Name: application of dna barcoding to identify medicinal plants
Uploaded: 2024-11-01T13:20:00.000+00:00
Duration: 8 min 55 s
Description: Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration ...

This work was supported by introduces the talented person scientific research start funds subsidization project of Chengdu University of Traditional Chinese Medicine (030040015).

1. Sample preparation
<ol>
	<li>The present study utilized two-year-old A. sinensis with low temperature and long sunshine at an altitude of 2800 m from Min County, Gansu Province, as experimental materials.Three plants were selected from which more than three roots were selected for experimentation. Rinse the roots first with sterilized water and then clean them with an alcohol sprayer or alcohol swabs to prevent contamination that could affect the accuracy of the experimental results. Cut the roots into pieces smaller than 5 mm using a sterilized scalpel and mix for further analysis. (Figure 2). 
	NOTE: Alternatively, place the roots in liquid nitrogen to crisp up, making them easier to break. Depending on the shape, hardness, and other characteristics of the medicinal plants, use instruments to deal with them.</li>
	<li>Prepare three tubes of experimental samples for parallel experiments. Label each sample as AS-1, AS-2, and AS-3. Take about 100 mg fresh or 20 mg dry-weight tissue (air-dried) and place it in a 2 mL centrifuge tube.</li>
	<li>Place two 5 mm stainless steel beads into the 2 mL centrifuge tubes. Transfer the tubes to a high-throughput tissue grinder operating at 60 Hz for 60 s.</li>
</ol>
2 DNA extraction from sample
NOTE: This study uses a Plant Genomic DNA Extraction Kit, which is based on the CTAB method. DNA extraction is performed following the instruction manual with some modifications, including the addition of a unique Nuclear Isolation Buffer (NIB). The protocol improves DNA purity by first separating the contaminants from the tissue and then adding an initial nuclei isolation step28,29,30.
<ol>
	<li>Add 800 &#181;L of pre-cooled NIB and place the sample on a vortex mixer, vibrating for 5 min.</li>
	<li>Place in a centrifuge and process at 13,780 x g for 10 min. Remove the supernatant.</li>
	<li>Repeat steps 2.1-2.2 for an additional 3 rounds. 
	NOTE: NIB extracts higher-quality DNA, and its preparation contains some hazardous chemicals that must be handled in a fume hood, making it more difficult for novices to handle. However, this step is not mandatory. Users may opt to follow this recommendation or skip these steps. Its detailed formulation is in Table 1.</li>
	<li>Add 600 &#181;L of Buffer P1 and 5 &#181;L of RNase A (10 mg/mL). Place the sample on a vortex mixer and vortex to mix. Incubate the samples in a water bath at 65 &#176;C for 1.5 h, inverting the tubes 2x-3x during incubation.</li>
	<li>Add 200 &#181;L of Buffer P2, mix thoroughly, place on ice for 15 min, and then centrifuge at 13,780 x g for 10 min.</li>
	<li>Carefully aspirate the supernatant onto a filter column AF, centrifuge at 13,780 x g for 2 min, and transfer the lower filtrate collected in the collection tube to a new 1.5 mL centrifuge tube.</li>
	<li>Calculate the volume of filtrate, add 1.5x the volume of P3, and shake immediately to get a mixed solution.</li>
	<li>Add 650 &#181;L of the prepared mixture to an adsorbent column adsorption column (AC) and incubate for 5 min, then centrifuge at 13,780 x g for 30-60 s.</li>
	<li>Add the filtrate obtained from step 2.8 to the AC again, centrifuge, and discard the waste liquid. Repeat the procedure with the remaining mixed solution from step 2.7.</li>
	<li>Add 600 &#181;L of rinse solution WB, centrifuge at 13,780 x g for 30 s, discard the waste solution, and repeat the procedure 1x.</li>
	<li>Place the column AC back into the empty collection tube, centrifuge at 13,780 x g for 2 min, and leave at room temperature to remove residual ethanol.</li>
	<li>Take the adsorbent column AC and place it in a clean 1.5 mL centrifuge tube. Add 45 &#181;L of sterilized deionized water (ddH2O) to the middle of the adsorbent membrane, which has been heated to 65 &#176;C. Leave at room temperature for 5 min. Centrifuge at 13,780 x g for 2 min.</li>
	<li>Add the resulting solution back to the column and centrifuge at 13,780 x g for 2 min at room temperature.</li>
	<li>Collect the filtered solution. Use a spectrophotometer to determine DNA concentration; OD260 represents the absorbance of nucleic acids. Use the following criteria for DNA quality determination standard: OD260/OD280=1.80-2.00, the normal range; OD260/OD280&#62;2.00; there is a large amount of RNA contamination; OD260/OD280&#60;1.80, there are proteins, phenols, and other contaminants.</li>
</ol>
3 Target fragment amplification and detection
NOTE: Select appropriate amplification primers based on the plant&#39;s proposed DNA barcoding regions; reaction conditions are shown in Table 2.
<ol>
	<li>Set up the reaction conditions corresponding to primer amplification. Use 0.2 mL centrifuge tubes filled with 9.5 &#181;L of ddH2O, 12.5 &#181;L of 2x PCR Master Mix, and 1 &#181;L each of forward primer, reverse primer, and template DNA for a total volume of 25 &#181;L. Prepare a negative control, replacing the template with water.</li>
	<li>Add 20 mL of 1x Tris Acetate-EDTA (TEA) buffer and 0.2 g of agarose to heat and prepare a 1% agarose gel, then add 2 &#181;L of nucleic acid gel stain (10,000x) and mix thoroughly. Pour the mixture into a gel casting tray and allow it to solidify to obtain the agarose gel. Add 3 &#181;L of the PCR product and 2 &#181;L of DNA marker 5000 bp to the gel.</li>
	<li>Set the voltage at 120 V, the current at 400 mA, and electrophoresis for 40 min. Use a versatile gel image analysis system to view gels and check the results.</li>
</ol>
4. Data collection and analysis
NOTE: There is a wide range of sequence assembly and analysis software; we use Codon code Aligner V11.0.1 and MEGA11 as examples for illustration.
<ol>
	<li>Use the aligner to open the sequencing file to observe the peak map and splice the bidirectional sequencing peak map files.
	<ol>
		<li>Select Create a New Project and click OK to go to the software homepage. Select Add Samples under the File menu, select the File to be processed as sequence trace format, and import it directly into the software as the imported file at Unassembled Samples.</li>
		<li>Choose Contig, then, in the section, choose Advanced Assembly, and then choose Assemble in Groups. First-time users, after selecting Assemble in Groups, will see this dialog: Choose Define names. Modify the Define sample name parts according to the file name and click on Assemble. The aligned sequence will be displayed.</li>
		<li>Retrieve the complete ITS2 sequences according to hidden Markov model (HMM)-based model analysis. Use the 5.8s (CGAGGGCACGCCTGCCTGGGCGTCA) and 28s (CGACCCCAGGTCAGGCGGGGCCACC) sequences31 to search the aligned sequence from the beginning to remove the 5.8s and 28s regions.</li>
		<li>Select Go, then, in the section, select Search Sequence and click OK to get the matching sequence. Choose Contig, choose Delete in the section to remove the 5.8s and 28s regions and the low-quality sequences, and then the software will output the splicing sequences for matching.</li>
	</ol>
	</li>
	<li>Use the splicing sequences obtained from the three parallel experimental steps for identification, select BLAST search using the nucleotide database at The National Center for Biotechnology Information (NCBI), and select the Species Identification Tool and the Specific Primer ITS2 corresponding in the Global Pharmacopoeia Genome Database (GPGD) database. 
	NOTE: NCBI32 and GPGD33 include the nucleotide sequences of medicinal plants and animals and they are recognized as authoritative databases. Their major methods for identification are the methods based on sequence comparison34 (BLAST). The percentage identity from the identity results is used to determine whether the species with the greatest similarity is the target genus.</li>
	<li>Use MEGA11 for sequence alignment, analyze and compare intraspecific and interspecific sequence variation, and construct a phylogenetic neighbor-joining tree.
	<ol>
		<li>Download the sequences of three species of Angelica and one species of Peucedanum praeruptorum as an out-group from NCBI. Analyze these sequences together with the result sequence obtained.</li>
		<li>Click File, choose Open a File/Session to import the file, and a dialog will appear. Choose Align &#62; DNA, and select Align by ClustalW for sequence comparison. Choose Phylogenetic Analysis in Data, then return to the home page. Click Construct/Test Neighbor-Joining Tree in PHYLOGENY. The software generates a phylogenetic tree.</li>
	</ol>
	</li>
</ol>

DNA Barcoding for Medicinal Plants: Identification and Phylogenetic Analysis

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Molecular identification technology is easier to learn and master than traditional identification methods. It overcomes the limitations of traditional medicinal herb identification, as it is not affected by the plant&#39;s growth stage and does not rely on subjective judgment or the accumulation of specialized expertise35. Other species are confused with A. sinensis due to its similar morphology and medicinal parts, but with the use of DNA barcoding, it&#160;can be definitively identified36.
The key steps in this protocol involve several critical considerations. First, avoiding contamination when handling herbs and extracting DNA is essential to prevent foreign DNA or impurities from compromising the results. Proper cleaning of the samples is necessary to remove external contaminants, while thorough pulverization enhances DNA extraction by increasing the surface area for reagent interaction. It is also important to use an appropriate amount of sample to ensure efficient mixing with the reagents, allowing for better cytolysis and release of DNA. Lastly, controlling the water bath time is crucial, as excessive heating can lead to DNA degradation, affecting the quality of the extracted DNA. Together, these steps ensure the successful extraction of high-quality DNA for analysis.
Medicinal plants contain polysaccharides and polyphenols that affect DNA extraction and amplification. The use of Nuclear Isolation Buffer reduces the effect of these substances and enables Nuclei lysis, resulting in better extraction of high-purity gDNA28,29,30. Currently, there are three primary DNA extraction methods: the centrifugal column method, the CTAB method, and the SDS method. However, this study chose the centrifugal column method for the experiments due to its stability, simplicity, efficiency, and the ability to extract high concentrations of DNA37, and heating the elution buffer can help to elute DNA with better quality. Here, this study chose ITS2-specific primers17,38, the short ITS2 sequence serves as an efficient taxonomic sequence tag in comparison with the other primers39, which have high inter-specific variation and a wider range of identifications. The possible reason for the amplification failure is DNA degradation in some samples; another possibility is that the pair of ITS2 universal primers used may not work for certain species or using the alternative set of universal primers40. The BLAST result was determined using the highest percent identity score and the lowest e-value. Species identification was considered successful when the highest maximal percent identity included a single species and scored &#62;99%40,41, for the score &#8804;99%, check the quality of the sequencing file or whether the PCR product is contaminated.
In summary, DNA barcoding should play a key role in the quality control of traditional herbal medicine and the international herb trade. This paper provides some insights into extracting plant DNA and a detailed guide on using DNA barcoding technology for identifying medicinal plants. It highlights the key points to note during the experimental process. Thus, this paper provides references for basic herbal identification and helps more people to rapidly master the technology. However, in special cases where the efficiency of single-locus barcode identification is insufficient, it depends on the reference library. Constructing a reference library with high species coverage would be a major step towards identifying species using DNA barcodes42, and many researchers have proposed that multi-locus barcoding technology can improve the efficiency43,44. In addition, with the development of molecular technology, Zheng et al. combined DNA barcoding technology with isothermal DNA amplification technology and RPA-LFD detection to rapidly authenticate poisonous plants45 and some off-the-shelf kits have also been developed46. The DNA barcode database is constantly improving, which plays an important role in promoting the generalization, standardization, and internationalization of the identification methods of herbal medicine.

Medicinal plants have a wide range of pharmacological effects and are important substances for the treatment and prevention of diseases. The market demand for medicinal plants in herbal medicines and pharmaceutical products is huge and still growing. With the increasing market for medicinal plants, the problem of adulteration has hindered the development of medicinal plants. Currently, medicinal plant adulteration suffers from these reasons: 1) the similar morphology of medicinal plants makes it difficult to identify and use them correctly1,2,3,4,5, 2) the increasing demand for medicinal plants has led to insufficient supply in the market6,7, 3) medicinal plants are expensive and have fluctuating prices, and the use of cheap herbs instead of economically valuable materials has led to adulteration and market profiteering8,9. To solve the problems of proper identification and use of medicinal plants, there is a need for a technology that allows non-specialists to identify the source10.
There are limitations to properly identifying and using medicinal plants by appearance and odor alone11. For more accurate identification and quality control, physicochemical methods are employed12. Thin-layer chromatography (TLC), for instance, is a rapid method for identifying medicinal herbs and is included in the Chinese Pharmacopoeia. Nevertheless, it requires reference standards to identify the plants13. High-performance liquid chromatography (HPLC) can perform both qualitative and quantitative tests, making it suitable for medicine quality testing. However, this instrument is expensive and requires specialized knowledge to operate14,15. DNA barcoding technology is a rapid and accurate species identification technology that identifies species by using stable DNA sequences to differentiate between plants with similar morphology. Hebert et al. proposed DNA barcoding technology to identify species, which uses a recognized and relatively short DNA sequence within the genome16, Chen et al. proposed ITS2 as a universal sequence for the molecular identification of medicinal plants and identified more than 6600 plants and found a high identification ability17. The study of medicinal plants based on ITS2 and chloroplast gene fragments has demonstrated the ability to distinguish species at the species level, with applications in the fields of resource protection, market regulation, and international trade17,18,19. The application of DNA barcoding can overcome the limitations of traditional identification methods, which is helpful in ensuring the quality and safety of medicinal plants, preventing resource abuse and confusion20. It has proven beneficial for studying medicinal plants, supporting the growth of the herbal industry in a sustainable manner, and providing a guarantee that the consumer uses the correct medication21,22,23,24.
The paper outlines protocols for how to apply DNA barcoding to identify medicinal plants using A. sinensis as an example. DNA barcoding utilizes one or more standardized short genetic markers in an organism&#39;s DNA to recognize it as belonging to a particular species. Current methods for identifying medicinal plants have certain limitations. Traditional morphological identification relies heavily on experts&#39; extensive experience, which can be influenced by human factors, while chemical identification is prone to issues like adulteration of key compounds. In contrast, DNA barcoding provides a more accurate means of species identification, offering advantages such as speed, high reproducibility, and stability. Furthermore, this technology enables centralized management and sharing of existing species sequence data through the internet and information platforms, significantly improving the efficiency and reliability of species identification11,12. Due to their similar morphology and medicinal parts, A. sinensis is often confused with other species and is frequently misused or intentionally substituted on the market25. Yang et al. identified A. anomala using DNA barcoding to distinguish it from false drugs26. Yuan et al. collected 23 species of Angelica and used DNA barcoding to differentiate between the various species27. By following the procedures described in this protocol, users will be able to authenticate plant-based medicinal materials from pre-processing to ultimately matching the barcoding sequence with the barcode database (Figure 1).

<table><tbody><tr><td>CTAB Rapid Plant Genomic DNA Extraction Kit</td><td>Shanghai Huiling Biotechnology Co.</td><td>NG411M</td><td>Suitable for rapid extraction of high quality genomic DNA from different tissues of a wide range of plants</td></tr><tr><td>DL5000 DNA Marker</td><td>Nanjing vazyme Bio-technology Co.</td><td>MD102-02</td><td>Ready-to-use product, take an appropriate amount of this product directly for electrophoresis when running the gel.</td></tr><tr><td>Electrophoresis</td><td>Beijing Liuyi Biotechnology Co.</td><td>DYY-6C</td><td>Adopt touch screen design, can display set voltage, set current at the same time, parallel output</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>BeijingpsaitongBiotechnologyCo.,Ltd</td><td>E70015-100G</td><td>Nuclear Isolation Buffer formulation reagents.</td></tr><tr><td>Goldview Nucleic Acid Gel Stain(10,000&amp;times;)</td><td>Yisheng Biotechnology (Shanghai) Co., Ltd</td><td>10201ES03</td><td>When using agarose gel electrophoresis to detect DNA, it binds to DNA and produces a strong fluorescent signal.</td></tr><tr><td>High-Speed Tabletop Centrifuge</td><td>Changsha High-tech Industrial Development Zone Xiangyi Centrifuge Instrument Co.</td><td>H1650</td><td>For fast and efficient separation of samples, this compact and lightweight centrifuge offers reliable safety</td></tr><tr><td>High-Throughput Tissue Grinder</td><td>Shanghai Jingxin Industrial Development Co.</td><td>Tiss-48</td><td>A high-frequency vibration instrument for grinding samples</td></tr><tr><td>http://www.gpgenome.com/</td><td>Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences</td><td>-</td><td>HerbGenomics database includes genome sequences, gene sets, organelle genomes, low coverage genome data and DNA barcode sequences.</td></tr><tr><td>https://www.ncbi.nlm.nih.gov/</td><td>U.S. National Library of Medicine</td><td>-</td><td>The National Center for Biotechnology Information advances science and health by providing access to biomedical and genomic information.</td></tr><tr><td>Kylin-Bell</td><td>Haimen Qilinbel Instrument Manufacturing Co.</td><td>VORTEX-5</td><td>Rapid mixing in the form of a high-speed vortex, mixing speed, uniformity, thoroughness</td></tr><tr><td>LifeTouch</td><td>Hangzhou BORI Technology Co.</td><td>TC-96/G/H(b)B</td><td>Adoption of advanced thermoelectric refrigeration technology and newly created TAS technology to enhance its overall performance</td></tr><tr><td>Multi-functional Gel Image Analysis System</td><td>Southwest Operation Center of Shanghai Tianneng Life Science Co.</td><td>Tanon-Mini Space 2000</td><td>Performs rapid gene amplification experiments with a gradient function for mapping amplification conditions and a gradient temperature range of up to 30&amp;deg;C</td></tr><tr><td>NaCl</td><td>Beijing Solarbio Science&amp;amp;Technology Co.,Ltd.</td><td>S8210-100</td><td>Nuclear Isolation Buffer formulation reagents.</td></tr><tr><td>Nanodrop One</td><td>Genes Ltd.</td><td>ND ONE</td><td>Quantify DNA, RNA and protein samples in seconds with just 1-2 &amp;micro;L of sample</td></tr><tr><td>Polyvinyl pyrrolidone</td><td>Shanghai yuanye Bio-Technology Co., Ltd</td><td>S30268-500g</td><td>Nuclear Isolation Buffer formulation reagents.</td></tr><tr><td>Snowflake Ice Maker</td><td>Shanghai Zhixin Experimental Instrument Technology Co.</td><td>ZX-60X</td><td>Adopting rotary extrusion ice making method, fast ice making speed and high efficiency of ice production</td></tr><tr><td>Stainless Steel Beads for Tissue Homogenizer</td><td>Beyotime Biotechnology.&amp;nbsp;</td><td>F6623</td><td>Equipment for grinding and mixing of tissue and other samples by vibration</td></tr><tr><td>Tris Acetate-EDTA buffer</td><td>Beyotime Biotech Inc</td><td>ST716</td><td>TAE is a commonly used buffer for DNA electrophoresis, frequently employed in agarose gel electrophoresis.</td></tr><tr><td>Tris-HCl</td><td>Beijing Solarbio Science&amp;amp;Technology Co.,Ltd.</td><td>T8230</td><td>Nuclear Isolation Buffer formulation reagents.</td></tr><tr><td>Water bath Kettle</td><td>Shanghai Senxin Experimental Instrument Co.</td><td>DK-8D</td><td>Precise thermostat and temperature regulation, accurate and reliable temperature control</td></tr><tr><td>&amp;beta;-mercaptoethanol</td><td>Shanghai Eon Chemical Technology Co.</td><td>R054186-100ml&amp;nbsp;&amp;nbsp;</td><td>Nuclear Isolation Buffer formulation reagents.</td></tr></tbody></table>

application of dna barcoding to identify medicinal plants

Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration obstructs their development. DNA barcoding, a technique for species identification by standard DNA regions, facilitates prompt and accurate identification of traditional medicinal plants. The process of DNA barcoding entails six basic steps: 1) processing the medicinal plants, 2) extracting high-quality total DNA from the medicinal plants using centrifugal column method, 3) amplifying target DNA region internal transcribed spacer 2 (ITS2) with universal primers of plants and performing Sanger sequencing, 4) splicing and aligning sequence to obtain the target sequence, 5) matching the barcode sequence against the barcode library for identification, 6) aligning sequence, comparing intraspecific and interspecific variation, constructing phylogenetic neighbor-joining tree. As shown in the results, the universal primer can amplify the target region. Basic Local Alignment Search Tool (BLAST) demonstrates the percentage identified was 100%, and the neighbor-joining tree demonstrates that the splicing sequences were clustered with the A. sinensis OR879715.1 clade, and the clade support value is 100. This protocol provides a reference for applying DNA barcoding technology as an effective method to identify medicinal plants and adulterants.

Sample DNA quality
The range of OD260/OD280 absorbance ratios was 1.80-1.84. The DNA quantity measured by spectrophotometer for each sample was greater than 100 ng/&#181;L (Table 3), indicating a good quality of sample DNA extraction. This indicates that the samples were not contaminated by protein, RNA, or reagents during the extraction process and that they were of good quality and suitable for downstream PCR amplification.
PCR analysis
Gel electrophoresis was performed on the PCR product of the three parallel experimental samples. The setup was: Marker, samples 1-3 (AS-1, AS-2, AS-3), and negative control (0), as shown in Figure 3. The sizes of AS-1, AS-2, and AS-3 are all between 500 bp with single, bright, clear bands, and there are no bands in the 0, indicating that the extracted DNA was amplified to 500 bp using ITS2 primers.
Database comparison of sequencing results
The sequencing results identified A. sinensis with 100% sequence similarity by combining the BLAST identification results of the NCBI database, which is the same as the species identification results of the GPGD database (Table 4). The BLAST result was determined using the highest percent identity score and the lowest e-value. Species identification was considered successful when the highest maximal percent identity included a single species and scored &#62;99%. If a score is &#8804; 99%, check the quality of the sequencing file or whether the PCR product is contaminated.
Phylogenetic tree-based analysis of species identification
The results showed that in the constructed NJ phylogenetic tree, all four species were clustered in separate clades, and the P. praeruptorum as an outgroup was separated from the Angelica clades. The Splicing sequences were clustered with the A. sinensis OR879715.1 clade, and the clade support value (bootstrap) was 100, and then the other two species, A. dahurica, and A. cartilaginomarginata were each clustered in a separate clade, thus proving that the Splicing sequences were A. sinensis (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66925/66925fig01.jpg" /> 
Figure 1: Medicinal Plant species identification flowchart. (A) Process plant, extraction DNA and sequencing of medicinal plant, (B) comparison of species sequence using databases, and (C) employing phylogenetic trees for taxonomic validation to confirm the phylogenetic relationships among species. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66925/66925fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66925/66925fig02.jpg" /> 
Figure 2: Medicinal Plant DNA extraction workflow. (A) A total of 6 steps are involved in extracting DNA from medicinal plants. (B) PCR instrument amplification and PCR cycling process. (C) Electrophoresis. (D) Sanger sequencing and the sequencing chromatogram. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66925/66925fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66925/66925fig03.jpg" /> 
Figure 3: Gel electrophoresis of Angelica sinensis (Oliv.) Diels. Using the DL5000 DNA marker as a molecular marker, AS-1, AS-2, and AS-3 are used as samples, and 0 as the control group. Gel electrophoresis was conducted, and the results showed that the AS-1, AS-2, and AS-3 samples all had bands at 500 bp, while the control showed no bands. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66925/66925fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/66925/66925fig04.jpg" /> 
Figure 4: Neighbor-Joining phylogenetic tree created from 13 sequences. A total of 10 sequences from four plant species were downloaded from the NCBI database, and the Splicing sequences were compared to analyze and compare intraspecific and interspecific sequence variation and to construct phylogenetic neighbor-joining trees. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66925/66925fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name of Material/ Equipment</td>
			<td>dose</td>
		</tr>
		<tr>
			<td>Polyvinyl pyrrolidone</td>
			<td>10 g</td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>1 M&#160; 50 mL</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid</td>
			<td>0.5 M 20 mL</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>20.45 g</td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol</td>
			<td>10 mL</td>
		</tr>
		<tr>
			<td>sterilized deionized water</td>
			<td>500 mL</td>
		</tr>
	</tbody>
</table>
Table 1: Nuclear Isolation Buffer formulation reagents.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Barcode</td>
			<td>Primer</td>
			<td colspan="2">Primer Sequence (5&#39;-3&#39;)</td>
			<td colspan="3">PCR Amplification Sequencing</td>
		</tr>
		<tr>
			<td rowspan="5">ITS2</td>
			<td rowspan="3">R:3R</td>
			<td colspan="2" rowspan="3">GACGCTTCTCCAGACTACAAT</td>
			<td>94&#176;C</td>
			<td colspan="2">5min</td>
		</tr>
		<tr>
			<td>94&#176;C</td>
			<td>30s</td>
			<td rowspan="3">40cycles</td>
		</tr>
		<tr>
			<td>56&#176;C</td>
			<td>30s</td>
		</tr>
		<tr>
			<td rowspan="2">F:2F</td>
			<td colspan="2" rowspan="2">ATGCGATACTTGGTGTGAAT</td>
			<td>72&#176;C</td>
			<td>45s</td>
		</tr>
		<tr>
			<td>72&#176;C</td>
			<td colspan="2">10min</td>
		</tr>
	</tbody>
</table>
Table 2: DNA barcode primers and PCR reaction conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>samples</td>
			<td>DNA extraction(ng/&#181;L)</td>
			<td>OD260/OD280</td>
		</tr>
		<tr>
			<td>AS-1</td>
			<td>124</td>
			<td>1.84</td>
		</tr>
		<tr>
			<td>AS-2</td>
			<td>184</td>
			<td>1.81</td>
		</tr>
		<tr>
			<td>AS-3</td>
			<td>164</td>
			<td>1.82</td>
		</tr>
	</tbody>
</table>
Table 3: Angelica sinensis (Oliv.) Diels extracted DNA quality.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Samples</td>
			<td>Aligned sequence Length(bp)</td>
			<td>Splicing sequence Length(bp)</td>
			<td>GC(%)</td>
			<td>NCBI:Percentage BLAST(%)</td>
			<td>GPGD:Percentage Species identification(%)</td>
		</tr>
		<tr>
			<td>AS-1</td>
			<td>500bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>AS-2</td>
			<td>504bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>AS-3</td>
			<td>499bp</td>
			<td>229bp</td>
			<td>55.50%</td>
			<td>100%</td>
			<td>100%</td>
		</tr>
	</tbody>
</table>
Table 4: Database comparison of sequencing results.

Author Spotlight: Harnessing DNA Barcode Technology to Enhance the Efficiency of Medicinal Plant Identification

The present protocol describes the use of DNA barcoding technology to authenticate plant-based medicinal materials, and the medicinal plant Angelica sinensis (Oliv.) Diels was identified as an example.

Application of DNA Barcoding to Identify Medicinal Plants

Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration ...

application-of-dna-barcoding-to-identify-medicinal-plants

Nanyang Technological University

Research

JoVE Journal

Genetics

1.3K Views.  Guizhou University of Traditional Chinese Medicine. Mijn onderzoek is erop gericht de kracht van DNA-barcodetechnologie te benutten om de nauwkeurigheid en efficiëntie van medische plantidentificatie te verbeteren en zo bij te dragen aan het behoud en het duurzame gebruik van hun waardevolle natuurlijke hulpbron. DNA-barcodetechnologie heeft bredere toepassingen gevonden, zoals kwaliteitscontrole door soorten te monitoren of te beschermen en beoordeling van de biodiversiteit. High-throughput screening en high...

Video: Auteur in de schijnwerpers: DNA-barcodetechnologie gebruiken om de efficiëntie van de identificatie van medicinale planten te verbeteren

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species.
Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family,&#160;it could be easily used to other prokaryote and eukaryote species

Here, we present a protocol for tracing genomic DNA (gDNA) contamination in RNA samples. The presented method utilizes primers specific for the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) genes. The method is suited for reliable and sensitive detection of DNA contamination in most eukaryotes and prokaryotes.

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Rapid High-throughput Species Identification of Botanical Material Using Direct Analysis in Real Time High Resolution Mass Spectrometry

We demonstrate that direct analysis in real time-high resolution mass spectrometry can be used to produce mass spectral profiles of botanical material, and that these chemical fingerprints can be used for plant species identification. The mass spectral data can be acquired rapidly and in a high throughput manner without the need for sample extraction, derivatization or pH adjustment steps. The use of this technique bypasses challenges presented by more conventional techniques including lengthy chromatography analysis times and resource intensive methods. The high throughput capabilities of the direct analysis in real time-high resolution mass spectrometry protocol, coupled with multivariate statistical analysis processing of the data, provide not only class characterization of plants, but also yield species and varietal information. Here, the technique is demonstrated with two psychoactive plant products, Mitragyna speciosa (Kratom) and Datura (Jimsonweed), which were subjected to direct analysis in real time-high resolution mass spectrometry followed by statistical analysis processing of the mass spectral data. The application of these tools in tandem enabled the plant materials to be rapidly identified at the level of variety and species.

A method for species identification of botanical material by direct analysis in real time-high resolution mass spectrometry and multivariate statistical analysis is presented.

We demonstrate that direct analysis in real time-high resolution mass spectrometry can be used to produce mass spectral profiles of botanical material, ...

Chemistry

Application of DNA Fingerprinting using the D1S80 Locus in Lab Classes

In biological sciences, DNA fingerprinting has been widely used for paternity testing, forensic applications and phylogenetic studies. Here, we describe a reliable and robust method for genotyping individuals by Variable Number of Tandem Repeat (VNTR) analysis in the context of undergraduate laboratory classes. The human D1S80 VNTR locus is used in this protocol as a highly polymorphic marker based on variation in the number of repetitive sequences.
This simple protocol conveys useful information for teachers and the implementation of DNA fingerprinting in practical laboratory classes. In the presented laboratory exercise, DNA extraction followed by PCR amplification is used to determine genetic variation at the D1S80 VNTR locus. Differences in the fragment size of PCR products are visualized by agarose gel electrophoresis. The fragment sizes and repeat numbers are calculated based on a linear regression of the size and migration distance of a DNA size standard.
Following this guide, students should be able to:
&#8226;&#160; Harvest and extract DNA from buccal mucosa epithelial cells 
&#8226;&#160; Perform a PCR experiment and understand the function of various reaction components 
&#8226;&#160; Analyze the amplicons by agarose gel electrophoresis and interpret the results 
&#8226;&#160; Understand the use of VNTRs in DNA fingerprinting and its application in biological sciences

Application of DNA Fingerprinting using the D1S80 Locus in Lab Classes

Here we describe a simple protocol to generate DNA fingerprinting profiles by amplifying the VNTR locus D1S80 from epithelial cell DNA.

In biological sciences, DNA fingerprinting has been widely used for paternity testing, forensic applications and phylogenetic studies. Here, we describe a ...

Quantification of the Potential Impact of Glyphosate-Based Products on Microbiomes

Glyphosate-based products (GBP) are the most common broad-spectrum herbicides worldwide. The target of glyphosate is the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in the shikimate pathway, which is virtually universal in plants. The inhibition of the enzyme stops the production of three essential amino acids: phenylalanine, tyrosine, and tryptophan. EPSPS is also present in fungi and prokaryotes, such as archaea and bacteria; thus, the use of GBP may have an impact on the microbiome composition of soils, plants, herbivores, and secondary consumers. This article aims to present general guidelines to assess the effect of GBP on microbiomes from field experiments to bioinformatics analyses and provide a few testable hypotheses. Two field experiments are presented to test the GBP on non-target organisms. First, plant-associated microbes from 10 replicated control and GBP treatment plots simulating no-till cropping are sampled and analyzed. In the second experiment, samples from experimental plots fertilized by either poultry manure containing glyphosate residues or non-treated control manure were obtained. Bioinformatics analysis of EPSPS protein sequences is utilized to determine the potential sensitivity of microbes to glyphosate. The first step in estimating the effect of GBP on microbiomes is to determine their potential sensitivity to the target enzyme (EPSPS). Microbial sequences can be obtained either from public repositories or by means of PCR amplification. However, in the majority of field studies, microbiome composition has been determined based on universal DNA markers such as the 16S rRNA and the internal transcribed spacer (ITS). In these cases, sensitivity to glyphosate can only be estimated through a probabilistic analysis of EPSPS sequences using closely related species. The quantification of the potential sensitivity of organisms to glyphosate, based on the EPSPS enzyme, provides a robust approach for further experiments to study target and non-target resistant mechanisms.

Glyphosate-based products (GBP) are the most common broad-spectrum herbicides worldwide. In this article, we introduce general guidelines to quantify the effect of GBP on microbiomes, from field experiments to bioinformatics analyses.

Glyphosate-based products (GBP) are the most common broad-spectrum herbicides worldwide. The target of glyphosate is the enzyme ...

Environment

Primary Organ Identification in Medicinal Plants Using 13C6&#45;Glucose Labeling

13C6&#45;Glucose Labeling Associated with LC&#45;MS&#58; Identification of Plant Primary Organs in Secondary Metabolite Synthesis

This paper presents a novel and efficient method for certifying primary organs involved in secondary metabolite synthesis. As the most important secondary metabolite in Parispolyphylla var. yunnanensis (Franch.) Hand. -Mzt. (PPY), Paris saponin (PS) has a variety of pharmacological activities and PPY is in increasing demand. This study established leaf, rhizome, and stem-vascular-bundle 13C6-Glucose feeding and non-feeding four treatments to precisely certify the primary organs involved in Paris saponins VII (PS VII) synthesis. By combining liquid chromatography-mass spectrometry (LC-MS), the 13C/12C ratios of leaf, rhizome, stem, and root in different treatments were quickly and accurately calculated, and four types of PS isotopic ion peak(M&#8722;) ratios were found: (M+1) &#8722;/M&#8722;, (M+2) &#8722;/M&#8722;, (M+3) &#8722;/M&#8722; and (M+4) &#8722;/M&#8722;. The results showed that the ratio of 13C/12C in the rhizomes of the stem-vascular-bundle and rhizome feeding treatments was significantly higher than that in the non-feeding treatment. Compared to the non-feeding treatment, the ratio of PS VII molecules (M+2) &#8722;/M&#8722; in the leaves increased significantly under leaf and stem-vascular-bundle feeding treatments. Simultaneously, compared to the non-feeding treatment, the ratio of PS VII molecules (M+2) &#8722;/M&#8722; in the leaves under rhizome treatment showed no significant difference. Furthermore, the ratio of PS VII molecules (M+2) &#8722;/M&#8722; in the stem, root, and rhizome showed no differences among the four treatments. Compared to the non-feeding treatment, the ratio of the Paris saponin II (PS II) molecule (M+2) &#8722;/M&#8722; in leaves under leaf feeding treatment showed no significant difference, and the (M+3) &#8722;/M&#8722; ratio of PS II molecules in leaves under leaf feeding treatment were lower. The data confirmed that the primary organ for the synthesizing of PS VII is the leaves. It lays the foundation for future identification of the primary organs and pathways involved in the synthesis of secondary metabolites in medicinal plants.

Author Spotlight: Plant Primary Organs Profiling Using 13C6&#45;Glucose Labeling and LC&#45;MS

The developed method of 13C6-Glucose labeling combined with liquid chromatography high-resolution mass spectrometry is versatile and lays the foundation for future studies on the primary organs and pathways involved in the synthesis of secondary metabolites in medicinal plants, as well as the comprehensive utilization of these secondary metabolites.

This paper presents a novel and efficient method for certifying primary organs involved in secondary metabolite synthesis. As the most important secondary ...

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas1-2. Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety4 (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed.
Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce viable wind-dispersed seeds that spread cogongrass over wide distances5-7. JBG has a slightly different genotype than cogongrass and may be able to form viable hybrids with cogongrass. To add to the problem, JBG is more cold and shade tolerant than cogongrass8-10, and gene flow between these two varieties is likely to generate hybrids that are more aggressive, shade tolerant, and cold hardy than wild-type cogongrass. While wild-type cogongrass currently infests over 490 million hectares worldwide, in the Southeast U.S. it infests over 500,000 hectares and is capable of occupying most of the U.S. as it rapidly spreads northward due to its broad niche and geographic potential3,7,11. The potential of a genetic crossing is a serious concern for the USDA-APHIS Federal Noxious Week Program. Currently, the USDA-APHIS prohibits JBG in states where there are major cogongrass infestations (e.g., Florida, Alabama, Mississippi). However, preventing the two varieties from combining can prove more difficult as cogongrass and JBG expand their distributions. Furthermore, the distribution of the JBG revert is currently unknown and without the ability to identify these varieties through morphology, some cogongrass infestations may be the result of JBG reverts. Unfortunately, current molecular methods of identification typically rely on AFLP (Amplified Fragment Length Polymorphisms) and DNA sequencing, both of which are time consuming and costly. Here, we present the first cost-effective and reliable PCR-based molecular genotyping method to accurately distinguish between cogongrass and JBG revert.

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

We provide a cost-effective and rapid molecular genotyping protocol that employs variety-specific PCR primers that target DNA sequence differences within the chloroplast trnL-F spacer region to differentiate between varieties of Imperata cylindrica (cogongrass) that cannot be distinguished by morphology alone. These varieties include the federally listed noxious weed, cogongrass and closely-related, wide-spread ornamental variety, I. cylindrica var. koenigii (Japanese blood grass).

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in ...

Biology

Analyzing Tibetan Medicinal Plant APB Using 2D-HPLC-MS with Molecular Networking

2D-HPLC-MS Technology Combined with Molecular Network for the Identification of Components in Tibetan Medicine Aconitum pendulum

In this study, a comprehensive approach was employed, utilizing 2D-HPLC-MS technology in conjunction with the molecular network to unravel the intricate chemical composition of the Tibetan medicinal plant APB. Through the implementation of 2D-HPLC, enhanced separation of complex mixtures was achieved, enabling the isolation of individual compounds for subsequent analysis. The molecular network approach further aided in elucidating structural relationships among these compounds, contributing to the determination of potential bioactive molecules. This integrated strategy efficiently identified a wide array of chemical components present within the plant. The findings revealed a diverse spectrum of chemical constituents within APB, including alkaloids, among others. This research not only advances understanding of the phytochemical profile of this traditional Tibetan medicine but also provides valuable insights into its potential therapeutic properties. The integration of 2D-HPLC-MS and molecular network proves to be a powerful tool for systematically exploring and identifying complex chemical compositions in herbal medicines, paving the way for further research and development in the field of natural product discovery.

Author Spotlight: Integrating 2D-HPLC-MS and Molecular Networking in Natural Medicine Analysis

This study utilizes two-dimensional high-performance liquid chromatography-mass spectrometry (2D-HPLC-MS) technology in conjunction with molecular networking to unravel the intricate chemical composition of the Tibetan medicinal plant Aconitum pendulum Busch (APB). The article provides a detailed protocol for the systematic exploration and identification of complex chemical components of herbal medicines.

In this study, a comprehensive approach was employed, utilizing 2D-HPLC-MS technology in conjunction with the molecular network to unravel the intricate ...

Medicine

Field Identification of Matricaria chamomilla using a Portable qPCR System

Quality control in botanical products begins with the raw material supply. Traditionally, botanical identification is performed through morphological assessment and chemical analytical methods. However, the lack of availability of botanists, especially in recent years, coupled with the need to enhance quality control to combat the stresses on the supply chain brought by increasing consumer demand and climate change, necessitates alternative approaches. The goal of this protocol is to facilitate botanical species identification using a portable qPCR system on the field or in any setting, where access to laboratory equipment and expertise is limited. Target DNA is amplified using dye-based qPCR, with DNA extracted from botanical reference materials serving as a positive control. The target DNA is identified by its specific amplification and matching its melting peak against the positive control. A detailed description of the steps and parameters, from hands-on field sample collection, to DNA extraction, PCR amplification, followed by data interpretation, has been included to ensure that readers can replicate this protocol. The results produced align with traditional laboratory botanical identification methods. The protocol is easy to perform and cost-effective, enabling quality testing on raw materials as close to the point of origin of the supply chain as possible.

Field Identification of Matricaria chamomilla using a Portable qPCR System

Presented here is a protocol for field identification of Matricaria chamomilla using a portable qPCR system. This easy-to-perform protocol is ideal as a method to confirm the identity of a botanical species at locations where access to laboratory equipment and expertise is limited, such as farms and warehouses.

Quality control in botanical products begins with the raw material supply. Traditionally, botanical identification is performed through morphological ...

Systematic Approach to Identify Novel Antimicrobial and Antibiofilm Molecules from Plants' Extracts and Fractions to Prevent Dental Caries

Natural products provide structurally different substances, with a myriad of biological activities. However, the identification and isolation of active compounds from plants are challenging because of the complex plant matrix and time-consuming isolation and identification procedures. Therefore, a stepwise approach for screening natural compounds from plants, including the isolation and identification of potentially active molecules, is presented. It includes the collection of the plant material; preparation and fractionation of crude extracts; chromatography and spectrometry (UHPLC-DAD-HRMS and NMR) approaches for analysis and compounds identification; bioassays (antimicrobial and antibiofilm activities; bacterial &#34;adhesion strength&#34; to the salivary pellicle and initial glucan matrix treated with selected treatments); and data analysis. The model is simple, reproducible, and allows high-throughput screening of multiple compounds, concentrations, and treatment steps can be consistently controlled. The data obtained provide the foundation for future studies, including formulations with the most active extracts and/or fractions, isolation of molecules, modeling molecules to specific targets in microbial cells and biofilms. For example, one target to control cariogenic biofilm is to inhibit the activity of Streptococcus mutans glucosyltransferases that synthesize the extracellular matrix&#8217; glucans. The inhibition of those enzymes prevents the biofilm build-up, decreasing its virulence.

Natural products represent promising starting points for the development of new drugs and therapeutic agents. However, due to the high chemical diversity, finding new therapeutic compounds from plants is a challenging and time-consuming task. We describe a simplified approach to identify antimicrobial and antibiofilm molecules from plant extracts and fractions.

Natural products provide structurally different substances, with a myriad of biological activities. However, the identification and isolation of active ...

Application of DNA Barcoding to Identify Medicinal Plants

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video