The authors would like to acknowledge the startup fund from SUNY Albany and the access of facilities at the University at Albany Cancer Research Center.

Caution: Several chemicals used in this protocol are irritants and are hazardous in case of skin contact. Consult material safety data sheets (MSDS) and wear appropriate personal protective equipment before performing this protocol. The piranha solution used in Step (1.1.1) is highly corrosive and should be prepared by adding the peroxide slowly to the acid with agitation. Handle this solution with extreme caution in a fume hood. Use appropriate eye protection and acid-resistant gloves. Trimethylchlorosilane (TMCS) is a corrosive, flammable chemical used in an optional step after (1.1.6). Handle this chemical in a fume hood.
Note: Perform the barcode slide fabrication and critical flow-patterning procedures in a clean room to minimize contamination by particulate matter. Dust particles may block the ports and microchannels of PDMS molds and interfere with flow-patterning.
1. Construction of the One-dimensional DNA Barcode Slide
<ol>
	<li>Preparation of the SU-8 master for barcode flow patterns 
	Note: The drawings for the perpendicular flow patterns (Figure 1A-B) are created using a computer-aided design (CAD) software. These patterns are rendered on a chrome photomask. Transparent areas of the mask correspond to the features of the SU-8 master.
	<ol>
		<li>Clean a silicon wafer (100 mm diameter) thoroughly in a mixture of 3 H2SO4: 1 30% H2O2 (piranha solution) heated to 96&#160;&#176;C. Wash the wafer with deionized water and isopropyl alcohol, followed by drying with a nitrogen blow gun.</li>
		<li>Pour about 4 ml of SU-8 2025 photoresist on the wafer. Use a programmable spin coater to uniformly spread the photoresist on the wafer for 10 sec at 500 rpm, then 30 sec at 3,000 rpm. This creates a photoresist layer with a thickness of ~25 &#181;m. Gradually allow spinning to slow down before stopping &#8212; this is to maintain an even coating on the wafer&#39;s surface.</li>
		<li>Bake the coated wafer on a hotplate for 1 min at 65 &#176;C, then for 5 min at 95 &#176;C. This step allows the coating to solidify. Cool to RT for 5 min.</li>
		<li>Place the chrome mask (Figure 1C) on the photoresist coat. Expose the mask features to near-UV light (350-400 nm, exposure energy 150-160 mJ/cm2) for 20 sec. 
		Note: The design on the chrome mask contains 20 channels, each of which are 20 &#181;m wide with 50 &#181;m pitch. The channels are winding from one end of the pattern to the opposite end. Altogether, the 20 channels cover a rectangular area with a length of ~40 mm and a width of ~20 mm. Each channel is flanked by two circular features which correspond to an inlet and an outlet. Inlets and outlets are interchangeable.</li>
		<li>Bake the exposed wafer on a hotplate for 5 min at 95 &#176;C. Cool to RT gradually.</li>
		<li>Immerse the wafer in SU-8 developer with agitation for 5 min. Wash the wafer with a small portion of fresh SU-8 developer, followed by isopropyl alcohol. Dry the wafer using a nitrogen blow gun. Hard-bake the wafer on a 200 &#176;C hotplate for 30 min, and allow the wafer to cool gradually to RT. 
		Note: Development may be carried out for a longer time if a white film is observed after washing in this step. 
		Optional: Silanize the SU-8 master by exposing it to trimethylchlorosilane vapor in a closed Petri dish for 10 min.</li>
	</ol>
	</li>
	<li>Preparation of the PDMS barcode mold
	<ol>
		<li>Combine 40.0 g silicone elastomer base with 4.0 g curing agent. Stir the prepolymer mixture vigorously for 10 min. Degas for 20 min under vacuum. 
		Note: As a general rule, use a 10:1 (base: curing agent) mass ratio.</li>
		<li>Pour the prepolymer into a Petri dish containing a silicon wafer with the SU-8 master of the barcode pattern. The height of the PDMS mixture should be about 7.5 mm or above. Degas the mixture in the Petri dish for a second time to remove any remaining bubbles, then bake the mixture for 1 hr at 75 &#176;C to allow PDMS to cure. 
		Note: It is important to maintain enough thickness of the PDMS slab at ~7.5 mm or above to avoid adding too much tension to the PDMS-glass bond upon insertion of pins/tubing through holes in the PDMS mold in step (1.3.3.1)</li>
		<li>Using a scalpel, carefully cut around the area of the PDMS slab that contains the barcode mold features and peel the slab from the wafer.</li>
		<li>Trim the edges of the slab to attain the desired shape of the PDMS barcode mold. Punch 20 holes (1.0-mm diameter) through the mold using a biopsy punch with plunger. Ensure that the holes are aligned with the circular features of the barcode pattern. These holes serve as the inlets and outlets.</li>
	</ol>
	</li>
	<li>One-dimensional patterning of poly-L-lysine (PLL)
	<ol>
		<li>Remove any dust on the surface of a poly-L-lysine coated glass slide using a nitrogen blow gun. Attach the PDMS mold to the clean glass slide. Ensure that the edges of the mold and the slide are aligned.</li>
		<li>Bake for 1.5 hr at 75 &#176;C to strengthen the bond between the PDMS mold and the PLL-coated slide. Meanwhile, prepare 20 pieces of flexible polyethylene tubing (3- to 4-inch pieces, with an inner diameter of 0.5 mm and an outer diameter of 1.5 mm). 
		Note: The number of pieces of tubing corresponds to the number of inlets in the PDMS barcode mold. The tubing serves to couple the channels on the PDMS barcode mold to a nitrogen gas tank equipped with a pressure regulator.</li>
		<li>To one end of each piece of tubing, attach a stainless steel hollow pin (1-mm diameter). Aspirate sterile-filtered poly-L-lysine solution through the pin, until at least 1 cm of the tubing is filled with the solution.
		<ol>
			<li>Fasten the pins (connected to solution-filled tubing) to the inlets of the PDMS barcode mold (Figure 1E). Attach the other end of the tubes to a pressure-regulated nitrogen tank set-up. Allow the solution to flow through the mold using a pressure range of 0.5-1 psi for at least 6 hr. 
			Note: Refer to step (1.3.3) for all flow-patterning procedures.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>One-dimensional patterning of ssDNA 14 
	Note: The phosphate buffered saline (PBS) used in subsequent steps is prepared from 137 mM NaCl, 10 mM Na2HPO4, and 2 mM KH2PO4. The pH of the buffer is 7.4.
	<ol>
		<li>Prepare 2 mM bis(sulfosuccinimidyl)suberate (BS3) solution in PBS. Prepare 300 &#181;M solutions of A, B, and C ssDNA (5&#39;-amine modified, 80 nucleotides) in PBS or ultrapure water. 
		Note: Use the BS3 solution within about 30 min after preparation because the N-hydroxysuccinimide ester easily undergoes hydrolysis.</li>
		<li>Combine 2.5 &#181;l of 300 &#181;M A, B, or C ssDNA with 2.5 &#181;l of 2 mM bis(sulfosuccinimidyl)suberate in PBS for each channel. A, B, and C DNA are designated to channels 1, 2, and 3, respectively. This order is also applied to remaining sets of 3 channels (Figure 2A).</li>
		<li>Perform step (1.3.3). This time, aspirate the 5-&#181;l BS3/DNA solutions through stainless steel pins and into the polyethylene tubing, then couple the PDMS mold to the nitrogen source. Allow the BS3/DNA solution to flow through the barcode mold for about 40 min&#160;or until at the channels are filled.</li>
		<li>Stop the flow once all channels are filled, then incubate the BS3/DNA solution in the barcode at RT for 2 hr. Do not allow the solution to dry up. Bake the PDMS mold with attached barcode slide for 1 hr at 75 &#176;C. 
		Note: To facilitate alignment in subsequent flow-patterning steps, the edges of the channel pattern on the barcode slide may be outlined. This is done by carefully scratching the glass surface using a diamond scribe to generate alignment markers on the bottom of the glass slide. Alignment in later stages of the protocol may be checked under a microscope.</li>
		<li>Remove the PDMS mold from the barcode slide. Wash the slide gently with 0.01% SDS once and three times with ultrapure water.
		<ol>
			<li>Dry the barcode slide using a microscope slide spinner. Store the barcode slide in a clean 50-ml centrifuge tube for subsequent use.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Validation of the One-dimensional Pattern on the Barcode Slide
Note: This validation protocol may also be adapted for use in assessing the quality of subsequent flow patterning steps.
<ol>
	<li>Blocking of the slide
	<ol>
		<li>Prepare 1% bovine serum albumin (BSA) in PBS. Filter this solution through a 0.45 &#181;m syringe filter before use. Using a gel-loading tip, apply 50 &#181;l of 1% BSA solution to one edge of the barcode slide.</li>
		<li>Incubate the 1% BSA solution for 1 hr at RT.</li>
	</ol>
	</li>
	<li>Incubation with Cyanine 3 (Cy3)-conjugated complementary DNA
	<ol>
		<li>Prepare a cocktail of A&#39;, B&#39;, and C&#39; oligonucleotides conjugated to Cy3 at one end. The sequences of A&#39;, B&#39;, and C&#39; are complementary to those of A, B, and C, respectively. The working concentration of the Cy3-DNA is 0.05 &#181;M in 0.1% BSA.</li>
		<li>Remove the BSA solution from the slide by pipetting, then apply 30 &#181;l of the DNA cocktail solution on the same edge of the slide. Incubate the Cy3-DNA cocktail on the slide at RT for 1 hr. Perform this incubation step in the dark to protect the Cy3 moiety from photobleaching.</li>
	</ol>
	</li>
	<li>Analysis of fluorescence intensity
	<ol>
		<li>Pipette out the Cy3-DNA cocktail and wash the slide in 1% BSA, PBS, and finally in diluted PBS (1 part PBS with 50 parts ultrapure water). Dry the slide using a spinner.</li>
		<li>Observe the fluorescence (Figure 2B) using a fluorescence microscope or a microarray scanner. When using a microarray scanner, set the laser emission wavelength to 532 nm, the pixel size at 5 microns, photomultiplier tube (PMT) gain at 450 and power at 15%.</li>
	</ol>
	</li>
</ol>
3. Fabrication of the 2-dimensional (3x3) DNA Array14
<ol>
	<li>Preparation of the PDMS barcode mold
	<ol>
		<li>Perform procedure (1.1) to construct another SU-8 master, but this time use a chrome mask with a flow pattern perpendicular to that of the first design. Perform procedure (1.2) to construct a new PDMS mold with the perpendicular pattern.</li>
	</ol>
	</li>
	<li>Two-dimensional flow patterning of ssDNA
	<ol>
		<li>For a 3 x 3 array, prepare 150 &#181;M stock solutions of A&#39;-i, B&#39;-ii, C&#39;-iii, A&#39;-iv, B&#39;-v, C&#39;-vi, A&#39;-vii, B&#39;-viii, and C&#39;-ix DNA in 3% BSA/PBS. These oligonucleotides serve as &#34;bridging sequences&#34; (Figure 2A). Combine the oligonucleotide solutions (Solutions 1 to 3) such that the working concentration is 50 &#181;M for each oligonucleotide. Use the guide provided in Table 1.</li>
		<li>Flow 3% BSA/PBS blocking solution into all 20 channels for 1 hr at 0.5-1 psi.</li>
		<li>Flow Solutions 1, 2, and 3 into channels 1, 2, and 3, respectively. Follow this order for subsequent sets of 3 channels. Flow is usually completed in around 40 min. Incubate the DNA solutions at RT for 2 hr to allow the DNA to hybridize.</li>
		<li>Flow 3% BSA/PBS blocking solution into all 20 channels for 1 hr at 0.5-1 psi to remove unhybridized DNA. Peel off the PDMS slab, and wash the resulting DNA microarray slide by dipping the glass slide into 3% BSA/PBS once and PBS twice, followed by diluted PBS (1 part PBS and 50 parts ultrapure water). Dry the slide using a microscope slide spinner.</li>
		<li>Perform a second validation step (Figure 2C) similar to that in section 2. Use oligonucleotides i&#39; to ix&#39; that are Cy3-conjugated. Store the 3 x 3 array slide in a 50-ml centrifuge tube for subsequent use. 
		Note: The DNA microarray can be stored at RT in a desiccator for months.</li>
	</ol>
	</li>
</ol>
4. Conversion of the 3 x 3 DNA Array into an Antibody Array
<ol>
	<li>Preparation of antibody-oligonucleotide (DEAL) conjugates
	<ol>
		<li>Prepare solutions of 200 mM succinimidyl-4-formylbenzoate (S-4FB) and 40 mM succinimidyl-6-hydrazinonicotinamide (S-HyNic) in anhydrous N,N-dimethylformamide (DMF).</li>
		<li>Prepare up to 7 separate solutions of capture antibodies (1 mg/ml) in PBS. 
		Note: If the antibody stock solutions contain sodium azide bacteriostat, perform buffer exchange with PBS using spin desalting columns with 7 kDa molecular weight cut-off (MWCO).</li>
		<li>Prepare separate 400 &#181;M solutions of i&#39;, ii&#39;, iii&#39;, iv&#39;, v&#39;, vi&#39;, and vii&#39; DNA. Assign each capture antibody to one oligonucleotide sequence. Combine 40 &#181;l of 400 &#181;M DNA with 12.25 &#181;l of DMF in microcentrifuge tubes and spin down to mix thoroughly.
		<ol>
			<li>To each DNA/DMF solution, add 2.3 &#181;l of 200 mM S-4FB in DMF. For every 100 &#181;g of capture antibody, add 2.25 &#181;l of 40 mM S-HyNic in DMF.</li>
		</ol>
		</li>
		<li>Incubate the antibody/S-HyNic and DNA/S-4FB solutions for 4 hr at RT.</li>
		<li>In preparation for the antibody-DNA coupling reaction, prepare new spin desalting columns (one for each DNA solution and one for each antibody) by washing them with citrate buffer at pH 6.</li>
		<li>After 4 hr of incubation, perform buffer exchange for each antibody/S-HyNic and DNA/S-4FB solution. Combine the S-4FB-conjugated i&#39;, ii&#39;, iii&#39;, iv&#39;, v&#39;, vi&#39; and vii&#39; oligonucleotides with the antibody-S-HyNic conjugates. Incubate the mixtures for 2 hr at RT.</li>
		<li>Incubate the reaction O/N at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Purification of antibody-oligonucleotide (DEAL) conjugates 
	Note: To purify the antibody-oligonucleotide conjugates, perform fast protein liquid chromatography (FPLC) on a standard FPLC system equipped with a Superose 6 10/300 GL column.
	<ol>
		<li>Set the wavelength of UV detector of the FPLC system to 280 nm. Use isocratic flow of PBS (pH 7.4) at 0.3 ml/min to separate the antibody-oligonucleotide conjugates from the excess S-4FB-DNA.</li>
		<li>Pool the fractions containing the conjugate and concentrate the fractions to a volume of 150 &#181;l using spin filters with a 10 kDa MWCO.</li>
	</ol>
	</li>
	<li>Two-dimensional patterning of antibodies
	<ol>
		<li>Prepare another PDMS mold with microchambers or micro-wells using fabrication procedures in step (1.2). The PDMS mold may contain microliter to nanoliter wells for immunoassays. 
		Note: For general biomarker detection in fluidic samples, a PDMS mold with multiple wells is mated with the array slide. The features of the PDMS mold depend on the system being studied. For instance, the detection of proteins from single cell experiments can be performed with a PDMS mold containing microchambers with 0.15-nl&#160;volumes.</li>
		<li>(Optional) Subject the PDMS mold to plasma cleaning (18 W) for 1.5 min to render its patterned surface hydrophilic. Prior to plasma cleaning, use adhesive tape to block all other surfaces that will be directly bonded to the 3 x 3 array slide. 
		Note: Step (4.3.2) is optional but is usually performed when the PDMS mold is intended for use in single cell experiments.</li>
		<li>Mate the PDMS mold with the 3 x 3 array slide, then block the slide with 1% BSA in PBS. Incubate for 1 hr at RT. Meanwhile, prepare a cocktail (200 &#181;l final volume) of antibody-oligonucleotide conjugates. The working concentration of each conjugate is 10 &#181;g/ml in 1% BSA/PBS.</li>
		<li>Add the antibody-oligonucleotide cocktail, then incubate for 1 hr at 37 &#176;C to allow the oligonucleotide moiety of the conjugates to hybridize with specific spots on the 3 x 3 arrays, thereby converting the DNA array to an antibody array.</li>
		<li>Repeat step (3.2.4) to clean and dry the slide. The highest sensitivity can be achieved if the antibody array is used immediately. Prolonged storage may result in loss of sensitivity.</li>
	</ol>
	</li>
	<li>Detection of proteins
	<ol>
		<li>Reconstitute recombinant proteins or prepare a filtered cell sample.</li>
		<li>Mate the microarray with a custom-designed chip, and block the surface with 3% BSA in PBS for 1 hr. Then remove the BSA solution, and apply samples and incubate for 2 hr.</li>
		<li>Wash off the samples using 3% BSA in PBS three times, and then add detection antibodies at a concentration provided by the product datasheet. Incubate for 2 hr.</li>
		<li>Wash off the detection antibodies by 3% BSA in PBS three times, and then add Cyanine 5(Cy5)-streptavidin at 1 &#181;g/ml, followed by incubation for 1 hr.</li>
		<li>Repeat step (3.2.4) to clean and dry the slide for scanning.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncoproteomic+profiling+with+antibody+microarrays.">Oncoproteomic profiling with antibody microarrays.</a> Genome Med. 1 (7), (2009).</li><li>Angenendt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+protein+and+antibody+microarray+technology.">Progress in protein and antibody microarray technology.</a> Drug Discov Today. 10 (7), 503-511 (2005).</li><li>Sun, H. Y., Chen, G. Y. J., Yao, S. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+microarray+technologies+for+proteomics.">Recent advances in microarray technologies for proteomics.</a> Chem Biol. 20 (5), 685-699 (2013).</li><li>Fan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+barcode+chips+for+rapid,+multiplexed+analysis+of+proteins+in+microliter+quantities+of+blood.">Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood.</a> Nat Biotechnol. 26 (12), 1373-1378 (2008).</li><li>Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+technologies+for+monitoring+immune+systems.">Single-cell technologies for monitoring immune systems.</a> Nat Immunol. 15 (2), 128-135 (2014).</li><li>Varadarajan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid,+efficient+functional+characterization+and+recovery+of+HIV-specific+human+CD8(+)+T+cells+using+microengraving.">Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving.</a> Proc Natl Acad Sci USA. 109 (10), 3885-3890 (2012).</li><li>Ma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation-based+delivery+of+cell-penetrating+peptide+conjugates+of+peptide+nucleic+acids+for+antisense+inhibition+of+intracellular+bacteria.">Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria.</a> Integr Biol-Uk. 6 (10), 973-978 (2014).</li><li>Wang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitating+cell-cell+interaction+functions+with+applications+to+glioblastoma+multiforme+cancer+cells.">Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells.</a> Nano Lett. 12 (12), 6101-6106 (2012).</li><li>Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+cellular+architectures+are+predicted+through+the+characterization+of+two-cell+interactions.">Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions.</a> Proc Natl Acad Sci USA. 111 (17), 6521-6526 (2014).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+methods+for+the+simultaneous+quantitation+of+metabolites+and+proteins+from+single+cells.">Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells.</a> J Am Chem Soc. 137 (12), 4066-4069 (2015).</li><li>Shi, Q. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+chip+for+profiling+intracellular+signaling+pathways+in+single+tumor+cells.">Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells.</a> Proc Natl Acad Sci USA. 109 (2), 419-424 (2012).</li><li>Ma, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+clinical+microchip+for+evaluation+of+single+immune+cells+reveals+high+functional+heterogeneity+in+phenotypically+similar+T+cells.">A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells.</a> Nat Med. 17 (6), 738-743 (2011).</li><li>Deng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+microfluidic+chip+system+for+single-cell+secretion+profiling+of+rare+circulating+tumor+cells.">An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells.</a> Sci Rep. 4, 7499 (2014).</li><li>Vermesh, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-density,+multiplexed+patterning+of+cells+at+single-cell+resolution+for+tissue+engineering+and+other+applications.">High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications.</a> Angew Chem Int Ed. 50 (32), 7378-7380 (2011).</li><li>Yu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+single-cell+functional+proteomics+for+fundamental+and+applied+biomedical+applications.">Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications.</a> Annu Rev Anal Chem. 7, 275-295 (2014).</li><li>Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-encoded+antibody+libraries:+A+unified+platform+for+multiplexed+cell+sorting+and+detection+of+genes+and+proteins.">DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins.</a> J Am Chem Soc. 129, 1959-1967 (2007).</li><li>Alegria-Schaffer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+protein-protein+cross-linking.">General protein-protein cross-linking.</a> Methods Enzymol. 539, 81-87 (2014).</li><li>Ahmad, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robotics+platform+for+automated+batch+fabrication+of+high+density,+microfluidics-based+DNA+microarrays,+with+applications+to+single+cell,+multiplex+assays+of+secreted+proteins.">A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins.</a> Rev Sci Instrum. 82, 094301 (2011).</li></ol>

The authors have no competing interests to disclose.

Flow pattern design is the first critical step in fabricating the 2-D microarray. To generate two overlapping DNA patterns on a glass substrate, the channel features of the first design should be perpendicular to those of the second (Figure 1A-B). The designs also consider the downstream applications of the microarray. In the case of single cell analysis, the microarray is used to detect proteins from single cells enclosed in microchambers, therefore the channel dimensions are made compatible with the microchambers that align with the 2-D arrays. Each design is rendered on a photomask and standard photolithography techniques are used to fabricate the channel features in SU-8 on a silicon wafer (Figure 1C-D). This serves as the master for molding PDMS. Once the mold has been fabricated, it is bonded to a PLL-coated slide and then coupled with a nitrogen gas flow set-up (Figure 1E). The set-up we use is simple and has the advantage of being easily incorporated into any laboratory with a pressure-regulated nitrogen gas source. We use an assembly of inexpensive multiple 3-way valves connected to a nitrogen gas tank. The air flow for patterning must be maintained at low pressures (0.5-1 psi) to avoid the delamination of the glass slide from the mold. Leaks within the PDMS mold can compromise the integrity of the patterns.
The DNA flow patterning steps in this protocol utilize ssDNA with carefully selected orthogonal sequences (Figure 2A). Prior to flow-patterning, the unique sequences on these oligonucleotides should be tested for the absence of cross-talk. A simple test for cross-talk is done by modifying the validation procedure we introduce in our protocol (Step 2). Instead of using a cocktail of Cy3-tagged complementary DNA, only one type of complementary sequence is used at a time for a selected area of the slide on which multiple DNA sequences are immobilized. In the absence of DNA cross-talk, only one stripe (for the 1-D DNA array) or one spot (for the 2-D DNA array) should be fluorescent under a Cy3 filter. Examples of thoroughly validated orthogonal sequences can be found in the Table of Materials and Equipment. The first DNA patterning step introduces three kinds of &#34;anchor&#34; oligonucleotides. These 80-nt sequences are comprised of two 20-mer poly-A regions that alternate with two unique 20-mer sequences. The 5&#39;-amine modification on these anchor sequences is necessary for amine-to-amine cross-linking17 with PLL mediated by BS3. The second DNA patterning step does not require a cross-linker. This step introduces &#34;bridging&#34; oligonucleotides that partly hybridize with the anchor sequences. Each 60-nt bridging sequence consists of a 20-mer region complementary to one anchor sequence, a 20-mer poly-A spacer, and a unique 20-mer sequence. Validation of the DNA arrays (Figure 2B-C) is performed after every DNA flow-patterning step to assess the quality of the patterning steps and to ensure no cross-contamination14. This is performed by introducing Cy3-conjugated oligonucleotide probes that hybridize with the DNA patterns. With the parameters specified in Step (2.3.2) for analyzing fluorescence intensity, the DNA patterns should exhibit fluorescence intensities of at least 40,000 a.u. to maximize the sensitivity of the downstream immunoassays performed using the microarray. Strategic use of different Cy3-DNA sets during validation gives rise to alternative patterns (Figure 2D), thus demonstrating the flexibility of the DNA patterning steps8. Failure to achieve uniform patterns could result from leaks or mechanical obstructions (such as dust particles) encountered in the flow-patterning steps.
The preparation of antibody-oligonucleotide DEAL conjugates is another critical step in this protocol. The choice of antibodies is dictated by the biological system under study. The oligonucleotides used in conjugation should have sequences complementary to those anchored on the DNA array. Stock solutions of the S-4FB and S-HyNic linkers should be freshly prepared and kept away from moisture to avoid hydrolysis. The incubation times used in our conjugation protocol are long enough to introduce the desired functionalities on the antibodies and DNA. The final coupling reaction is only quenched by removing the unreacted S-4FB-conjugated oligonucleotides via FPLC. Thus, FPLC purification should be performed immediately after completing the conjugation. When performing FPLC with the system described in our protocol, lower flow rates (0.2-0.25 ml/min) may also be used to improve resolution. The conjugates are eluted as a broad peak (elution volume of around 9-15 ml) that appears before a narrower and higher DNA peak (17-20 ml elution volume). We do not recommend storing solutions of conjugates with excess S-4FB-DNA because this can lead to loss of antigen-binding sites in the antibody upon conjugation with excess functionalized DNA. The sensitivity, specificity, and reproducibility of sandwich ELISAs using DEAL conjugates have been demonstrated in previous studies.8,9,11,12,16 To assess the quality of antibody-DNA conjugates, the conjugates may be incubated on DNA arrays to generate the antibody array, which is subsequently used in sandwich ELISA experiments to generate calibration curves for protein detection (Figure 3F). To generate these calibration curves, recombinant proteins provided in a conventional sandwich ELISA kit may be used. The use of high-quality conjugates should give rise to linear ranges and lower limits of detection comparable with those of the kit. As an example, the lower limits for INF&#947; and TNF&#945; for sandwich ELISA on our antibody array (Figure 3F) are ~50-100 pg/ml, and are consistent with the linear detection range of ~15-1,000 pg/ml indicated in the product datasheet for the conventional sandwich ELISA kit. Poor signal readout obtained in downstream sandwich ELISA experiments could be attributed to the low quality of DNA array, the interference of excess DNA in the conjugate solutions, or alternatively, incomplete conjugation of ssDNAs with antibodies.
Major concerns for performing sandwich ELISA on the antibody array include cross-talk between reagents and whether the signal reflects the real biological events. The orthogonal DNAs we use in this protocol have been thoroughly validated to have less than 0.1% cross-talk. Therefore any cross-talk observed at the immunoassay stage is mainly from the antibodies and ELISA reagents. Testing for cross-talk among antibodies in the array should be performed prior to conducting assays on real samples. Once an antibody panel is constructed, a few sandwich ELISA control experiments should be performed with the following conditions: 1. Without antigens, 2. Without detection antibodies, and 3. Detection antibodies and labeling reagents only. If cross-talk is observed at the immunoassay stage, the antibody pairs and/or ELISA reagents should be replaced. It should be noted that the use of commercially available antibodies from conventional ELISA kits does not guarantee applicability to the array-based sandwich ELISA technique.
The merits of this technology include inexpensive manufacturing, miniature size, and flexibility of design. Our fabrication protocol does not need a microarray spotter that may not be available to many users of antibody arrays. The flow patterning set-up can be easily assembled in simple laboratories. For laboratories that are not equipped with instruments for photolithography, the CAD designs we provide in our protocol may be forwarded to companies that offer microfabrication services. Downsizing the conventional microarray into the compact array fabricated with our protocol allows for compatibility with microchips used in single-cell experiments. Our protocol features the production of the array as an ssDNA array first before conversion to an antibody array. Preliminary patterning with ssDNAs has a number of advantages. First, ssDNAs are chemically more stable compared to antibodies, thus the ssDNA-patterned slides can be stored in a desiccator for at least 6 months without significant degradation8,16. Second, our approach offers an end user the flexibility to choose the assays needed, by simply mixing the selective conjugates together in a solution without modification of the microarray; On the contrary, conventional protein/antibody arrays are pre-designed and fixed on a substrate, so the change of assays would require the patterning/printing of proteins/antibodies from the very beginning. Representative studies illustrate the use of the barcode antibody microarray in the high-throughput detection of multiple signaling proteins from single cells. By varying the flow pattern designs and/or the oligonucleotide patterning solutions used, a multitude of array layouts can be explored. As an example of this application, functional proteins from single cells may be studied. The chip for single-cell analysis encompasses as many as ~8,700 microchambers, each aligned with a complete 3 x 3 antibody array (Figure 3H). Such a set-up allows for high-throughput detection. Proteins secreted by cells cultured in microchambers can be detected by this array. The versatile microarray design also allows for multiplexed detection of proteins from serum, cell lysates, and single cells after combining the microarray with other generic components8,15. In addition to protein detection, the 3 x 3 antibody array is also useful in capturing cells (Figure 3G).
The main disadvantage of this approach is its added complexity compared with the manufacturing of conventional microarrays. Strategies for patterning and for array design must be carefully conceptualized while considering the specific applications of the fabricated array. This approach also requires a number of critical steps including validation procedures and tests for cross-talk. The 3 x 3 array constructed using our protocol is limited to detecting 7 proteins at a time. However, this limit can be surpassed by creating larger arrays. The protocol featured here is not limited to the fabrication of 3 x 3 microarrays. We have been able to successfully fabricate 5 x 5 microarrays and other dimensions of array elements. In principle, other n x m arrays may be fabricated using similar techniques as long as the oligonucleotide sets used in creating the preliminary DNA-patterned array are orthogonal to avoid cross-talk between array elements. The creation of expanded arrays is achieved by flow patterning n types of ssDNA anchors for the first DNA patterning step, followed by n x m bridging ssDNA sequences for the second patterning step. For instance, to create a 5 x 5 array, anchor sequences A to E may be used, while bridging sequences A&#39;-i to E&#39;-xxv are utilized. To automate the flow patterning process, a robotics platform has been developed18 although this has only utilized one DNA flow patterning step. In principle, the same platform can be extended to the second step of perpendicular flow patterning, while the switching between two steps may require manually peeling off the first PDMS mold after the first patterning step, followed by washing and drying the slide (this step would take about 10 min), before mating the slide with another PDMS mold to facilitate the perpendicularly oriented second patterning step.
We have discussed detailed procedures for fabricating an n x m array patterned with antibodies at high density, which holds great promise for future applications in proteomic studies and cell signaling. The protocol presented here may also serve as a guide for the construction of more elaborate DNA/antibody arrays for other purposes.

Antibody microarrays have been widely used in proteomic studies for decades to examine the presence of targeted proteins, including protein biomarkers1-3. Although this field is currently facing great challenges from other high-throughput technologies such as mass spectrometry (MS), there is still plenty of room for the utility of antibody microarrays, mainly because these devices afford simple data interpretation and easy interface with other assays. In recent years, the integration of microarrays into microchip scaffolds has provided the antibody microarray a new opportunity to thrive4-7. For instance, the barcode microarray integrated into a single-cell microchip has been used in cell communication studies8,9. This technology has distinctive advantages over other available microarray technologies. It features array elements at 10-100 &#956;m, much smaller than the typical 150 &#956;m size used in conventional microarray elements. The construction of smaller array elements is achieved using systematic flow-patterning approaches, and this gives rise to compact microarrays that can detect single-cell secreted proteins and intracellular proteins. Another advantage is the use of a simple, instrument-free setup. This is particularly important, because most laboratories and small companies may not be able to access microarray core facilities. Such barcode antibody microarrays feature enhanced assay throughput and can be used to perform highly multiplexed assays on single cells while achieving high sensitivity and specificity comparable with that of conventional sandwich enzyme-linked immunosorbent assay (ELISA8). This technology has found numerous applications in detecting proteins from glioblastoma9-11, T cells12, and circulating tumor cells13. Alternatively, barcode DNA microarrays alone have been utilized in the precise positioning of neurons and astrocytes for mimicking the in vivo assembly of brain tissue14.
This protocol focuses only on the experimental steps and build-up blocks of the two-dimensional (2-D) barcode antibody microarray which has potential applications in the detection of biomarkers in fluidic samples and in single cells. The technology is based on an addressable single-stranded, one-dimensional (1-D) DNA microarray constructed using orthogonal oligonucleotides that are patterned spatially on glass substrates. The 1-D pattern is formed when parallel flow channels are used in the flow-patterning step, and such a pattern appears as discrete bands visually similar to 1-D Universal Product Code (UPC) barcodes. The construction of a 2-D (n x m) antibody array &#8212; reminiscent of a 2-D Quick Response (QR) matrix code&#160;&#8212; needs more complex patterning strategies, but allows for the immobilization of antibodies at a higher density8,15. The fabrication requires two DNA patterning steps, with the first pattern perpendicular to the second. The points of intersection of these two patterns constitute the n x m elements of the array. By strategically selecting the sequences of single-stranded DNA (ssDNA) utilized in flow-patterning, each element in a given array is assigned a specific address. This spatial reference is necessary in distinguishing between fluorescence signals on the microarray slide. The ssDNA array is converted into an antibody array through the incorporation of complementary DNA-antibody conjugates, forming a platform called DNA-encoded antibody library (DEAL16).
This video protocol describes the key steps in creating n x m antibody arrays which include preparing polydimethylsiloxane (PDMS) barcode molds, flow-patterning ssDNA in two orientations, preparing antibody-oligonucleotide DEAL conjugates, and converting the 3 x 3 DNA array into a 3 x 3 antibody array.

<table border="0" cellpadding="0" cellspacing="0" width="951">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Sylgard 184 silicone elastomer base</td>
			<td style="width:403px;">Dow Corning</td>
			<td style="width:119px;">3097366-1004</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:263px;">Sylgard 184 silicone elastomer curing agent</td>
			<td style="width:403px;">Dow Corning</td>
			<td style="width:119px;">3097358-1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">SU-8 2025 photoresist</td>
			<td style="width:403px;">MicroChem</td>
			<td style="width:119px;">Y111069</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Silicon wafers&#160;</td>
			<td style="width:403px;">University Wafers</td>
			<td style="width:119px;">452</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Poly-L-lysine coated glass slides</td>
			<td style="width:403px;">Thermo Scientific</td>
			<td style="width:119px;">C40-5257-M20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Oligonucleotides</td>
			<td style="width:403px;">Integrated DNA Technologies</td>
			<td style="width:119px;"></td>
			<td>*Custom-ordered from Integrated DNA Technologies, see table below</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Poly-L-lysine adhesive stock solution</td>
			<td style="width:403px;">Newcomer Supply</td>
			<td style="width:119px;">1339</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Bis (sulfosuccinimidyl) suberate&#160; (BS3)</td>
			<td style="width:403px;">Thermo Scientific</td>
			<td style="width:119px;">21585</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">1x Phosphate buffered saline, pH 7.4</td>
			<td style="width:403px;">Quality Biological</td>
			<td style="width:119px;">114-058-101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:263px;">&#196;kta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System</td>
			<td style="width:403px;">GE (Amersham Pharmacia)&#160;</td>
			<td>18-1112-41</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Superose 6 10/300 GL column</td>
			<td style="width:403px;">GE Healthcare Life Sciences</td>
			<td>17-5172-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Capture antibodies</td>
			<td style="width:403px;">various</td>
			<td style="width:119px;">various</td>
			<td>*Antibody selection depends on application</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:263px;">Succinimidyl-6-hydrazino-nicotinamide (S-HyNic)</td>
			<td style="width:403px;">Solulink</td>
			<td style="width:119px;">S-1002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Succinimidyl-4-formylbenzamide (S-4FB)</td>
			<td style="width:403px;">Solulink</td>
			<td style="width:119px;">S-1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">N,N-dimethylformamide</td>
			<td style="width:403px;">Sigma-Aldrich</td>
			<td style="width:119px;">227056</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Citric acid, anhydrous</td>
			<td style="width:403px;">Acros</td>
			<td style="width:119px;">42356</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Sodium hydroxide</td>
			<td style="width:403px;">Fisher Scientific</td>
			<td style="width:119px;">S318</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Amicon Ultra spin filter 10 kDa MWCO</td>
			<td style="width:403px;">EMD Millipore</td>
			<td>UFC201024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:263px;">Spin coater</td>
			<td style="width:403px;">Laurell Technologies</td>
			<td>WS-650-MZ</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biopsy punch with plunger (0.50 mm diameter)</td>
			<td style="width:403px;">Electron Microscopy Sciences</td>
			<td align="right" style="width:119px;">57393</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diamond scribe (Style 60)</td>
			<td style="width:403px;">SPI supplies</td>
			<td align="right" style="width:119px;">6004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trimethylchlorosilane</td>
			<td style="width:403px;">Sigma Aldrich</td>
			<td align="right" style="width:119px;">92361</td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-pattern guided fabrication of high-density barcode antibody microarray

Antibody microarray as a well-developed technology is currently challenged by a few other established or emerging high-throughput technologies. In this report, we renovate the antibody microarray technology by using a novel approach for manufacturing and by introducing new features. The fabrication of our high-density antibody microarray is accomplished through perpendicularly oriented flow-patterning of single stranded DNAs and subsequent conversion mediated by DNA-antibody conjugates. This protocol outlines the critical steps in flow-patterning DNA, producing and purifying DNA-antibody conjugates, and assessing the quality of the fabricated microarray. The uniformity and sensitivity are comparable with conventional microarrays, while our microarray fabrication does not require the assistance of an array printer and can be performed in most research laboratories. The other major advantage is that the size of our microarray units is 10 times smaller than that of printed arrays, offering the unique capability of analyzing functional proteins from single cells when interfacing with generic microchip designs. This barcode technology can be widely employed in biomarker detection, cell signaling studies, tissue engineering, and a variety of clinical applications.

The designs for the PDMS molds (Figure 1A-1B) were drawn using a CAD program (AutoCAD). Two designs shown feature channels for flow patterning, one horizontal and one vertical. The left and right parts of each design are symmetric; either of them could be inlets or outlets. Each of 20 channels is winding from one end all the way to the other end. Each design is printed on a chrome photomask (Figure 1C). The fabricated SU-8 master on a wafer is shown in Figure 1D. To facilitate the flow-patterning of PLL or DNA, the PDMS mold was coupled to a nitrogen gas flow set-up (Figure 1E).
There are three flow-patterning steps used in this protocol. The first step immobilizes PLL on the glass substrate, while the succeeding steps both introduce oligonucleotide solutions. In Table 1, the oligonucleotide compositions of Solutions 1-3 are given. The working concentration of each oligonucleotide is 50 &#181;M and the total volume of each solution is 39 &#181;l. These solutions are prepared by combining 13 &#181;l of each oligonucleotide stock solution (150 &#181;M).
The patterned DNA microarray units are repetitive and adjacent across the whole glass slide. For 3 x 3 microarrays, the maximum density is about 400,000 spots on one glass slide. Side-by-side comparison with commercial DNA microarray reveals that our technology is about 5 times more sensitive when binding to Cy3 tagged complementary DNAs. The patterned DNAs are relatively uniform with ~5% variation across multiple repeats. Those features promise the high quantification ability of our technology when measuring protein contents from biological samples. In addition, the orthogonality of DNAs in combination with the flow channel design offer the flexibility of patterning in a variety of geometries (Figure 2D).
After converting the DNA array into an antibody array through hybridization with DNA-antibody conjugates (Figure 3B), the resulting antibody panel is used in multiplexed detection, mainly through sandwich ELISA platform as shown in Figure 3C. In sandwich ELISA, biotinylated detection (secondary) antibodies bind to the captured proteins, and subsequent labeling with fluorophore-conjugated streptavidin allows for fluorescence-based detection (Figure 3C-E). Detection of proteins shows &#60;10% variation from one end to the other end of the glass slide (Figure 3D). With the 3 x 3 array, we are able to detect up to 7 proteins, while assigning one array element as reference (Cy3 labeled) and another element as negative control. For instance, in a single-cell experiment performed for tumor studies, the proteins interleukin-6 (IL-6), matrix metallopeptidase 9 (MMP9), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), interleukin-8 (IL-8), and macrophage migration inhibitory factor (MIF) from a single cell can be detected simultaneously (Figure 3E).
We also calibrated the system using recombinant proteins at various concentrations. In Figure 3F, calibration curves for the recombinant proteins interferon-&#947;(IFN-&#947;), tumor necrosis factor &#945; (TNF &#945;), interleukin-13 (IL-13), tumor necrosis factor &#946; (TNF &#946;), granzyme B, interleukin-4 (IL-4), and interleukin-8 (IL-8) are shown. The sensitivity of detection is quite similar to that of conventional sandwich ELISA on well plates even with higher loading of DNAs and possibly antibodies on the substrate.
The barcode antibody microarray can be used to detect biomarkers in fluidic samples as well as in single cells. Since single-cell analysis is not the focus of this protocol, we simply exemplified the application of the 3 x 3 antibody microarray in the detection of cytokines. Through antibody-surface marker interactions, cluster of differentiation 8 (CD8)-positive cells were captured on one of the microarray elements (Figure 3G; a PDMS chip on the top), and the rest of the elements were used to detect secreted cytokines (Figure 3H). With this cell capture method, &#34;cell arrays&#34; can be formed. This array capture technique also allows for control over the number of cells subjected to each ELISA experiment. The cells were physically isolated in the microchambers so that the detected proteins pertained to particular single cells. In Figure 3H, it is shown that each microchamber is equipped with 16 microarray elements to ensure encapsulation of a complete 3 x 3 microarray set.
<img alt="Figure 1" src="/files/ftp_upload/53644/53644fig1.jpg" /> 
Figure 1. Design and fabrication of PDMS barcode molds for flow-based DNA patterning. Panel (A) shows the AutoCAD drawings for horizontal and vertical one-dimensional barcode patterns. Panel (B) shows the superimposed horizontal and vertical barcode patterns from (A). Green boxes enclose areas patterned with discrete 3 x 3 arrays. (C) Chrome mask for fabricating the SU-8 master. (D) SU-8 master fabricated on a silicon wafer. (E) Set-up for flow patterning. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53644/53644fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53644/53644fig2.jpg" /> 
Figure 2. Construction and validation of a 3 x 3 DNA array. This figure has been modified from &#34;Quantitating Cell-Cell Interaction Functions with Applications to Glioblastoma Multiforme Cancer Cells,&#34; by Wang, J. et al., 2012, Nano Lett 12. Copyright 2012 by the American Chemical Society. Adapted with permission. (A) Scheme for the DNA flow-patterning steps. (B) Fluorescence intensity profile of 20 channels in a selected area (traced by a vertical line) of the 1D barcode. Cy3-conjugated oligonucleotides were hybridized with the DNA arrays for validation. (C) Fluorescence intensity profile of arrays validated with Cy3-conjugated DNA after completing the second DNA patterning step. (D) Alternative fluorescent patterns from different flow-patterning strategies. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53644/53644fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53644/53644fig3.jpg" /> 
Figure 3. Applications of the 3 x 3 microarray. (A) Scheme for the synthesis of antibody-oligonucleotide DEAL conjugates. (B) Scheme for the conversion of the DNA array into an antibody array through hybridization with antibody-oligonucleotide conjugates. (C) Scheme for utilizing the 3 x 3 microarray in a sandwich ELISA platform. This figure has been modified from &#34;Quantitating Cell-Cell Interaction Functions with Applications to Glioblastoma Multiforme Cancer Cells,&#34; by Wang, J. et al., 2012, Nano Lett 12. Copyright 2012 by the American Chemical Society. Adapted with permission. Panel (D) shows a fluorescence readout generated under a Cy5 channel. This corresponds to a sandwich ELISA experiment that detected 6 proteins. Panel (E) is a zoomed-in profile of a 3 x 3 array readout under Cy3 and Cy5 channels. Panel (F) shows the sandwich ELISA calibration curves for recombinant proteins. Panel (G) shows a &#34;cell array&#34; formed by capturing cells through binding with antibodies on the array. Panel (H) shows the detection result superimposed with microchambers in a microchip. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53644/53644fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Solution</td>
			<td>Oligonucleotide Composition</td>
		</tr>
		<tr>
			<td>1</td>
			<td>A&#8217;-i, B&#8217;-ii, C&#8217;-iii&#160;</td>
		</tr>
		<tr>
			<td>2</td>
			<td>A&#8217;-iv, B&#8217;-v, C&#8217;-vi</td>
		</tr>
		<tr>
			<td>3</td>
			<td>A&#8217;-vii, B&#8217;-viii, C&#8217;-ix</td>
		</tr>
	</tbody>
</table>
Table 1. Composition of Solutions 1-3 for DNA Flow Patterning.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td colspan="2">Anchoring sequences</td>
		</tr>
		<tr>
			<td>A&#160;</td>
			<td>ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA</td>
		</tr>
		<tr>
			<td rowspan="2">B&#160;</td>
			<td>GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-</td>
		</tr>
		<tr>
			<td>AAAAAAAAAAAAAAAAAAAA</td>
		</tr>
		<tr>
			<td>C&#160;</td>
			<td>GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA</td>
		</tr>
		<tr>
			<td colspan="2">Bridging sequences</td>
		</tr>
		<tr>
			<td>A&#8217;-i</td>
			<td>TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA</td>
		</tr>
		<tr>
			<td>B&#8217;-ii</td>
			<td>TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA</td>
		</tr>
		<tr>
			<td>C&#8217;-iii</td>
			<td>TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA</td>
		</tr>
		<tr>
			<td>A&#8217;-iv</td>
			<td>TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT</td>
		</tr>
		<tr>
			<td>B&#8217;-v</td>
			<td>TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG</td>
		</tr>
		<tr>
			<td>C&#8217;-vi</td>
			<td>TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA</td>
		</tr>
		<tr>
			<td>A&#8217;-vii</td>
			<td>TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG</td>
		</tr>
		<tr>
			<td>B&#8217;-viii</td>
			<td>TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG</td>
		</tr>
		<tr>
			<td>C&#8217;-ix</td>
			<td>TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATTAAGTCTGCTTCGGC</td>
		</tr>
		<tr>
			<td colspan="2">Cy3-conjugated oligonucleotides for validation</td>
		</tr>
		<tr>
			<td>A&#8217;</td>
			<td>TACGGACTTAGCTCCAGGAT</td>
		</tr>
		<tr>
			<td>B&#8217;</td>
			<td>TAGGCATGATTCAATGAGGC</td>
		</tr>
		<tr>
			<td>C&#8217;</td>
			<td>TAGCGATAGTAGACGAGTGC</td>
		</tr>
		<tr>
			<td>i&#8217;</td>
			<td>TACTCTGACATCTCGACCAT&#160;</td>
		</tr>
		<tr>
			<td>ii&#8217;</td>
			<td>TAGATACTGCCACTTCACAT</td>
		</tr>
		<tr>
			<td>iii&#8217;</td>
			<td>TACCGTGAACCTTACCTGAT</td>
		</tr>
		<tr>
			<td>iv&#8217;</td>
			<td>AATGCTGGGGAAGGCTACTC</td>
		</tr>
		<tr>
			<td>v&#8217;</td>
			<td>CGCACCGCAGTTTGGTCAAT</td>
		</tr>
		<tr>
			<td>vi&#8217;</td>
			<td>TCCGACGCAACAATAGGGCA</td>
		</tr>
		<tr>
			<td>vii&#8217;</td>
			<td>CCTGCTCGACAACTAGAAGA</td>
		</tr>
		<tr>
			<td>viii&#8217;</td>
			<td>CCGCGACCAGAATTAGATTA</td>
		</tr>
		<tr>
			<td>ix&#8217;</td>
			<td>GCCGAAGCAGACTTAATCAC</td>
		</tr>
	</tbody>
</table>
Table 2. Sequences used in DNA flow-patterning.

Watch this Scientific Journal Video about Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray at JoVE.com

Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray

This protocol outlines the fabrication of a large-scale, multiplexed two-dimensional DNA or antibody array, with potential applications in cell signaling studies and biomarker detection.

Antibody microarray as a well-developed technology is currently challenged by a few other established or emerging high-throughput technologies. In this ...

flow-pattern-guided-fabrication-high-density-barcode-antibody

Nanyang Technological University

Research

JoVE Journal

Chemistry

10.3K Views.  University at Albany, State University of New York. This protocol outlines the fabrication of a large-scale, multiplexed two-dimensional DNA or antibody array, with potential applications in cell signaling studies and biomarker detection.

Video: Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray

A Guided Materials Screening Approach for Developing Quantitative Sol-gel Derived Protein Microarrays

Microarrays have found use in the development of high-throughput assays for new materials and discovery of small-molecule drug leads. Herein we describe a guided material screening approach to identify sol-gel based materials that are suitable for producing three-dimensional protein microarrays. The approach first identifies materials that can be printed as microarrays, narrows down the number of materials by identifying those that are compatible with a given enzyme assay, and then hones in on optimal materials based on retention of maximum enzyme activity. This approach is applied to develop microarrays suitable for two different enzyme assays, one using acetylcholinesterase and the other using a set of four key kinases involved in cancer. In each case, it was possible to produce microarrays that could be used for quantitative small-molecule screening assays and production of dose-dependent inhibitor response curves. Importantly, the ability to screen many materials produced information on the types of materials that best suited both microarray production and retention of enzyme activity. The materials data provide insight into basic material requirements necessary for tailoring optimal, high-density sol-gel derived microarrays.

A guided material screening approach to develop sol-gel derived protein doped microarrays using an emerging pin-printing method of fabrication is described. This methodology is demonstrated through the development of acetylcholinesterase and multikinase microarrays, which are used for cost-effective small-molecule screening.

Microarrays have found use in the development of high-throughput assays for new materials and discovery of small-molecule drug leads. Herein we describe a ...

Multiplexed Fluorescent Microarray for Human Salivary Protein Analysis Using Polymer Microspheres and Fiber-optic Bundles

Herein, we describe a protocol for simultaneously measuring six proteins in saliva using a fiber-optic microsphere-based antibody array. The immuno-array technology employed combines the advantages of microsphere-based suspension array fabrication with the use of fluorescence microscopy. As described in the video protocol, commercially available 4.5 &#956;m polymer microspheres were encoded into seven different types, differentiated by the concentration of two fluorescent dyes physically trapped inside the microspheres. The encoded microspheres containing surface carboxyl groups were modified with monoclonal capture antibodies through EDC/NHS coupling chemistry. To assemble the protein microarray, the different types of encoded and functionalized microspheres were mixed and randomly deposited in 4.5 &#956;m microwells, which were chemically etched at the proximal end of a fiber-optic bundle. The fiber-optic bundle was used as both a carrier and for imaging the microspheres. Once assembled, the microarray was used to capture proteins in the saliva supernatant collected from the clinic. The detection was based on a sandwich immunoassay using a mixture of biotinylated detection antibodies for different analytes with a streptavidin-conjugated fluorescent probe, R-phycoerythrin. The microarray was imaged by fluorescence microscopy in three different channels, two for microsphere registration and one for the assay signal. The fluorescence micrographs were then decoded and analyzed using a homemade algorithm in MATLAB.

We describe a procedure for profiling salivary proteins using multiplexed microsphere-based antibody arrays. Monoclonal antibodies were covalently linked to fluorescent dye-encoded 4.5 &#x03BC;m polymer microspheres using carbodiimide chemistry. The modified microspheres were deposited in fiber-optic microwells to measure protein levels in saliva using fluorescence sandwich immunoassays.

Herein, we describe a protocol for simultaneously measuring six proteins in saliva using a fiber-optic microsphere-based antibody array. The immuno-array ...

Fabrication of Large-area Free-standing Ultrathin Polymer Films

This procedure describes a method for the fabrication of large-area and ultrathin free-standing polymer films. Typically, ultrathin films are prepared using either sacrificial layers, which may damage the film or affect its mechanical properties, or they are made on freshly cleaved mica, a substrate that is difficult to scale. Further, the size of ultrathin film is typically limited to a few square millimeters. In this method, we modify a surface with a polyelectrolyte that alters the strength of adhesion between polymer and deposition substrate. The polyelectrolyte can be shown to remain on the wafer using spectroscopy, and a treated wafer can be used to produce multiple films, indicating that at best minimal amounts of the polyelectrolyte are added to the film. The process has thus far been shown to be limited in scalability only by the size of the coating equipment, and is expected to be readily scalable to industrial processes. In this study, the protocol for making the solutions, preparing the deposition surface, and producing the films is described.

We describe a method for the fabrication of large-area (up to 13 cm diameter) and ultrathin (as thin as 8 nm) polymer films. Instead of using a sacrificial interlayer to delaminate the film from its substrate, we use a self-limiting surface treatment suitable for arbitrarily large areas.

This procedure describes a method for the fabrication of large-area and ultrathin free-standing polymer films.  Typically, ultrathin films are prepared ...

Microbubble Fabrication of Concave-porosity PDMS Beads

Microbubble fabrication (by use of a fine emulsion) provides a means of increasing the surface-area-to-volume (SAV) ratio of polymer materials, which is particularly useful for separations applications. Porous polydimethylsiloxane (PDMS) beads can be produced by heat-curing such an emulsion, allowing the interface between the aqueous and aliphatic phases to mold the morphology of the polymer. In the procedures described here, both polymer and crosslinker (triethoxysilane) are sonicated together in a cold-bath sonicator. Following a period of cross-linking, emulsions are added dropwise to a hot surfactant solution, allowing the aqueous phase of the emulsion to separate, and forming porous polymer beads. We demonstrate that this method can be tuned, and the SAV ratio optimized, by adjusting the electrolyte content of the aqueous phase in the emulsion. Beads produced in this way are imaged with scanning electron microscopy, and representative SAV ratios are determined using Brunauer&#8211;Emmett&#8211;Teller (BET) analysis. Considerable variability with the electrolyte identity is observed, but the general trend is consistent: there is a maximum in SAV obtained at a specific concentration, after which porosity decreases markedly.

Procedures used to generate microstructured concave-porosity polydimethylsiloxane beads are presented. Effects of electrolyte concentration and identity within the aqueous phase are particularly emphasized.

Microbubble fabrication (by use of a fine emulsion) provides a means of increasing the surface-area-to-volume (SAV) ratio of polymer materials, which is ...

Influence of Hybrid Perovskite Fabrication Methods on Film Formation, Electronic Structure, and Solar Cell Performance

Hybrid organic/inorganic halide perovskites have lately been a topic of great interest in the field of solar cell applications, with the potential to achieve device efficiencies exceeding other thin film device technologies. Yet, large variations in device efficiency and basic physical properties are reported. This is due to unintentional variations during film processing, which have not been sufficiently investigated so far. We therefore conducted an extensive study of the morphology and electronic structure of a large number of CH3NH3PbI3 perovskite where we show how the preparation method as well as the mixing ratio of educts methylammonium iodide and lead(II) iodide impact properties like film formation, crystal structure, density of states, energy levels, and ultimately the solar cell performance.

We present an extensive study on the effects of different fabrication methods for organic/inorganic perovskite thin films by comparing crystal structures, density of states, energy levels, and ultimately the solar cell performance.

Hybrid organic/inorganic halide perovskites have lately been a topic of great interest in the field of solar cell applications, with the potential to ...

Fabrication and Testing of Photonic Thermometers

In recent years, a push for developing novel silicon photonic devices for telecommunications has generated a vast knowledge base that is now being leveraged for developing sophisticated photonic sensors. Silicon photonic sensors seek to exploit the strong confinement of light in nano-waveguides to transduce changes in physical state to changes in resonance frequency. In the case of thermometry, the thermo-optic coefficient, i.e., changes in refractive index due to temperature, causes the resonant frequency of the photonic device such as a Bragg grating to drift with temperature. We are developing a suite of photonic devices that leverage recent advances in telecom compatible light sources to fabricate cost-effective photonic temperature sensors, which can be deployed in a wide variety of settings ranging from controlled laboratory conditions, to the noisy environment of a factory floor or a residence. In this manuscript, we detail our protocol for the fabrication and testing of photonic thermometers.

We describe the process of fabrication and testing of photonic thermometers.

In recent years, a push for developing novel silicon photonic devices for telecommunications has generated a vast knowledge base that is now being ...

Chemo-enzymatic Synthesis of N-glycans for Array Development and HIV Antibody Profiling

We present a highly efficient way for the rapid preparation of a wide range of N-linked oligosaccharides (estimated to exceed 20,000 structures) that are commonly found on human glycoproteins. To achieve the desired structural diversity, the strategy began with the chemo-enzymatic synthesis of three kinds of oligosaccharyl fluoride modules, followed by their stepwise &#945;-selective glycosylations at the 3-O and 6-O positions of the mannose residue of the common core trisaccharide having a crucial &#946;-mannoside linkage. We further attached the N-glycans to the surface of an aluminum oxide-coated glass (ACG) slide to create a covalent mixed array for the analysis of hetero-ligand interaction with an HIV antibody. In particular, the binding behavior of a newly isolated HIV-1 broadly neutralizing antibody (bNAb), PG9, to the mixture of closely spaced Man5GlcNAc2 (Man5) and 2,6-di-sialylated bi-antennary complex type N-glycan (SCT) on an ACG array, opens a new avenue to guide the effective immunogen design for HIV vaccine development. In addition, our ACG array embodies a powerful tool to study other HIV antibodies for hetero-ligand binding behavior.

Chemo-enzymatic Synthesis of N-glycans for Array Development and HIV Antibody Profiling

A modular approach to the synthesis of N-glycans for attachment to an aluminum oxide-coated glass slide (ACG slide) as a glycan microarray has been developed and its use for the profiling of an HIV broadly neutralizing antibody has been demonstrated.

We present a highly efficient way for the rapid preparation of a wide range of N-linked oligosaccharides (estimated to exceed 20,000 structures) that are ...

Fabrication of Spherical and Worm-shaped Micellar Nanocrystals by Combining Electrospray, Self-assembly, and Solvent-based Structure Control

Micellar nanocrystals (micelles with encapsulated nanocrystals) have become an emerging major class of nanobiomaterials. We describe a method of fabricating micellar nanocrystals based on combining top-down electrospray, bottom-up self-assembly, and solvent-based structure control. This method involves first using electrospray to generate uniform ultrafine liquid droplets, each of which functions as a micro-reactor in which self-assembly reaction occurs forming micellar nanocrystals, with the structures (micelle shape and nanocrystal encapsulation) controlled by the organic solvent used. This method is largely continuous and produces high quality micellar nanocrystal products with an inexpensive structure control approach. By using a water-miscible organic solvent tetrahydrofuran (THF), worm-shaped micellar nanocrystals can be produced due to solvent-induced/facilitated micelle fusion. Compared with the common spherical micellar nanocrystals, worm-shaped micellar nanocrystals can offer minimized non-specific cellular uptake, thus enhancing biological targeting. By co-encapsulating multiple nanocrystals into each micelle, multifunctional or synergistic effects can be achieved. Current limitations of this fabrication method, which will be part of the future work, primarily include imperfect encapsulation in the micellar nanocrystal product and the incompletely continuous nature of the process.

The present work describes a method to fabricate micellar nanocrystals, an emerging major class of nanobiomaterials. This method combines top-down electrospray, bottom-up self-assembly, and solvent-based structure control. The fabrication method is largely continuous, can produce high quality products, and possesses an inexpensive means of structure control.

Micellar nanocrystals (micelles with encapsulated nanocrystals) have become an emerging major class of nanobiomaterials. We describe a method of ...

Fabrication and Testing of Catalytic Aerogels Prepared Via Rapid Supercritical Extraction

Protocols for preparing and testing catalytic aerogels by incorporating metal species into silica and alumina aerogel platforms are presented. Three preparation methods are described: (a) the incorporation of metal salts into silica or alumina wet gels using an impregnation method; (b) the incorporation of metal salts into alumina wet gels using a co-precursor method; and (c) the addition of metal nanoparticles directly into a silica aerogel precursor mixture. The methods utilize a hydraulic hot press, which allows for rapid (&#60;6 h) supercritical extraction and results in aerogels of low density (0.10 g/mL) and high surface area (200-800 m2/g). While the work presented here focuses on the use of copper salts and copper nanoparticles, the approach can be implemented using other metal salts and nanoparticles. A protocol for testing the three-way catalytic ability of these aerogels for automotive pollution mitigation is also presented. This technique uses custom-built equipment, the Union Catalytic Testbed (UCAT), in which a simulated exhaust mixture is passed over an aerogel sample at a controlled temperature and flow rate. The system is capable of measuring the ability of the catalytic aerogels, under both oxidizing and reducing conditions, to convert CO, NO and unburned hydrocarbons (HCs) to less harmful species (CO2, H2O and N2). Example catalytic results are presented for the aerogels described.

Here we present protocols for preparing and testing catalytic aerogels by incorporating metal species into silica and alumina aerogel platforms. Methods for preparing materials using copper salts and copper-containing nanoparticles are featured. Catalytic testing protocols demonstrate the effectiveness of these aerogels for three-way catalysis applications.

Protocols for preparing and testing catalytic aerogels by incorporating metal species into silica and alumina aerogel platforms are presented. Three ...

Genetic Encoding of a Non-Canonical Amino Acid for the Generation of Antibody-Drug Conjugates Through a Fast Bioorthogonal Reaction

Antibody-drug conjugates (ADCs) used nowadays in clinical practice are mixtures of antibody molecules linked to a varying number of toxins at different positions. Preclinical studies have shown that the therapeutic index of these traditional ADCs can be improved by the site-specific linkage of toxins. However, current approaches to produce homogeneous ADCs have several limitations, such as low protein expression and slow reaction kinetics. In this protocol we describe how to set up an expression system to incorporate a cyclopropene derivative of lysine (CypK) into antibodies using genetic code expansion. This minimal bioorthogonal handle allows rapid conjugation of tetrazine derivatives through an inverse-demand Diels-Alder cycloaddition. The expression system here reported enables the facile production and purification of trastuzumab bearing CypK in each of the heavy chains. We explain how to link the antibody to the toxin monomethyl auristatin E and characterize the immunoconjugate by hydrophobic interaction chromatography and mass spectrometry. Finally, we describe assays to assess the stability in human serum of the dihydropyridazine linkage resulting from the conjugation and to test the selective cytotoxicity of the ADC for breast cancer cells with high levels of HER2 receptor.

Incorporating a cyclopropene derivative of lysine into antibodies allows the site-specific, rapid and efficient linkage of tetrazine-bearing molecules to generate antibody-drug conjugates.

Antibody-drug conjugates (ADCs) used nowadays in clinical practice are mixtures of antibody molecules linked to a varying number of toxins at different ...