C.R. acknowledges funding from the Forschungsinitiative Rheinland-Pfalz and ReALity (project MORE), the BMBF Cluster4Future CurATime (project MicrobAIome; 03ZU1202CA), the Wilhelm Sander-Stiftung (Nr. 2022.131.1), and the Deutsche Zentren der Gesundheitsforschung (DZG) Innovation Fund &#34;Microbiome&#34; (81X2210129). C.R. is a scientist at the German Center for Cardiovascular Research (DZHK). C.R. is a member of the Center for Translational Vascular Biology (CTVB), the Research Center for Immunotherapy (FZI), and the Potentialbereich EXPOHEALTH at the Johannes Gutenberg-University Mainz. C.R. is a member of the DFG Research Unit 5644 INFINITE (RE 3450/15-1). C.R. was awarded a Fellowship from the Gutenberg Research College at the Johannes Gutenberg-University Mainz. K.K. is supported by the DZHK &#34;Promotion of Women Scientists&#34; Excellence Programme and is a member of Young DZHK. Z.G and O.D. are PhD students at the Mainz Research School of Translational Biomedicine (TransMed).

All procedures involving mice were approved by the local committee on the legislation of animals (Landesuntersuchungsamt Rheinland-Pfalz, Koblenz, Germany; G21-1-041). 6-8 week-old male and female B6.FVB-F2rtm1a(EUCOMM) Tg/Cdh5-cre)7Mlia/Tarc mice were used for the study. The endothelial cell-specific regulation of F2r (PAR1) occurs via the VE-Cadherin Cre promoter28. In this study, flox-F2r x VE-Cadherin Cre+ (F2R&#916;EC)&#160;exhibited reduced F2r (PAR1) expression on endothelial cells,&#160;and flox-F2r x VE-Cadherin Cre- (WT) express normal endothelial F2r (PAR1) levels. The details of the reagents and the equipment used in this study are listed in the Table of Materials.
1. Preparation for the surgery
<ol>
	<li>Sterilize the necessary surgical instruments (extra narrow scissors straight, forceps, vascular clamp, etc.).</li>
	<li>Prepare the oxygen and isoflurane-based anesthesia system with a nose cone and a heating plate.</li>
</ol>
2. Animal preparation
<ol>
	<li>Weigh the animal.</li>
	<li>Perform anesthesia: Anesthetize mice via intraperitoneal (i.p.) injection of a solution containing midazolam (5 mg/kg), medetomidine (0.5 mg/mL), and fentanyl (0.5 mg/kg) (following institutionally approved protocols).</li>
	<li>Remove hair from the neck and abdomen operation area with an electric shaver for small animals.</li>
	<li>Position the mouse in dorsal recumbency on the heating pad and connect it to the oxygen system via a nose cone. Secure limbs of the mouse&#160;to a heated pad with surgical tape. Ensure that the latex nose cone membrane fits firmly over the head of the mouse. Monitor the animal&#39;s body temperature rectally using a rodent-specific thermometer.</li>
	<li>Apply hair removal cream to remove any remaining hair from the neck surgical area and wipe the skin of the operation area with 70% ethanol.</li>
	<li>Perform a toe pinch test (pedal reflex) to ensure that the animal is fully anesthetized.</li>
</ol>
3. Surgical procedure
<ol>
	<li>Catheter implantation in the jugular vein
	<ol>
		<li>Make a transverse incision (~0.5 cm) over the trachea, remove the skin covering the neck, and isolate the right jugular vein.</li>
		<li>Use a silk thread of about 5 cm, close the distal end of the vein, and fix it with surgical forceps. Place three silk threads about 2 cm below the vein: one close to the distal end and two close to the proximal end of the jugular vein. Tie a surgical knot, but do not close the vessel.</li>
		<li>Prepare a polyethylene catheter (0.28 mm ID, 0.61 mm OD) filled with 0.9% NaCl and plugged with a 1 mL syringe. Use scissors to cut a hole between the second and third knots and implant the catheter into the jugular vein. Aspirate the syringe to ensure that blood is present in the catheter.</li>
		<li>Fix the catheter in the vein by tying the silk thread, ensuring it is securely fastened. Use medical tape to secure the syringe.</li>
		<li>Prepare Acridine orange: dilute 1:4 a 2 mg/mL stock solution with sterile saline (0.5 mg/mL final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 &#181;L in the mouse.</li>
		<li>Prepare nucleic acid dye: dilute 1:1000 a 5 mM stock solution with sterile saline (5 &#181;M final concentration) in a 1 mL syringe. Keep the syringe in the dark and inject 50 &#181;L in the mouse.</li>
		<li>Inject in vivo Acridine orange (50 &#181;g/&#181;L, 50 &#181;L per mouse) via the jugular vein catheter to visualize stained leukocytes and an extracellular DNA fluorescent dye similarly to stain neutrophil extracellular traps (NETs) (5 &#181;M, 50 &#181;L per mouse). NETs and leukocytes are imaged simultaneously.</li>
	</ol>
	</li>
	<li>Mesenteric I/R injury model
	<ol>
		<li>Disinfect the abdominal skin with 70% ethanol.</li>
		<li>Perform a 3-5 cm laparotomy along the linea alba using surgical scissors.</li>
		<li>Using two saline-moistened cotton tips, gently remove the intestine and identify a location with minimal fat coverage. Position small intestinal branches on a black dough to reduce the background signal.</li>
		<li>Acquire the videos before I/R (pre ischemia).</li>
		<li>Make a compress moisture with NaCl and place the intestine in it. Ensure&#160;that the intestine is surrounded by the compress and maintained moisture during step 5.6.</li>
		<li>Occlude the superior mesenteric artery with a small vascular clamp.</li>
		<li>Gently push the intestine back into the abdominal cavity using saline-moistened cotton swabs, and use a 7-0 suture to close the abdominal wall to prevent loss of moisture and temperature. Maintain ischemia for 60 min, checking anesthesia at least every 20 min.</li>
		<li>After 1 h, initiate reperfusion by removing the clamp. 
		NOTE: Proper execution of the ischemia procedure results in a visible change. Initially, the affected area will appear pale or white due to the lack of blood flow. Upon removal of the clamp, blood flow will gradually return to the ischemic region, which will regain its normal color, signifying successful occlusion. It is imperative to closely observe the mouse continuously throughout the ischemia stage.</li>
		<li>Following the ischemic period, apply a few drops of saline to the clipped area, then gently remove the microvascular clips using a clip applier.</li>
		<li>Using saline-moistened cotton tips, gently remove the intestine again, position the small branches of the vein on a black dough, inject 50 &#181;L of Acridine orange again, and capture the videos of the same vein in the same location (post-ischemia).</li>
	</ol>
	</li>
</ol>
4. Intravital high-speed video epifluorescence microscopy
<ol>
	<li>Visualize leukocytes and NETs with a high-speed wide-field fluorescence microscope equipped with a long-distance condenser, a monochromator, a 10x water immersion objective, and a charge-coupled device camera. The image acquisition was performed with a 30 ms exposure time and Alexa Fluor 488(495/519) and Rhodamine Red (570/590) filters.</li>
	<li>Use imaging software for image acquisition and analysis.</li>
	<li>Quantify cell recruitment within a 0.06 mm&#178; region of interest.</li>
	<li>Quantify adherent leukocytes as cells remaining stationary or attached to the endothelial lining for a 20 s observation period.</li>
	<li>Identify NETs as extracellular structures labeled with both leukocyte and extracellular nucleic acid fluorescent dyes.</li>
	<li>Euthanize animals by cervical dislocation at the end of the experiment (following institutionally approved protocols).</li>
</ol>
5. Liver endothelial cell (LEC) isolation and quantitative RT-PCR
<ol>
	<li>Isolate LECs via magnetic cell sorting (MACS)29.</li>
	<li>Isolate total RNA.</li>
	<li>Perform complementary DNA (cDNA) synthesis27 by mixing 2 &#181;g of total RNA with 2 &#181;L of RT Buffer, 0.8 &#181;L of dNTP Mix, 2 &#181;L of RT Random Primers, 1 &#181;L of Reverse Transcriptase, and 4.2 &#181;L sterile distilled H2O.</li>
	<li>cDNA transcription was performed applying the following conditions: 25&#160;&#176;C for 10 min, 37 &#176;C for 120 min, 85 &#176;C for 5 min.</li>
	<li>Use 20 ng of cDNA for qPCR.</li>
	<li>Use the following primers: F2r (forward): TGAACCCCCGCTCATTCTTTC, F2r (reverse): CCAGCAGGACGCTTTCATTTTT, L32 (forward): CCTCTGGTGAAGCCCAAGATC, L32 (reverse): TCTGGGTTTCCGCCAGTTT. Use the following conditions: 95&#160;&#176;C 30 s, 45 cycles of (95 &#176;C for 10 s, 60 &#176;C for 25 s), 60 &#176;C to 95 &#176;C for 6 s with &#916;&#932; 1 &#176;C.</li>
</ol>

Endothelial PAR1 Role in Leukocyte Adhesion and NET Formation During I/R Injury

The authors disclose no conflict of interest.

The mesenteric I/R injury combined with intravital microscopy was applied to a genetic mouse model of F2r (PAR1) deficiency in endothelial cells for the in vivo analysis of leukocytes and NETs after 1 h of ischemia. The mesenteric I/R injury model is frequently used in rodents with both ischemia and reperfusion times varying from minutes to several hours23,31, influencing the inflammatory outcome32 and mortality33. The model also depends on several factors, including microbiota19,34, immune receptors10,35,36,37, sex38,39, and age35. Aside from varying I/R times, another variable in this model is the differential response of different parts of the intestine to injury, with the small intestine showing greater mucosal damage than the colon40. The positioning of the microvascular clip affecting the ischemic region is crucial for the reproducibility of the method32,33. Importantly, superior mesenteric artery occlusion combined with collateral flow interruption yields mortality rates that are consistently related to the duration of ischemia41.
In this study, mice were subjected to 1 h of ischemia, and in vivo leukocyte adhesion and NET formation were visualized immediately after reperfusion to examine the early inflammatory response triggered by the ischemic state in the absence of endothelial F2r expression. Applying these methods to genetic mouse models allows for the investigation of how certain target molecules affect cellular behavior and the inflammatory response both after ischemia and during reperfusion.
There are several critical steps in the protocol, including the maintenance of intestinal integrity. Handling the intestine must be done gently to avoid tissue damage. For this purpose, moist cotton swabs are the appropriate tool for temporarily detaching the intestine from the abdominal cavity. It is crucial that the intestine remains moist until it is repositioned in the abdomen. Minor handling injuries can trigger the activation of various cell types, such as platelets and endothelial cells, which can affect the results.
For consistency, it is crucial to visualize the same site of intestinal segments before and after ischemia. This can be challenging because the intestine is repositioned in the abdominal cavity after ischemia. To address this issue, one approach is to place a small piece of moist compress on the part of the gut that was visualized before ischemia.
To visualize leukocyte rolling and adhesion as well as NET formation in vivo, mice were injected with both a leukocyte and a nucleic acid fluorescence dye via the jugular vein. The leukocyte dye (see Table of Materials) is a cell-permeable metachromatic fluorescence dye that binds to white blood cells but not red blood cells and has been widely used for staining leukocytes in vivo17,42. The dye is applied intravenously and provides strong leukocyte staining within seconds. However, specificity can be a limitation as it also stains other nucleated cells, such as endothelial cells. Nonetheless, circulatory cells retain the staining longer due to a washout effect43. The nucleic acid fluorescence dye (see Table of Materials) is a cell-impermeable nucleic acid stain commonly used to visualize NET formation30,44,45. It can also be applied intravenously, binds with high affinity, and is quick and easy to use. Again, specificity is a drawback as the dye will bind to any cell with a non-intact membrane. Ideally, it should be combined with a neutrophil marker (e.g., CD15, CD11b) or a NETosis marker (e.g., anti-citH3 antibodies) to enhance specificity. These dyes enable in vivo imaging of leukocytes in the mesenteric venules of laboratory animals.
The major limitation of the technique is the presence of visceral fat, which restricts the visualization of intestinal capillaries and greatly hampers image acquisition. To avoid this complication, it is necessary to use young experimental animals (6-8 weeks old) that have reduced visceral fat formation. Additionally, ex vivo histological analysis is hampered by the use of in vivo staining. Another limitation is the impact of the gut microbiota and diet on this model, which may vary strongly between different mouse husbandries46. To address this limitation, the study of gnotobiotic mouse models could be considered10.
In this study, the immediate cellular response was investigated after ischemia, and reduced leukocyte deposition to the activated mesenteric endothelium and NET formation was observed in vivo. NET degradation by intravenous administration of DNase 1 h after ischemia reduces the early proinflammatory response and ameliorates the gut barrier disruption47. Of note, treatment with thrombomodulin, a transmembrane glycoprotein that inhibits thrombin activity48, improved the survival of mice with severe intestinal I/R injury, attenuating the inflammatory response of endothelial dysfunction and reducing the intense histone accumulation in remote organs49. Here, the endothelial thrombin receptor was shown to influence the I/R outcome, highlighting the significance of combining the intestinal I/R injury model with intravital microscopy in genetically engineered mice to investigate important mediators of the disease pathology.

Acute mesenteric ischemia (AMI) is a rare pathology1 with a high mortality risk2, characterized by reduced blood flow in the mesentery due to thrombi in the celiac axis, or the superior or inferior mesenteric artery. In 60%-70% of the cases, acute occlusions of the superior mesenteric artery due to thrombosis or embolization are responsible for acute bowel ischemia3. In contrast, in 5-15% of cases, mesenteric venous thrombosis accounts for mesenteric ischemia involving the superior mesenteric vein and, more rarely, the inferior mesenteric vein4. The hypoxia and malnutrition arising from ischemia lead to energy metabolism disorders at the cellular level5. For instance, impaired mitochondrial function activates multiple signaling pathways, initiating cellular death mechanisms6. Although rapid reperfusion enables the restoration of aerobic metabolism, the restoration of blood flow to an ischemic region often causes extensive tissue injury due to reactive oxygen species (ROS) production7, calcium overload8, endothelial dysfunction9, and inflammatory responses10.
Many experimental animal models employing temporary vascular occlusion of the superior mesenteric artery have been established to elucidate the molecular mechanisms during ischemia-reperfusion (I/R) injury11. The use of such models in combination with intravital microscopy (IVM) is fundamental for gaining insights into the underlying cellular interactions and disease progression11. Gut barrier dysfunction is observed shortly after ischemia12, with the epithelium losing its integrity13, resulting in bacterial translocation to extraintestinal sites such as the mesenteric lymph nodes, spleen, liver, and kidney12,14. Reperfusion further aggravates the mucosal injury15. An inflammatory response in the arterioles is manifested by the rolling and firm adhesion of leukocytes on the endothelial cell layer, which is dependent on molecules such as L-selectin16, P-selectin (CD62P)17, platelet GPIIb/IIIa, and fibrinogen18. Interestingly, leukocyte adhesion to mesenteric venules is influenced by the presence of gut microbiota19 and Toll-like receptor 4 signaling10. I/R injury also triggers neutrophil extracellular trap (NET) formation10. Therapeutic targeting of the extracellular DNA, originating from activated leukocytes such as neutrophils, improves the outcome of intestinal I/R injury20. In the liver, I/R injury is ignited by resident microphages21, and microRNA inhibition notably attenuates apoptosis22. Of note, I/R injury in the mesentery results in gut dysbiosis, which is reversible and resolved after revascularization23.
The endothelium is also influenced by the damaging effects of I/R injury, with ROS playing a pivotal role in the process24. Leukocyte adhesion to the endothelial cell layer, endothelial damage, and alterations of nitric oxide (NO) metabolism are observed9. However, the molecular pathways involved have not yet been fully explored.
Protease-activated receptor 1 (PAR1, F2r), is a membrane receptor expressed by a variety of cells, including endothelial cells, and is activated during inflammatory conditions25. Its activation occurs when serine proteases cleave the receptor at the N-terminus, exposing the tethered ligand that, in turn, activates the receptor by binding to the second extracellular loop of the molecule26. The endothelial protein C receptor (EPCR)-PAR1 signaling pathway impacts endothelial NO homeostasis and facilitates the restoration of blood flow in peripheral ischemia27.
In this study, I/R injury was applied to a genetic mouse model characterized by endothelial cell-specific PAR1 deficiency to visualize leukocyte rolling, adhesion, and NET formation. The combination of a genetic mouse model and intravital microscopy after I/R microsurgery provides valuable insights by highlighting the specific cell types involved in the disease progression. Applying I/R injury to genetic mouse models is instrumental in identifying potential therapeutic targets that can be used to improve the course of the disease. Moreover, the significance of endothelial PAR1 in NETosis was shown.

<table><tbody><tr><td>Acridine orange</td><td>Sigma-Aldrich&amp;nbsp;</td><td>&amp;nbsp;A-6014</td><td></td></tr><tr><td>96-well plate Multiply PCR-Platten&amp;nbsp;</td><td>Sarstedt</td><td>721977202.00</td><td></td></tr><tr><td>Anaesthesia Systems for Rodents</td><td>GROPPLER medizintechnik</td><td>Uni Vet -Porta T-8</td><td></td></tr><tr><td>Aqua ad injectabilia IVM</td><td>B Braun Melsungen</td><td>53402101</td><td></td></tr><tr><td>black dough</td><td>Staedtler</td><td></td><td>modelling clay</td></tr><tr><td>CD146 Microbeads, mouse</td><td>Miltenyi Biotec</td><td>130-092-007</td><td></td></tr><tr><td>cellSens</td><td>Olympus</td><td>Olympus cellSense Dimension Desktop 2.3</td><td>software</td></tr><tr><td>charge-coupled device camera</td><td>Hamamatsu Photonics</td><td>ORCA-R2</td><td>camera</td></tr><tr><td>cotton swabs</td><td>B&amp;ouml;ttger</td><td>09-119-9100</td><td></td></tr><tr><td>Curved Hemostat 125mm/5&quot;</td><td>Indigo Instruments&amp;nbsp;</td><td>22466</td><td></td></tr><tr><td>Depilatory cream</td><td>Balea</td><td>not applicable</td><td></td></tr><tr><td>Dorbene Vet</td><td>zoetis</td><td></td><td></td></tr><tr><td>Dumont Forceps</td><td>Fine Science Tools</td><td>11251-35</td><td></td></tr><tr><td>Ethanol p.a. 99,5 %</td><td>Roth</td><td>5504.20</td><td></td></tr><tr><td>Extra Narrow Scissors &amp;ndash; Straight/Sharp-Sharp/10.5</td><td>FST</td><td>14088-10</td><td></td></tr><tr><td>Fentanyl</td><td>Janssen-Cilag GmBH</td><td></td><td></td></tr><tr><td>Forceps &quot;Dumont #5&quot; (Inox, tip 0.1mm, length 11 cm)</td><td>FST</td><td>11251-20</td><td></td></tr><tr><td>GentleMACS C Tubes</td><td>Miltenyi Biotec</td><td>130-093-236</td><td></td></tr><tr><td>Graphpadprism</td><td>Graphpad</td><td>Prism 10</td><td>software</td></tr><tr><td>isoflurane&amp;nbsp;</td><td>Piramal</td><td>4150097146757.00</td><td></td></tr><tr><td>iTaq UniversalSYBR Green Supermix 10x5ml</td><td>BioRad</td><td>1725125.00</td><td></td></tr><tr><td>Leukofix medical tape</td><td>BSNMedical</td><td>0213600</td><td></td></tr><tr><td>Liver Dissociation Kit, mouse</td><td>Miltenyi Biotec</td><td>130-105-807</td><td></td></tr><tr><td>LS-Separation columns MACS</td><td>Miltenyi Biotec</td><td>130-042-401</td><td></td></tr><tr><td>MACS Smart Strainer 100 &amp;micro;m</td><td>Miltenyi Biotec</td><td>130-098-463</td><td></td></tr><tr><td>Microseal B Seal Seals</td><td>Biorad</td><td>MSB1001</td><td></td></tr><tr><td>Midazolam</td><td>hameln</td><td>5918501.00</td><td></td></tr><tr><td>NaCl</td><td>Braun</td><td>2350748</td><td></td></tr><tr><td>Needle holder</td><td>FST</td><td>12001-13</td><td></td></tr><tr><td>Nonabsorbable Braided Silk Suture, Size: 7/0, 91 Meters&amp;nbsp;</td><td>Fine Science Tools</td><td>18020-70</td><td></td></tr><tr><td>Olympus BX51WI fluorescence microscope</td><td>Olympus</td><td></td><td>microscope</td></tr><tr><td>PCR for Tube Strips</td><td>Sarstedt</td><td>72985002.00</td><td></td></tr><tr><td>PCR Tube Lids</td><td>Sarstedt</td><td>65989002.00</td><td></td></tr><tr><td>Plyethylene Catheter</td><td>Smith Medical Deutschland GmbH</td><td>800/100/100</td><td></td></tr><tr><td>Prolene (8648G), Polypropylen 6-0, Nahtmaterial&amp;nbsp;</td><td>Johnson &amp;amp; Johnson Medical GmbH&amp;nbsp;</td><td>8695H</td><td></td></tr><tr><td>Relia Prep RNA Miniprep Systems</td><td>Promega</td><td>Z6112</td><td></td></tr><tr><td>Reverse Tanscription Kit (High Capacity cDNA)</td><td>Applied Biosystems</td><td>4368813.00</td><td></td></tr><tr><td>School scale&amp;nbsp;</td><td>KERN &amp;amp; SOHN GmbH</td><td>EMB 500-1</td><td></td></tr><tr><td>Spring Scissors - Angled to Side</td><td>FST</td><td>15006-09</td><td></td></tr><tr><td>Stereo microscope</td><td>Leica</td><td>M50</td><td></td></tr><tr><td>Straight Hemostats 135mm/5.5&quot;</td><td>Indigo Instruments&amp;nbsp;</td><td>22468</td><td></td></tr><tr><td>Syringe 1 mL</td><td>Braun</td><td>9166017V</td><td></td></tr><tr><td>SYTOX Orange</td><td>Thermo Fisher Scientific</td><td>S11368</td><td></td></tr><tr><td>Temperature Controller TC-1000</td><td>FMI F&amp;ouml;hr Medical Instruments GmbH</td><td>not applicable</td><td></td></tr><tr><td>Tissue Forceps - 1x2 Teeth</td><td>FST</td><td>18057-14</td><td></td></tr><tr><td>vascular clamp</td><td>Fine Science Tools</td><td>18055-02</td><td></td></tr><tr><td>Vetiva mini</td><td>WAHL</td><td>1584-0480</td><td></td></tr></tbody></table>

visualization of neutrophil extracellular traps in mesenteric venules after mesenteric ischemia-reperfusion injury via intravital microscopy

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric vessels, leading to both local and systemic pathologies with a poor prognosis. Both ischemia and reperfusion trigger a series of cellular and molecular responses, with inflammatory cells serving as key regulators of the pathology. These interactions with the ischemic endothelium are mediated by multiple adhesion receptors. Several animal models have been established to mimic this pathology and investigate the involved molecular pathways. In this study, a microsurgical model of I/R injury is combined with intravital microscopy to visualize leukocyte rolling, adhesion, and neutrophil extracellular trap (NET) formation. This model is applied to transgenic mice deficient in endothelial PAR1 (F2r) to assess the impact of PAR1 on leukocyte rolling and NET formation 1 h after ischemia and immediately following reperfusion. In vivo, Acridine Orange leukocyte staining was employed, and NETs were visualized using a nucleic acid stain. Interestingly, reduced leukocyte adhesion and NET formation were observed in mice lacking the endothelial PAR1 receptor. This model enables the in vivo analysis of key regulators involved in I/R injury.

To study the endothelial cell-dependent effects on leukocyte rolling and adhesion as well as on NET formation, initially, the efficacy of the VE-Cadherin Cre inducible F2r-deficiency was examined in endothelial cells. Magnetic cell sorting was employed to isolate hepatic endothelial cells. Subsequently, RNA was isolated, followed by quantitative real-time PCR (qRT-PCR). The F2r&#916;EC mice, in which the Cre recombinase expressed under the control of the VE-Cadherin promoter is absent, showed significantly reduced F2r (PAR1) mRNA levels (approx. by one-third) compared to WT controls (Figure 1).
After confirming the deficiency in the mouse line, mesenteric I/R injury was performed to examine the impact of PAR1 expressed by vascular endothelial cells on leukocyte rolling and adhesion, visualized by intravital microscopy (Figure 2A,B). After 1 h of ischemia, the clamp was removed, and the vessel was allowed to reperfuse. Leukocyte rolling and adhesion were observed and recorded (stained green, indicated by white arrows). Although both groups showed increased numbers of adherent leukocytes after I/R injury, the deficiency of endothelial F2r (PAR1) resulted in a markedly but not significantly decreased leukocyte adhesion to the I/R-activated mesenteric endothelium, suggesting an active role of endothelial PAR1 activation in leukocyte recruitment to the ischemic mesenteric venules (Figure 2C).
The next objective was to examine whether endothelial PAR1 expression regulates I/R injury-induced NET formation. Therefore, extracellular nucleic acids were stained with a cell-impermeable dye30, and visualized the generated NETs using intravital microscopy (indicated by black arrows) (Figure 2A,B). After I/R injury, NETs were observed only in the WT group expressing normal levels of PAR1 on the endothelial cells, indicating a regulatory role of PAR1 in NETosis (Figure 2C,D). Notably, when endothelial F2r expression was suppressed, no NETs were present in the I/R-injured mesenteric venules.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/67264/67264fig01.jpg" /> 
Figure 1: F2r (PAR1) mRNA expression. F2r liver endothelial cell expression of WT (n = 6) and F2r&#916;EC (n = 9) mice relative to the L32 housekeeping gene. Data are presented as a median with a 95% confidence interval. The Mann-Whitney test was used to compare two independent groups, *p &#60; 0.05. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67264/67264fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/67264/67264fig02.jpg" /> 
Figure 2: Endothelial PAR1 affects leukocyte adhesion and NET formation in I/R-injured mesenteric venules. Representative intravital microscopy images of adhering leukocytes stained with Acridine orange (white arrows) and NETs stained with Sytox Orange (black arrows) of WT and F2r&#916;EC&#160;mice before (pre) and after (post) I/R injury (A) 10x and (B)&#160;20x magnification. Scale bars: A, 50 &#181;m; B, 20 &#181;m. (C)&#160;Leukocyte adhesion and (D) NETs per mm2 of WT (n = 7) and F2r&#916;EC&#160;(n = 4) mice before (pre) and after (post) I/R injury. All data were represented as median with a 95% confidence interval. Statistical comparisons were performed using the Two-way ANOVA test, **p&#60; 0.01, and S&#237;d&#225;k&#39;s multiple comparison tests to compare the means of different genotypes in every time point (pre and post-ischemia). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67264/67264fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

This protocol presents a method for inducing mesenteric ischemia-reperfusion injury and visualizing neutrophil extracellular traps (NETs) in mesenteric venules using intravital microscopy. Blood flow in the superior mesenteric artery was restricted for 1 h, followed by reperfusion, allowing direct quantification of leukocyte adhesion and NETosis.

Intestinal ischemia-reperfusion (I/R) injury is an acute condition characterized by tissue damage resulting from restricted blood flow to the mesenteric ...

visualization-neutrophil-extracellular-traps-mesenteric-venules-after

Nanyang Technological University

Research

JoVE Journal

Medicine

392 Views.  University Medical Center Mainz, Johannes Gutenberg-University Mainz. De rol van bepaalde genen op het ontstaan en de ontwikkeling van trombose, in dit geval onderzoeken we de endotheliale PAR1-expressie op ischemie-reperfusieschade. We proberen het effect van het endotheel op de respons vast te stellen, zowel na ischemie als tijdens reperfusie. Een heel belangrijk aspect dat tot nu toe onderbelicht is, is het vaststellen van de rol van darmcommensalen bij mesenteriale ischemie-reperfusieschade.Om deze vraag te bestudere...

Video: Visualisatie van extracellulaire neutrofiele vallen in mesenteriale venulen na mesenteriale ischemie-reperfusieschade via intravitale microscopie

Neutrophil Extracellular Traps: How to Generate and Visualize Them

Neutrophil granulocytes are the most abundant group of leukocytes in the peripheral blood. As professional phagocytes, they engulf bacteria and kill them intracellularly when their antimicrobial granules fuse with the phagosome. We found that neutrophils have an additional way of killing microorganisms: upon activation, they release granule proteins and chromatin that together form extracellular fibers that bind pathogens. These novel structures, or Neutrophil Extracellular Traps (NETs), degrade virulence factors and kill bacteria1, fungi2 and parasites3. The structural backbone of NETs is DNA, and they are quickly degraded in the presence of DNases. Thus, bacteria expressing DNases are more virulent4. Using correlative microscopy combining TEM, SEM, immunofluorescence and live cell imaging techniques, we could show that upon stimulation, the nuclei of neutrophils lose their shape and the eu- and heterochromatin homogenize. Later, the nuclear envelope and the granule membranes disintegrate allowing the mixing of NET components. Finally, the NETs are released as the cell membrane breaks. This cell death program (NETosis) is distinct from apoptosis and necrosis and depends on the generation of Reactive Oxygen Species by NADPH oxidase5. 
Neutrophil extracellular traps are abundant at sites of acute inflammation. NETs appear to be a form of innate immune response that bind microorganisms, prevent them from spreading, and ensure a high local concentration of antimicrobial agents to degrade virulence factors and kill pathogens thus allowing neutrophils to fulfill their antimicrobial function even beyond their life span. There is increasing evidence, however, that NETs are also involved in diseases that range from auto-immune syndromes to infertility6.
We describe methods to isolate Neutrophil Granulocytes from peripheral human blood7 and stimulate them to form NETs. Also we include protocols to visualize the NETs in light and electron microscopy.

Neutrophil Extracellular Traps (NETs) are an important innate immune mechanism to fight pathogenic bacteria, fungi and parasites. Here we describe methods to isolate neutrophil granulocytes from human blood and to activate them to form NETs. We present preparation techniques to visualize NETs in light and electron microscopy.

Neutrophil granulocytes are the most abundant group of leukocytes in the peripheral blood. As professional phagocytes, they engulf bacteria and kill them ...

Immunology and Infection

Tracking Neutrophil Intraluminal Crawling, Transendothelial Migration and Chemotaxis in Tissue by Intravital Video Microscopy

The recruitment of circulating leukocytes from blood stream to the inflamed tissue is a crucial and complex process of inflammation1,2. In the postcapillary venules of inflamed tissue, leukocytes initially tether and roll on the luminal surface of venular wall. Rolling leukocytes arrest on endothelium and undergo firm adhesion in response to chemokine or other chemoattractants on the venular surface. Many adherent leukocytes relocate from the initial site of adhesion to the junctional extravasation site in endothelium, a process termed intraluminal crawling3. Following crawling, leukocytes move across endothelium (transmigration) and migrate in extravascular tissue toward the source of chemoattractant (chemotaxis)4. Intravital microscopy is a powerful tool for visualizing leukocyte-endothelial cell interactions in vivo and revealing cellular and molecular mechanisms of leukocyte recruitment2,5. In this report, we provide a comprehensive description of using brightfield intravital microscopy to visualize and determine the detailed processes of neutrophil recruitment in mouse cremaster muscle in response to the gradient of a neutrophil chemoattractant. To induce neutrophil recruitment, a small piece of agarose gel (~1-mm3 size) containing neutrophil chemoattractant MIP-2 (CXCL2, a CXC chemokine) or WKYMVm (Trp-Lys-Tyr-Val-D-Met, a synthetic analog of bacterial peptide) is placed on the muscle tissue adjacent to the observed postcapillary venule. With time-lapsed video photography and computer software ImageJ, neutrophil intraluminal crawling on endothelium, neutrophil transendothelial migration and the migration and chemotaxis in tissue are visualized and tracked. This protocol allows reliable and quantitative analysis of many neutrophil recruitment parameters such as intraluminal crawling velocity, transmigration time, detachment time, migration velocity, chemotaxis velocity and chemotaxis index in tissue. We demonstrate that using this protocol, these neutrophil recruitment parameters can be stably determined and the single cell locomotion conveniently tracked in vivo.

We describe a protocol of brightfield intravital microscopy for measuring dynamic neutrophil-endothelial cell interactions during neutrophil recruitment in response to the source of a neutrophil chemoattractant in vivo. Neutrophil intraluminal crawling, transendothelial migration and chemotaxis in mouse cremaster muscle tissue are visualized with time-lapsed video photography and tracked with ImageJ.

The recruitment of circulating leukocytes from blood stream to the inflamed tissue is a crucial and complex process of inflammation1,2. In the ...

An Ex Vivo Method for Time-Lapse Imaging of Cultured Rat Mesenteric Microvascular Networks

Angiogenesis, defined as the growth of new blood vessels from pre-existing vessels, involves endothelial cells, pericytes, smooth muscle cells, immune cells, and the coordination with lymphatic vessels and nerves. The multi-cell, multi-system interactions necessitate the investigation of angiogenesis in a physiologically relevant environment. Thus, while the use of in vitro cell-culture models have provided mechanistic insights, a common critique is that they do not recapitulate the complexity associated with a microvascular network. The objective of this protocol is to demonstrate the ability to make time-lapse comparisons of intact microvascular networks before and after angiogenesis stimulation in cultured rat mesentery tissues. Cultured tissues contain microvascular networks that maintain their hierarchy. Immunohistochemical labeling confirms the presence of endothelial cells, smooth muscle cells, pericytes, blood vessels and lymphatic vessels. In addition, labeling tissues with BSI-lectin enables time-lapse comparison of local network regions before and after serum or growth factor stimulation characterized by increased capillary sprouting and vessel density. In comparison to common cell culture models, this method provides a tool for endothelial cell lineage studies and tissue specific angiogenic drug evaluation in physiologically relevant microvascular networks.

An Ex Vivo Method for Time-Lapse Imaging of Cultured Rat Mesenteric Microvascular Networks

Angiogenesis involves multi-cell, multi-system interactions that need to be investigated in a physiologically relevant environment. The objective of this study is to demonstrate the ability of the rat mesentery culture model to make time-lapse comparisons of intact microvascular networks during angiogenesis.

Angiogenesis, defined as the growth of new blood vessels from pre-existing vessels, involves endothelial cells, pericytes, smooth muscle cells, immune ...

Developmental Biology

Intravital Microscopy of Leukocyte-endothelial and Platelet-leukocyte Interactions in Mesenterial Veins in Mice

Intravital microscopy is a method that can be used to investigate different processes in different regions and vessels in living animals. In this protocol, we describe intravital microscopy of mesentery veins. This can be performed in a short period of time with reproducible results showing leukocyte-endothelial interactions in vivo. We describe an inflammatory setting after LPS challenge of the endothelium. But in this model one can apply many different types of inflammatory conditions, like bacterial, chemical or biological and investigate the administration of drugs and their direct effects on the living animal and its impact on leukocyte recruitment. This protocol has been applied successfully to a number of different treatments of mice and their effects on inflammatory response in vessels. Herein, we describe the visualization of leukocytes and platelets by fluorescently labeling these with rhodamine 6G. Additionally, any specific imaging can be performed using targeted fluorescently labeled molecules.

This simplified application of intravital microscopy of mesentery veins in mice can be used in different models of inflammation to observe leukocyte-endothelial and platelet-leukocyte interactions.

Intravital microscopy is a method that can be used to investigate different processes in different regions and vessels in living animals. In this ...

Imaging Neutrophils and Monocytes in Mesenteric Veins by Intravital Microscopy on Anaesthetized Mice in Real Time

Efficient immune response is dependent on rapid mobilization of blood leukocytes to the site of infection or injury. Investigating leukocyte migration in vivo is crucial for understanding the molecular basis of leukocyte transendothelial migration and interaction with vascular endothelium. One powerful approach involves intravital microscopy on transgenic mice expressing fluorescent proteins in cells of interest.
Here we present a protocol for imaging monocytes and neutrophils in the CX3CR1gfp/wt mouse i.v. injected with orange dye-labeled neutrophils with an inverted confocal microscope. Time-lapse movies gathered from 30 min&#160;to several hours of imaging allow the analysis of leukocyte behavior in mesenteric veins under both steady state and inflammatory conditions. We also describe the steps to locally induce blood vessel inflammation with TLR2/TLR1 agonist Pam3SK4 and monitor the subsequent recruitment of neutrophils and monocytes.
The presented technique can also be used to monitor other populations of leukocytes and investigate molecules implicated in leukocyte recruitment or trafficking using other stimuli or transgenic mice.

We detail a protocol to monitor the behavior of neutrophils and monocytes in mesenteric veins under steady state and inflammatory conditions using intravital confocal microscopy on anaesthetized mice.

Efficient immune response is dependent on rapid mobilization of blood leukocytes to the site of infection or injury. Investigating leukocyte migration in ...

Intravital Microscopy of Monocyte Homing and Tumor-Related Angiogenesis in a Murine Model of Peripheral Arterial Disease

The therapeutic goal for peripheral arterial disease and ischemic heart disease is to increase blood flow to ischemic areas caused by hemodynamic stenosis. Vascular surgery is a viable option in selected cases, but for patients without indications for surgery such as progression to rest pain, critical limb ischemia, or major disruptions to life or work, there are few possibilities for mitigating their disease. Cell therapy via monocyte-enhanced perfusion through the stimulation of collateral formation is one of a few non-invasive options.
Our group examines arteriogenesis after monocyte transplantation into mice using the hindlimb ischemia model. Previously, we have demonstrated improvement in hindlimb perfusion using tetanus-stimulated syngeneic monocyte transplantation. In addition to the effects on the collateral formation, tumor growth could be affected by this therapy as well. To investigate these effects, we use a basement membrane-like matrix mouse model by injecting the extracellular matrix of the Engelbreth-Holm-Swarm sarcoma into the flank of the mouse, after occlusion of the femoral artery.
After the artificial tumor studies, we use intravital microscopy to study in vivo tumor-angiogenesis and monocyte homing within collateral arteries. Previous studies have described the histological examination of animal models, which presupposes subsequent analysis to post-mortem artifacts. Our approach visualizes monocyte homing to areas of collateralization in real time sequences, is easy to perform, and investigates the process of arteriogenesis and tumor angiogenesis in vivo.

Monocytes are important mediators of arteriogenesis in the context of peripheral arterial disease. Using a basement membrane-like matrix and intravital microscopy, this protocol investigates monocyte homing and tumor-related angiogenesis after monocyte injection in the femoral artery ligation murine model.

The therapeutic goal for peripheral arterial disease and ischemic heart disease is to increase blood flow to ischemic areas caused by hemodynamic ...

Identification of Neutrophil Extracellular Traps in Paraffin-Embedded Feline Arterial Thrombi using Immunofluorescence Microscopy

Neutrophil extracellular traps (NETs), composed of cell-free DNA (cfDNA) and proteins like histones and neutrophil elastase (NE), are released by neutrophils in response to systemic inflammation or pathogens. Although NETs have previously been shown to augment clot formation and inhibit fibrinolysis in humans and dogs, the role of NETs in cats with cardiogenic arterial thromboembolism (CATE), a life-threatening complication secondary to hypertrophic cardiomyopathy, is unknown. A standardized method to identify and quantify NETs in cardiogenic arterial thrombi in cats will advance our understanding of their pathological role in CATE. Here, we describe a technique to identify NETs in formaldehyde-fixed and paraffin-embedded thrombi within the aortic bifurcation, extracted during necropsy. Following deparaffinization with xylene, aortic sections underwent indirect heat-induced antigen retrieval. Sections were then blocked, permeabilized, and ex vivo NETs were identified by colocalization of cell-free DNA (cfDNA), citrullinated histone H3 (citH3), and neutrophil elastase (NE) using immunofluorescence microscopy. To optimize the immunodetection of NETs in thrombi, autofluorescence of tissue elements was limited by using an autofluorescence quenching process prior to microscopy. This technique could be a useful tool to study NETs and thrombosis in other species and offers new insights into the pathophysiology of this complex condition.

We describe a method to identify neutrophil extracellular traps (NETs) in formaldehyde-fixed and paraffin-embedded feline cardiogenic arterial thrombi using heat-induced antigen retrieval and a double immunolabeling protocol.

Neutrophil extracellular traps (NETs), composed of cell-free DNA (cfDNA) and proteins like histones and neutrophil elastase (NE), are released by ...

Immunofluorescence Labelling of Human and Murine Neutrophil Extracellular Traps in Paraffin-Embedded Tissue

Neutrophil granulocytes, also called polymorphonuclear leukocytes (PMN) due to their lobulated nucleus, are the most abundant type of leukocytes. They mature in the bone marrow and are released into the peripheral blood, where they circulate for about 6&#8722;8 h; however, in tissue, they can survive for days. By diapedesis through the endothelium, they leave the blood stream, enter tissues, and migrate towards the site of an infection following chemotactic gradients.&#160;Neutrophils can combat invading microorganisms by phagocytosis,&#160;degranulation, and generation of neutrophil extracellular traps (NETs). This protocol will help to detect NETs in paraffin-embedded tissue. NETs are the result of a process called NETosis, which leads to the release of nuclear, granular, and cytoplasmic components either from living (vital NETosis) or dying (suicidal NETosis) neutrophils. In vitro, NETs form cloud-like structures, which occupy a space several times larger than that of the cells from which they descended. The backbone of NETs is chromatin, to which a selection of proteins and peptides originating from granules and cytoplasm are bound. Thereby, a high local concentration of toxic compounds is maintained so that NETs can capture and inactivate a variety of pathogens including bacteria, fungi, viruses, and parasites, while diffusion of the highly active NET components leading to damage in neighboring tissue is limited. Nevertheless, in recent years it has become apparent that NETs, if generated in abundance or cleared insufficiently, do have pathological potential ranging from autoimmune diseases to cancer. Thus, detection of NETs in tissue samples may have diagnostic significance, and the detection of NETs in diseased tissue can influence the treatment of patients. Since paraffin-embedded tissue samples are the standard specimen used for pathological analysis, it was sought to establish a protocol for fluorescent staining of NET components in paraffin-embedded tissue using commercially available antibodies.

Neutrophil extracellular traps (NETs) are three-dimensional structures generated by stimulated neutrophil granulocytes. It has become clear in recent years that NETs are involved in a wide variety of diseases. Detection of NETs in tissue may have diagnostic relevance, so standardized protocols for labelling NET components are required.

Neutrophil granulocytes, also called polymorphonuclear leukocytes (PMN) due to their lobulated nucleus, are the most abundant type of leukocytes. They ...

Staining and Imaging to Visualize Neutrophil Extracellular Traps

Immunofluorescence Imaging of Neutrophil Extracellular Traps in Human and Mouse Tissues

Neutrophil extracellular traps (NETs) are released by neutrophils as a response to bacterial infection or traumatic tissue damage but also play a role in autoimmune diseases and sterile inflammation. They are web-like structures composed of double-stranded DNA filaments, histones, and antimicrobial proteins. Once released, NETs can trap and kill extracellular pathogens in blood and tissue. Furthermore, NETs participate in homeostatic regulation by stimulating platelet adhesion and coagulation. However, the dysregulated production of NETs has also been associated with various diseases, including sepsis or autoimmune disorders, which makes them a promising target for therapeutic intervention. Apart from electron microscopy, visualizing NETs using immunofluorescence imaging is currently one of the only known methods to demonstrate NET interactions in tissue. Therefore, various staining methods to visualize NETs have been utilized. In the literature, different staining protocols are described, and we identified four key components showing high variability between protocols: (1) the types of antibodies used, (2) the usage of autofluorescence-reducing agents, (3) antigen retrieval methods, and (4) permeabilization. Therefore, in vitro immunofluorescence staining protocols were systemically adapted and improved in this work to make them applicable for different species (mouse, human) and tissues (skin, intestine, lung, liver, heart, spinal disc). After fixation and paraffin-embedding, 3 &#181;m thick sections were mounted onto slides. These samples were stained with primary antibodies for myeloperoxidase (MPO), citrullinated histone H3 (H3cit), and neutrophil elastase (NE) according to a modified staining protocol. The slides were stained with secondary antibodies and examined using a widefield fluorescence microscope. The results were analyzed according to an evaluation sheet, and differences were recorded semi-quantitatively.
Here, we present an optimized NET staining protocol suitable for different tissues. We used a novel primary antibody to stain for H3cit and reduced non-specific staining with an autofluorescence-reducing agent. Furthermore, we demonstrated that NET staining requires a constant high temperature and careful handling of samples.

Author Spotlight: Neutrophil Extracellular Traps Imaging in Human and Mouse Tissues 

Neutrophil extracellular traps (NETs) are associated with various diseases, and immunofluorescence is often used for their visualization. However, there are various staining protocols, and, in many cases, only one type of tissue is examined. Here, we establish a generally applicable protocol for staining NETs in mouse and human tissue.

Neutrophil extracellular traps (NETs) are released by neutrophils as a response to bacterial infection or traumatic tissue damage but also play a role in ...

Quantifying NET Formation Using Dual-Dye Live Cell Analysis

Real-Time High Throughput Technique to Quantify Neutrophil Extracellular Traps Formation in Human Neutrophils

Neutrophils are myeloid-lineage cells that form a crucial part of the innate immune system. The past decade has revealed additional key roles that neutrophils play in the pathogenesis of cancer, autoimmune diseases, and various acute and chronic inflammatory conditions by contributing to the initiation and perpetuation of immune dysregulation through multiple mechanisms, including the formation of neutrophil extracellular traps (NETs), which are structures crucial in antimicrobial defense. Limitations in techniques to quantify NET formation in an unbiased, reproducible, and efficient way have restricted our ability to further understand the role of neutrophils in health and diseases. We describe an automated, real-time, high-throughput method to quantify neutrophils undergoing NET formation using a live cell imaging platform coupled with a membrane permeability-dependent dual-dye approach using two different DNA dyes to image intracellular and extracellular DNA. This methodology is able to help assess neutrophil physiology and test molecules that can target NET formation.

Author Spotlight: Quantifying Neutrophil Extracellular Traps in Disease and Drug Screening Using Dual-Color Live-Cell Imaging

We present an automated high-throughput method to quantify neutrophil extracellular traps (NETs) utilizing the live cell analysis system, coupled with a membrane permeability-dependent dual-dye approach.

Visualization of Neutrophil Extracellular Traps in Mesenteric Venules After Mesenteric Ischemia-Reperfusion Injury via Intravital Microscopy

Samenvatting

Meer video's verkennen