol. 19, 235-240 (2008).</li><li>Tan, L. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioactive+natural+products+from+marine+cyanobacteria+for+drug+discovery.">Bioactive natural products from marine cyanobacteria for drug discovery.</a> Phytochemistry. 68, 954-979 (2007).</li><li>Volk, R. B., Furkert, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antialgal,+antibacterial+and+antifungal+activity+of+two+metabolites+produced+and+excreted+by+cyanobacteria+during+growth.">Antialgal, antibacterial and antifungal activity of two metabolites produced and excreted by cyanobacteria during growth.</a> Microbiol Res. 161, 180-186 (2006).</li><li>Scott, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodiesel+from+algae:+challenges+and+prospects.">Biodiesel from algae: challenges and prospects.</a> Curr Opin Biotechnol. 21, 277-286 (2010).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phycobilisome-deficient+strains+of+Synechocystis+sp.+PCC+6803+have+reduced+size+and+require+carbon-limiting+conditions+to+exhibit+enhanced+productivity.">Phycobilisome-deficient strains of Synechocystis sp. PCC 6803 have reduced size and require carbon-limiting conditions to exhibit enhanced productivity.</a> Plant Physiol. 165, 705-714 (2014).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thylakoid+terminal+oxidases+are+essential+for+the+cyanobacterium+Synechocystis+sp.+PCC+6803+to+survive+rapidly+changing+light+intensities.">Thylakoid terminal oxidases are essential for the cyanobacterium Synechocystis sp. PCC 6803 to survive rapidly changing light intensities.</a> Plant Physiol. 162, 484-495 (2013).</li><li>Liu, X., Sheng, J., Curtiss, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatty+acid+production+in+genetically+modified+cyanobacteria.">Fatty acid production in genetically modified cyanobacteria.</a> Proc Natl Acad Sci U S A. 108, 6899-6904 (2011).</li><li>Xu, H., Vavilin, D., Funk, C., Vermaas, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+deletions+of+small+cab-like+proteins+in+the+cyanobacterium+Synechocystis+sp+PCC+6803+-+Consequences+for+pigment+biosynthesis+and+accumulation.">Multiple deletions of small cab-like proteins in the cyanobacterium Synechocystis sp PCC 6803 - Consequences for pigment biosynthesis and accumulation.</a> J Biol Chem. 279, 27971-27979 (2004).</li><li>Castenholz, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culturing+methods+for+Cyanobacteria.">Culturing methods for Cyanobacteria.</a> Method Enzymol. 167, 68-93 (1988).</li><li>Mitschke, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimentally+anchored+map+of+transcriptional+start+sites+in+the+model+cyanobacterium+Synechocystis+sp+PCC6803.">An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp PCC6803.</a> Proc Natl Acad Sci U S A. 108, 2124-2129 (2011).</li><li>Ried, J. L., Collmer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+nptI-sacB-sacR+cartridge+for+constructing+directed,+unmarked+mutations+in+gram-negative+bacteria+by+marker+exchange-eviction+mutagenesis.">An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis.</a> Gene. 57, 239-246 (1987).</li><li>Vieira, J., Messing, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pUC+plasmids,+an+M13mp7-derived+system+for+insertion+mutagenesis+and+sequencing+with+synthetic+universal+primers.">The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.</a> Gene. 19, 259-268 (1982).</li><li>Vermaas, W. F. J., Williams, J. G. K., Rutherford, A. W., Mathis, P., Arntzen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+Engineered+Mutant+of+the+Cyanobacterium+Synechocystis+6803+Lacks+the+Photosystem-Ii+Chlorophyll-Binding+Protein+Cp-47.">Genetically Engineered Mutant of the Cyanobacterium Synechocystis 6803 Lacks the Photosystem-Ii Chlorophyll-Binding Protein Cp-47.</a> Proc Natl Acad Sci U S A. 83, 9474-9477 (1986).</li><li>Westphal, S., Heins, L., Soll, J., Vothknecht, U. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+deletion+mutant+of+Synechocystis:+A+connection+between+bacterial+phage+shock+and+thylakoid+biogenesis?.">Vipp1 deletion mutant of Synechocystis: A connection between bacterial phage shock and thylakoid biogenesis?.</a> Proc Natl Acad Sci U S A. 98, 4243-4248 (2001).</li><li>Zhang, S. Y., Shen, G. Z., Li, Z. K., Golbeck, J. H., Bryant, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+Is+Essential+for+the+Biogenesis+of+Photosystem+I+but+Not+Thylakoid+Membranes+in+Synechococcus+sp+PCC+7002.">Vipp1 Is Essential for the Biogenesis of Photosystem I but Not Thylakoid Membranes in Synechococcus sp PCC 7002.</a> J Biol Chem. 289, 15904-15914 (2014).</li><li>Taroncher-Oldenberg, G., Nishina, K., Stephanopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+analysis+of+the+polyhydroxyalkanoate-specific+beta-ketothiolase+and+acetoacetyl+coenzyme+A+reductase+genes+in+the+cyanobacterium+Synechocystis+sp+strain+PCC6803.">Identification and analysis of the polyhydroxyalkanoate-specific beta-ketothiolase and acetoacetyl coenzyme A reductase genes in the cyanobacterium Synechocystis sp strain PCC6803.</a> Appl Environ Microbiol. 66, 4440-4448 (2000).</li><li>Hein, S., Tran, H., Steinbuchel, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synechocystis+sp.+PCC6803+possesses+a+two-component+polyhydroxyalkanoic+acid+synthase+similar+to+that+of+anoxygenic+purple+sulfur+bacteria.">Synechocystis sp. PCC6803 possesses a two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria.</a> Arch Microbiol. 170, 162-170 (1998).</li><li>Ng, A. H., Berla, B. M., Pakrasi, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+tuning+of+photoautotrophic+protein+production+by+combining+promoters+and+neutral+sites+in+Synechocystis+6803,+a+cyanobacterium.">Fine tuning of photoautotrophic protein production by combining promoters and neutral sites in Synechocystis 6803, a cyanobacterium.</a> Appl Environ Microbiol. , (2015).</li></ol>

The authors declare that they have no competing financial interests.

The most critical steps in generation of unmarked mutants are: 1) careful plasmid design to ensure only the targeted region is altered; 2) ensuring that samples remain axenic, especially when cultured on sucrose; 3) plating transformed cells for marked mutant generation initially on BG11 agar plates lacking antibiotics, followed by addition of agar plus antibiotics 24 hr later; 4) culturing marked mutants for 4 full days prior to plating on BG11 plus sucrose agar plates: 5) ensuring that marked mutants are fully segregated and 6) thoroughly confirming the genotype of mutant strains. For this last step, additional primers designed to amplify part of the deleted region, can be used to ensure that it has been removed. Southern blotting, while laborious, can also be used. However, our experience is that the procedure outlined in this paper is sufficient for proper verification of mutants. This procedure has also been used to generate marked mutants in Synechococcus elongatus PCC7942. However, repeated transformation of this cyanobacterium has proved challenging.
If marked mutants cannot be segregated then different environmental conditions high CO2, low light (&#60;20 &#181;mol photons m-2 sec-1) or additional nutrients (i.e. glucose) can be tested. For example, the addition of glucose is essential in order to generate photosystem II mutants21. If marked mutants never fully segregate then the gene is probably essential for viability. However, there are examples from the literature where some research groups have been unable to knockout a gene (For example, Vipp in Synechocystis)22, only for other groups to later show that the gene is not essential23. This could be due to differences in the wild-type strains or incorrect plasmid design, resulting in polar effects on adjacent, essential genes. If a mutant does not fully segregate we would recommend that the plasmid containing the npt1 cassette from pUC18K20 between the left and right fragments be used for transformation. It is easier to verify the presence of bands corresponding to the wild-type and mutant by PCR, since this fragment is approximately 1.2 kb, compared to the 3.8 kb npt1/sacB cassette. This result is an important piece of evidence demonstrating that the gene is essential.
Generation of unmarked mutants with inserted expression cassettes is generally more challenging than development of knockout strains. We generally express genes under control of the strong cpcBAC1C2D promoter13. In some cases this may decrease the chances of successful insertion of the gene cassette, if over-expression of a protein is deleterious to the cell. Weaker promoters should then be tested. In general we have observed that the larger the gene cassette is, the more difficult it is to insert it into the genome. We have not been able to insert gene cassettes larger than 5 kb. Care must also be taken in choosing sites to insert expression cassettes into the genome. Neutral sites that do not affect cell viability or growth should be used. Examples in Synechocystis include phaAB and phaCE, which encode the proteins encoding the polyhydroxybutyrate biosynthetic pathway24,25. More recently an extensive list of neutral sites in Synechocystis has been identified26.
Generation of unmarked mutants in cyanobacteria is a slow process, taking approximately 5-7 weeks if all steps are conducting properly. This is slower than the standard method of generating marked knockouts utilized by the majority of research groups investigating cyanobacteria. However, the flexibility of being able to introduce further mutations into unmarked mutants partially compensates for this, since additional plasmids containing a range of cassettes conferring resistance to different antibiotics, do not have to be constructed. For research purposes the ability to mutate multiple genes is sometimes necessary in order to fully characterize the functional role of proteins. For example, we identified a deleterious phenotype only upon deletion of the two terminal oxidase electron sinks localized to the thylakoid membrane, since loss of only one of these complexes could be compensated for by activity of the other14. Development of a strain for industrial applications will also require multiple modifications to a strain, not just for introduction of foreign genes but also to increase photosynthetic efficiency, light harvesting optimization and deletion of competing pathways for the desired substrate.
The major factor limiting the speed of unmarked mutant generation is the slow division time of model cyanobacterial species, between 8-20 hr depending on light conditions. Under higher light intensities and CO2 concentrations, growth is faster. However, there is a risk that mutant strains which cannot tolerate either high light or CO2 will be selected against, or that mutant strains will undergo undesirable alterations prior to phenotypic characterization. Therefore this is not recommended. However, it would be highly advantageous if a more rapid protocol to generate unmarked mutants was developed. Overall, this would facilitate the development of strains for both basic research and applied applications. Such strains could be used for biofuel, biomass or chemical production or in understanding many aspects of cyanobacterial biochemistry, genetics and physiology.

Cyanobacteria are an evolutionarily ancient and diverse phylum of bacteria found in nearly every natural environment on Earth. In marine ecosystems they are particularly abundant and play a key role in many nutrient cycles, accounting for approximately half of carbon fixation1, the majority of nitrogen fixation2 and hundreds of millions of tons of hydrocarbon production3 in the oceans annually. Chloroplasts, the organelle responsible for photosynthesis in eukaryotic algae and plants, are likely to have evolved from a cyanobacterium that was engulfed by a host organism4. Cyanobacteria have proved useful model organisms for the study of photosynthesis, electron transport5 and biochemical pathways, many of which are conserved in plants. In addition cyanobacteria are increasingly being used for production of food, biofuels6, electricity7 and industrial compounds8, due to their highly efficient conversion of water and CO2 to biomass using solar energy9. Many species can be cultivated on non-arable land with minimal nutrients and seawater, suggesting that cyanobacteria could potentially be grown at large scale without affecting agricultural production. Certain species are also sources of natural products, including antifungal, antibacterial and anti-cancer compounds10,11.
The ability to generate mutants is key to understanding cyanobacterial photosynthesis, biochemistry and physiology, and essential for development of strains for industrial purposes. The majority of published studies generate genetically modified strains by insertion of an antibiotic resistance cassette into the site of interest. This limits the number of mutations that can be introduced into a strain, as only a few antibiotic resistance cassettes are available for use in cyanobacteria. Strains containing genes conferring antibiotic resistance cannot be used for industrial production in open ponds, which is likely to be the only cost-effective means to produce biofuels and other low value products12. The generation of unmarked mutants overcomes these limitations. Unmarked mutants contain no foreign DNA, unless intentionally included, and can be manipulated multiple times. Therefore it is possible to generate as many alterations in a strain as desired. In addition, polar effects on genes downstream of the modification site can be minimized, allowing more precise modification of the organism13.
To generate mutant strains, suicide plasmids containing two DNA fragments identical to regions in the cyanobacterial chromosome flanking the gene to be deleted (termed the 5&#39; and 3&#39; flanking regions) are first constructed. Two genes are then inserted between these flanking regions. One of these encodes an antibiotic resistance protein; the second encodes SacB, which produces levansucrase, a compound conferring sensitivity to sucrose. In the first stage of the process, marked mutants, i.e. strains containing some foreign DNA, are generated. The plasmid construct is mixed with the cyanobacterial cells and the DNA is taken up naturally by the organism. Transformants are selected by growth on agar plates containing the appropriate antibiotic and the mutant genotype verified by PCR. Suicide plasmids cannot replicate within the strain of interest. Therefore any antibiotic resistant colonies will result from a recombination event whereby the gene of interest in inserted into the chromosome. To generate unmarked mutants, the marked mutant is then mixed with a second suicide plasmid containing just the 5&#39; and 3&#39; flanking regions. However, if insertion of foreign DNA is required, a plasmid consisting of the 5&#39; and 3&#39; flanking regions with a cassette containing the genes of interest inserted between these DNA fragments, can be used. Selection is via growth on agar plates containing sucrose. As sucrose is lethal to cells when the sacB gene product is expressed, the only cells that survive are those in which a second recombination event has occurred, whereby the sucrose sensitivity gene, in addition to the antibiotic resistance gene, has been recombined out of the chromosome and onto the plasmid. As a consequence of the recombinational exchange, the flanking regions and any DNA between them are inserted into the chromosome.
We have successfully used these methods to generate multiple chromosomal mutations in the same strain of Synechocystis sp. PCC6803 (hereafter referred to as Synechocystis)13,14, to introduce single point mutations into a gene of interest13 and for expression of gene cassettes. While generation of unmarked knockouts has been demonstrated prior to our work in Synechocystis15,16, a detailed method, aided by a visual presentation of the critical steps, is not publicly available. We have also applied the same method for generation of marked knockouts in another model cyanobacterium, Synechococcus sp. PCC7002 (hereafter referred to as Synechococcus). This protocol provides a clear, simple method for generating mutants and a rapid protocol for validating and storing these strains.

<table border="0" cellpadding="0" cellspacing="0" width="645">
	<tbody>
		<tr height="25">
			<td height="25" style="height:25px;width:237px;">NaNO3</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">S5506</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">MgSO4.7H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">230391</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CaCl2</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">C1016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">citric acid</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">C0759</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2EDTA</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">EDT002</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">H3BO3</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">339067</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">MnCl2.4H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">M3634</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">ZnSO4.7H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">Z4750</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2MoO4.2H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">331058</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CuSO4.5H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">209198</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Co(NO3)2.6H2O</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">239267</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ferric ammonium citrate</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">F5879</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">K2HPO4</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">P3786</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2CO3</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">SODC001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TES</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">T1375</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">NaHCO3</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">SODH001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEPES</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">H3375</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">cyanocobalamin</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">47869</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2S2O3</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">72049</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Bacto agar</td>
			<td style="width:123px;">BD</td>
			<td style="width:119px;">214010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Sucrose</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">SUC001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Petri dish 90 mm triple vented</td>
			<td style="width:123px;">Greiner</td>
			<td style="width:119px;">633185</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.2 &#181;m filters</td>
			<td style="width:123px;">Sartorius</td>
			<td style="width:119px;">16534</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">100 mL conical flasks</td>
			<td style="width:123px;">Pyrex</td>
			<td style="width:119px;">CON004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Parafilm M 100 mm x38 m</td>
			<td style="width:123px;">Bemis</td>
			<td style="width:119px;">FIL003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion high fidelity DNA polymerase&#160;</td>
			<td style="width:123px;">Phusion</td>
			<td style="width:119px;">F-530</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose</td>
			<td style="width:123px;">Melford</td>
			<td style="width:119px;">MB1200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNA purification kit&#160;</td>
			<td style="width:123px;">MoBio</td>
			<td style="width:119px;">12100-300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Restriction endonucleases</td>
			<td style="width:123px;">NEB</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">T4 ligase</td>
			<td style="width:123px;">Thermo Scientific</td>
			<td style="width:119px;">EL0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Luria Bertani broth</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">MES</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">M8250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Kanamycin sulfate</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">60615</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Ampicillin</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">A9518</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">GeneJET plasmid miniprep kit</td>
			<td style="width:123px;">Thermo Scientific</td>
			<td style="width:119px;">K0503</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">14 mL round-bottom tube</td>
			<td style="width:123px;">BD falcon</td>
			<td style="width:119px;">352059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">GoTaq G2 Flexi DNA polymerase</td>
			<td style="width:123px;">Promega</td>
			<td style="width:119px;">M7805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">425-600 &#181;m glass beads</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">G8772</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Glycerol</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">G5516</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">DMSO</td>
			<td style="width:123px;">Sigma</td>
			<td style="width:119px;">D8418</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fluorescent bulbs</td>
			<td style="width:123px;">Gro-Lux</td>
			<td style="width:119px;">69</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">HT multitron photobioreactor</td>
			<td style="width:123px;">Infors</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of marked and markerless mutants in model cyanobacterial species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Plasmid design is critical for successful generation of both marked and unmarked mutants. Figure 1 gives an example of plasmid A and B used to generate a deletion mutant in the Synechocystis genes cpcC1 and cpcC213. In each case the 5&#39; and 3&#39; flanking regions are approximately 900-1,000 bp. Reduced flanking regions can be used although the smallest we have successfully trialed has been approximately 500 bp. Plasmid B can also contain a gene cassette between the 5&#39; and 3&#39; ~1 kb flanking regions or a modified version of the native gene sequence.
<img alt="Figure 2" src="/files/ftp_upload/54001/54001fig2highres.jpg" width="600" /> 
Figure 2: Verification of marked and unmarked mutants, e.g. cpcC1/cpcC2 in Synechocystis and SYNPCC7002_A1173 in Synechococcus. (A) The expected size of the wild-type Synechocystis (top), unmarked (middle) and marked knockout (bottom) amplicons generated using primers cpcC1C2for and cpcC1C2rev, approximately 200 bp on either side of the chromosomal region to be deleted. (B) The expected size of the wild-type Synechococcus (top) and marked knockout (bottom) amplicons generated using primers A1173for and A1173rev, approximately 200 bp on either side of the chromosomal region to be deleted. Agarose gel showing amplicons generated from (C) wild-type Synechocystis (lane 2), unmarked (lane 3) and marked cpcC1/cpcC2 knockouts (lane 4), and (D) wild-type Synechococcus (lane 6) and the marked SYNPCC7002_A1173 knockout (lane 7). Markers are shown in lanes 1 and 5. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54001/54001fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Upon transformation of plasmid A into the cells, typically several hundred colonies will appear on a plate after approximately 7-10 days. Colonies are &#60;1 mm in diameter and will not increase in size for the next few weeks. Therefore it is critical to use a blunt end toothpick to remove the colony and streak it on a fresh BG11 + kanamycin agar plate. Approximately half the re-streaked colonies will grow after 4-6 days. If genes are non-essential and mutants demonstrate growth similar to the wild-type strain under continuous light of 20-40 &#181;mol photons m-2 sec-1 (e.g. terminal oxidase mutants in Lea-Smith et al., 201314) (Figure 3), then all the chromosomes should contain a copy of the npt1/sacB cassette inserted sequence, as determined via PCR. If genes are non-essential and mutants demonstrate a slow growth phenotype under continuous light of 20-40 &#181;mol photons m-2 sec-1 (e.g. phycobilisome deficient mutants in Lea-Smith et al., 201413) (Figure 3), then several rounds of re-streaking on BG11 agar plates with gradually increased amounts of kanamycin are essential in order to obtain a segregated marked mutant. Once a segregated mutant is obtained this should be re-streaked on a fresh BG11 plus kanamycin agar plate to ensure that segregation is complete. If repeated rounds of streaking do not result in a segregated marked mutant then the gene is likely essential for survival. Figure 4 gives an outline of the experimental steps involved in unmarked mutant generation.
<img alt="Figure 3" src="/files/ftp_upload/54001/54001fig3highres.jpg" width="700" /> 
Figure 3: Growth of Synechocystis mutants. Examples of mutants which demonstrate (A) similar growth to wild-type and (B) slower growth than wild-type. The &#916;COX mutant lacks cytochrome oxidase due to deletion of the CtaC1D1E1 genes. The &#916;Cyd mutant lacks quinol oxidase due to deletion of the CydAB genes. The olive mutant lacks a portion of the phycobilisome due to deletion of the CpcABC1C2D genes. Samples in (B) were bubbled with air to facilitate growth. Reproduced from data published in Lea-Smith et al., 201314 and 201413 (www.plantphysiol.org; Copyright American Society of Plant Biologists). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54001/54001fig3highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Generation of unmarked mutants is highly efficient. Upon transformation of plasmid B into the marked mutant, a four day incubation period and subsequent plating on BG11 plus sucrose agar plates, hundreds of colonies are obtained per 1-10 &#181;l of transformed cell suspension. However a series of dilutions should be trialed, ranging from 0.1 to 100 &#181;l, as an excessive amount leads to a reduced concentration of sucrose per cell, resulting in poor selection for unmarked mutants. If a lawn of cells is seen over the entire plate then lower concentrations should be tried. Once individual colonies are obtained on plates, patching on BG11 plus sucrose and BG11 plus kanamycin agar plates is an essential step. Typically for unmarked mutants where a region of the chromosome is being deleted, the majority of colonies will be kanamycin sensitive and sucrose resistant. PCR amplification of the target region in these colonies show that nearly 100% demonstrate the unmarked mutant profile, e.g. Figure 2. If a gene cassette is being inserted into the chromosome then typically a higher proportion of kanamycin resistant and sucrose resistant colonies are observed. These mutants can grow on sucrose due to a mutation in the sacB gene. If no kanamycin sensitive and sucrose resistant colonies are generated then the gene cassette is deleterious to the cell.
<img alt="Figure 4" src="/files/ftp_upload/54001/54001fig4highres.jpg" width="700" /> 
Figure 4: Generation of marked and unmarked mutants in Synechocystis. Schematic detailing (A) recombination and (B) experimental steps involved in mutant generation. Plasmid A is first mixed with cells. Following incubation on agar plates containing kanamycin, colonies in which a recombination event occurs between the 5&#39; and 3&#39; flanking regions (indicated in blue and red, respectively) and the homologous sequence in the chromosome, are isolated. In addition, the npt1/sacB cassette between the 5&#39; and 3&#39; flanking regions is inserted into the chromosome. Following segregation a marked mutant is generated. Marked mutant cells are then mixed with plasmid B which can contain either (C) 1: the 5&#39; and 3&#39; flanking regions; 2: the 5&#39; and 3&#39; flanking regions with an expression cassette containing genes of interest inserted between these sequences; 3: the 5&#39; and 3&#39; flanking regions with the wild-type sequence with the desired nucleotide alterations inserted between these sequences. A second homologous recombination event occurs between the 5&#39; and 3&#39; flanking regions and the homologous regions in the chromosome, resulting in removal of the npt1/sacB cassette and either the unmarked knockout or a mutant with an insertion or altered wild-type region introduced into the chromosome. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54001/54001fig4highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Stock solution recipes</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemical</td>
			<td>Amount (g)</td>
		</tr>
		<tr>
			<td>100x BG11 (per L)</td>
			<td></td>
		</tr>
		<tr>
			<td>NaNO3</td>
			<td>149.6</td>
		</tr>
		<tr>
			<td>MgSO4.7H2O</td>
			<td>7.49</td>
		</tr>
		<tr>
			<td>CaCl2.2H2O</td>
			<td>3.6</td>
		</tr>
		<tr>
			<td>Citric acid</td>
			<td>0.6</td>
		</tr>
		<tr>
			<td>Add 1.12 ml 0.25 M Na2EDTA, pH 8.0</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25 M Na2EDTA, pH 8.0 (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2EDTA</td>
			<td>9.3</td>
		</tr>
		<tr>
			<td>Trace elements (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>H3BO3</td>
			<td>0.286</td>
		</tr>
		<tr>
			<td>MnCl2.4H2O</td>
			<td>0.181</td>
		</tr>
		<tr>
			<td>ZnSO4.7H2O</td>
			<td>0.022</td>
		</tr>
		<tr>
			<td>Na2MoO4.2H2O</td>
			<td>0.039</td>
		</tr>
		<tr>
			<td>CuSO4.5H2O</td>
			<td>0.008</td>
		</tr>
		<tr>
			<td>Co(NO3)2.6H2O</td>
			<td>0.005</td>
		</tr>
		<tr>
			<td>Iron stock (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>Ferric ammonium citrate</td>
			<td>1.11</td>
		</tr>
		<tr>
			<td>Phosphate stock (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>3.05</td>
		</tr>
		<tr>
			<td>Na2CO3 stock (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2CO3</td>
			<td>2</td>
		</tr>
		<tr>
			<td>TES buffer, pH 8.2 (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>TES</td>
			<td>22.9</td>
		</tr>
		<tr>
			<td>NaHCO3 stock (per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>NaHCO3</td>
			<td>8.4</td>
		</tr>
		<tr>
			<td>HEPES, pH 8.2 (per 500 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>119.15</td>
		</tr>
		<tr>
			<td>Vitamin B12 (Per 50 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyanocobalamin</td>
			<td>0.02</td>
		</tr>
		<tr>
			<td>Luria Bertani media (Per 500 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Bertani broth</td>
			<td>12.5</td>
		</tr>
		<tr>
			<td>1 M MgCl2 (Per 100 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2.6H2O</td>
			<td>20.33</td>
		</tr>
		<tr>
			<td>Solution A (Per 200 ml)</td>
			<td></td>
		</tr>
		<tr>
			<td>MnCl2.4H2O</td>
			<td>0.395</td>
		</tr>
		<tr>
			<td>CaCl2.2H2O</td>
			<td>1.47</td>
		</tr>
		<tr>
			<td>2-(N-Morpholino)ethanesulfonic acid hydrate, 4-Morpholineethanesulfonic acid (MES)</td>
			<td>0.4265</td>
		</tr>
		<tr>
			<td>Solution A + glycerol</td>
			<td></td>
		</tr>
		<tr>
			<td>10 ml solution A</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml glycerol</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: Solutions used in this study.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer&#160;</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>cpcC1C2leftfor</td>
			<td>GTACTCTAGAGCGGCTAAATGCTACGAC</td>
		</tr>
		<tr>
			<td>cpcC1C2leftrev</td>
			<td>GATCGGATCCGCGGTAATTGTTCCCTTTGA</td>
		</tr>
		<tr>
			<td>cpcC1C2rightfor</td>
			<td>GATCGAGCTCTGCACTGGTCAGTCGTTC</td>
		</tr>
		<tr>
			<td>cpcC1C2rightrev</td>
			<td>GACTGAATTCATCGTTGCTTGAACGGTCTC</td>
		</tr>
		<tr>
			<td>M13 forward</td>
			<td>TGTAAAACGACGGCCAGT</td>
		</tr>
		<tr>
			<td>M13 reverse</td>
			<td>CAGGAAACAGCTATGAC</td>
		</tr>
		<tr>
			<td>cpcC1C2for</td>
			<td>GTTTTCATTGGCATCGGTCT</td>
		</tr>
		<tr>
			<td>cpcC1C2rev</td>
			<td>ATGTCCCAGGAACGACTGAC</td>
		</tr>
		<tr>
			<td>A1173for</td>
			<td>AGCAAACCGTTTTTGTGACC</td>
		</tr>
		<tr>
			<td>A1173rev</td>
			<td>TGCAAGGTGGCGAACTGTAT</td>
		</tr>
	</tbody>
</table>
Table 2: Primers used in this study. Restriction endonuclease sites are underlined.

Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

generation-marked-markerless-mutants-model-cyanobacterial

Nanyang Technological University

Research

JoVE Journal

Biology

11.9K Views.  University of Cambridge. Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Video: Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Neurocircuit Assays for Seizures in Epilepsy Mutants of Drosophila

Drosophila melanogaster is a useful tool for studying seizure like activity. A variety of mutants in which seizures can be induced through either physical shock or electrical stimulation is available for study of various aspects of seizure activity and behavior. All flies, including wild-type, will undergo seizure-like activity if stimulated at a high enough voltage. Seizure like activity is an all-or-nothing response and each genotype has a specific seizure threshold. The seizure threshold of a specific genotype of fly can be altered either by treatment with a drug or by genetic suppression or enhancement. The threshold is easily measured by electrophysiology. Seizure-like activity can be induced via high frequency electrical stimulation delivered directly to the brain and recorded through the dorsal longitudinal muscles (DLMs) in the thorax. The DLMs are innervated by part of the giant fiber system. Starting with low voltage, high frequency stimulation, and subsequently raising the voltage in small increments, the seizure threshold for a single fly can be measured.

Neurocircuit Assays for Seizures in Epilepsy Mutants of Drosophila

Using high frequency electrical stimulation, seizure-like activity can be induced in Drosophila. This activity is easily recorded from the giant fiber system.

Drosophila melanogaster is a useful tool for studying seizure like activity. A variety of mutants in which seizures can be induced through either physical ...

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development can be addressed. The zebrafish is useful for genetic studies due to several advantageous characteristics, including small size, high fecundity, short lifecycle, and ease of care. Lens development occurs rapidly in zebrafish. By 72 hpf, the zebrafish lens is functionally mature [3]. Abundant genetic and molecular resources are available to support research in zebrafish. In addition, the similarity of the zebrafish eye to those of other vertebrates provides basis for its use as an excellent animal model of human defects[4-7]. Several zebrafish mutants exhibit lens abnormalities, including high levels of cell death, which in some cases leads to a complete degeneration of lens tissues [8]. To determine whether lens abnormalities are due to intrinsic causes or to defective interactions with the surrounding tissues, transplantation of a mutant lens into a wild-type eye is performed. Using fire-polished metal needles, mutant or wild-type lenses are carefully dissected from the donor animal, and transferred into the host. To distinguish wild-type and mutant tissues, a transgenic line is used as the donor. This line expresses membrane-bound GFP in all tissues, including the lens. This transplantation technique is an essential tool in the studies of zebrafish lens mutants.

Lens development involves interactions with other tissues. Several zebrafish eye mutants are characterized by an abnormally small lens size. Here we demonstrate a lens transplantation experiment to determine whether this phenotype is due to intrinsic causes or defective interactions with tissues that surround the lens.

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development ...

A Noninvasive Hair Sampling Technique to Obtain High Quality DNA from Elusive Small Mammals

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using noninvasive sampling techniques to investigate population genetics and demography of wild populations1. This approach has proven to be especially useful when dealing with rare or elusive species2. While a number of these methods have been developed to sample hair, feces and other biological material from carnivores and medium-sized mammals, they have largely remained untested in elusive small mammals. In this video, we present a novel, inexpensive and noninvasive hair snare targeted at an elusive small mammal, the American pika (Ochotona princeps). We describe the general set-up of the hair snare, which consists of strips of packing tape arranged in a web-like fashion and placed along travelling routes in the pikas&#x2019; habitat. We illustrate the efficiency of the snare at collecting a large quantity of hair that can then be collected and brought back to the lab. We then demonstrate the use of the DNA IQ system (Promega) to isolate DNA and showcase the utility of this method to amplify commonly used molecular markers including nuclear microsatellites, amplified fragment length polymorphisms (AFLPs), mitochondrial sequences (800bp) as well as a molecular sexing marker. Overall, we demonstrate the utility of this novel noninvasive hair snare as a sampling technique for wildlife population biologists. We anticipate that this approach will be applicable to a variety of small mammals, opening up areas of investigation within natural populations, while minimizing impact to study organisms.

We present a noninvasive sampling approach to efficiently collect hair samples from elusive small mammals, as shown for the American pika. We demonstrate the utility of this method by extracting DNA from sampled hair and amplifying several types of molecular markers commonly used in studies of wildlife ecology and conservation.

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using ...

Generation, Purification, and Characterization of Cell-invasive DISC1 Protein Species

Protein aggregation is seen as a general hallmark of chronic, degenerative brain conditions like, for example, in the neurodegenerative diseases Alzheimer's disease (A&beta;, tau), Parkinson's Disease (&alpha;-synuclein), Huntington's disease (polyglutamine, huntingtin), and others. Protein aggregation is thought to occur due to disturbed proteostasis, i.e. the imbalance between the arising and degradation of misfolded proteins. Of note, the same proteins are found aggregated in sporadic forms of these diseases that are mutant in rare variants of familial forms.
Schizophrenia is a chronic progressive brain condition that in many cases goes along with a permanent and irreversible cognitive deficit. In a candidate gene approach, we investigated whether Disrupted-in-schizophrenia 1 (DISC1), a gene cloned in a Scottish family with linkage to chronic mental disease1, 2, could be found as insoluble aggregates in the brain of sporadic cases of schizophrenia3. Using the SMRI CC, we identified in approximately 20 % of cases with CMD but not normal controls or patients with neurodegenerative diseases sarkosyl-insoluble DISC1 immunoreactivity after biochemical fractionation. Subsequent studies in vitro revealed that the aggregation propensity of DISC1 was influenced by disease-associated polymorphism S704C4, and that DISC1 aggresomes generated in vitro were cell-invasive5, similar to what had been shown for A&beta;6, tau7-9, &alpha;-synuclein10, polyglutamine11, or SOD1 aggregates12. These findings prompted us to propose that at least a subset of cases with CMD, those with aggregated DISC1 might be protein conformational disorders.
 Here we describe how we generate DISC1 aggresomes in mammalian cells, purify them on a sucrose gradient and use them for cell-invasiveness studies. Similarly, we describe how we generate an exclusively multimeric C-terminal DISC1 fragment, label and purify it for cell invasiveness studies. Using the recombinant multimers of DISC1 we achieve similar cell invasiveness as for a similarly labeled synthetic &alpha;-synuclein fragment. We also show that this fragment is taken up in vivo when stereotactically injected into the brain of recipient animals.

The generation, purification and cell invasion of intracellular, cytoplasmic full length DISC1 protein aggresomes from cell cultures and of a labeled, multimeric recombinant DISC1 protein fragment in E. coli are described. Cell invasiveness is shown for recipient cells in cell culture and for neurons in vivo after stereotactical brain inoculation.

Protein aggregation is seen as a general hallmark of chronic, degenerative brain conditions like, for example, in the neurodegenerative diseases ...

Detecting, Visualizing and Quantitating the Generation of Reactive Oxygen Species in an Amoeba Model System

Reactive oxygen species (ROS) comprise a range of reactive and short-lived, oxygen-containing molecules, which are dynamically interconverted or eliminated either catalytically or spontaneously. Due to the short life spans of most ROS and the diversity of their sources and subcellular localizations, a complete picture can be obtained only by careful measurements using a combination of protocols. Here, we present a set of three different protocols using OxyBurst Green (OBG)-coated beads, or dihydroethidium (DHE) and Amplex UltraRed (AUR), to monitor qualitatively and quantitatively various ROS in professional phagocytes such as Dictyostelium. We optimised the beads coating procedures and used OBG-coated beads and live microscopy to dynamically visualize intraphagosomal ROS generation at the single cell level. We identified lipopolysaccharide (LPS) from E. coli as a potent stimulator for ROS generation in Dictyostelium. In addition, we developed real time, medium-throughput assays using DHE and AUR to quantitatively measure intracellular superoxide and extracellular H2O2 production, respectively.

We adapted a set of protocols for the measurement of reactive oxygen species (ROS) that can be applied in various amoeba and mammalian cellular models for qualitative and quantitative studies.

Reactive oxygen species (ROS) comprise a range of reactive and short-lived, oxygen-containing molecules, which are dynamically interconverted or ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...

In vivo Clonal Tracking of Hematopoietic Stem and Progenitor Cells Marked by Five Fluorescent Proteins using Confocal and Multiphoton Microscopy

We developed and validated a fluorescent marking methodology for clonal tracking of hematopoietic stem and progenitor cells (HSPCs) with high spatial and temporal resolution to study in vivo hematopoiesis using the murine bone marrow transplant experimental model. Genetic combinatorial marking using lentiviral vectors encoding fluorescent proteins (FPs) enabled cell fate mapping through advanced microscopy imaging. Vectors encoding five different FPs: Cerulean, EGFP, Venus, tdTomato, and mCherry were used to concurrently transduce HSPCs, creating a diverse palette of color marked cells. Imaging using confocal/two-photon hybrid microscopy enables simultaneous high resolution assessment of uniquely marked cells and their progeny in conjunction with structural components of the tissues. Volumetric analyses over large areas reveal that spectrally coded HSPC-derived cells can be detected non-invasively in various intact tissues, including the bone marrow (BM), for extensive periods of time following transplantation. Live studies combining video-rate multiphoton and confocal time-lapse imaging in 4D demonstrate the possibility of dynamic cellular and clonal tracking in a quantitative manner.

In vivo Clonal Tracking of Hematopoietic Stem and Progenitor Cells Marked by Five Fluorescent Proteins using Confocal and Multiphoton Microscopy

Combinatorial 5 fluorescent proteins marking of hematopoietic stem and progenitor cells allows in vivo clonal tracking via confocal and two-photon microscopy, providing insights into bone marrow hematopoietic architecture during regeneration. This method allows non-invasive fate mapping of spectrally-coded HSPCs-derived cells in intact tissues for extensive periods of time following transplantation.

We developed and validated a fluorescent marking methodology for clonal tracking of hematopoietic stem and progenitor cells (HSPCs) with high spatial and ...

The Assembly and Application of 'Shear Rings': A Novel Endothelial Model for Orbital, Unidirectional and Periodic Fluid Flow and Shear Stress

Deviations from normal levels and patterns of vascular fluid shear play important roles in vascular physiology and pathophysiology by inducing adaptive as well as pathological changes in endothelial phenotype and gene expression. In particular, maladaptive effects of periodic, unidirectional flow induced shear stress can trigger a variety of effects on several vascular cell types, particularly endothelial cells. While by now endothelial cells from diverse anatomic origins have been cultured, in-depth analyses of their responses to fluid shear have been hampered by the relative complexity of shear models (e.g., parallel plate flow chamber, cone and plate flow model). While these all represent excellent approaches, such models are technically complicated and suffer from drawbacks including relatively lengthy and complex setup time, low surface areas, requirements for pumps and pressurization often requiring sealants and gaskets, creating challenges to both maintenance of sterility and an inability to run multiple experiments. However, if higher throughput models of flow and shear were available, greater progress on vascular endothelial shear responses, particularly periodic shear research at the molecular level, might be more rapidly advanced. Here, we describe the construction and use of shear rings: a novel, simple-to-assemble, and inexpensive tissue culture model with a relatively large surface area that easily allows for a high number of experimental replicates in unidirectional, periodic shear stress studies on endothelial cells.

Different levels and patterns of fluid shear are known to modulate endothelial gene expression, phenotype and susceptibility to disease. We discuss the assembly and use of 'shear rings': a model that produces unidirectional, periodic shear stress patterns. Shear rings are simple to assemble, economical and can produce high cell yields.

Deviations from normal levels and patterns of vascular fluid shear play important roles in vascular physiology and pathophysiology by inducing adaptive as ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Neurocircuit Assays for Seizures in Epilepsy Mutants of Drosophila

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

A Noninvasive Hair Sampling Technique to Obtain High Quality DNA from Elusive Small Mammals

Generation, Purification, and Characterization of Cell-invasive DISC1 Protein Species

Detecting, Visualizing and Quantitating the Generation of Reactive Oxygen Species in an Amoeba Model System

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

In vivo Clonal Tracking of Hematopoietic Stem and Progenitor Cells Marked by Five Fluorescent Proteins using Confocal and Multiphoton Microscopy

The Assembly and Application of 'Shear Rings': A Novel Endothelial Model for Orbital, Unidirectional and Periodic Fluid Flow and Shear Stress

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing