These studies were partially funded by a grant from the George F. Haddix Fund of Creighton University (KMD). Figure 1 is generated in biorender.com, and Figure 3 is generated in benchling.com.

The details of the species, reagents, and equipment used in this study are listed in the Table of Materials. The sequence of the 17,004 base pair pGRUB construct is provided in Supplementary File 1.
1. Culturing trophozoites
<ol>
	<li>Thaw frozen N. gruberi trophozoites at 37 &#176;C for 3 min.</li>
	<li>Inoculate trophozoites into T25 flasks in modified peptone/yeast extract/nucleic acid/folic acid/hemin with 10% fetal calf serum (PYNFH) media plus 2% buffer (disodium phosphate, potassium dihydrogen phosphate).</li>
	<li>Culture the trophozoites at 25&#160;&#176;C until ~80% confluent, where they exhibit an amoeboid morphology (Figure 2A). 
	NOTE: When initially reviving a culture of trophozoites from their frozen state, it can take up to 5-7 days for a T25 to become confluent. Decant media every 3-4 days and replace with fresh media.</li>
	<li>Place the confluent flasks on ice for 5-10 min to release the adhered trophozoites from the plastic. Gently swirl the flask to dislodge any remaining adherent cells. The trophozoites now have a &#39;rounded up&#39; morphology (Figure 2B).</li>
	<li>Split the cultures 1:2 to 1:4 into new tissue culture flasks.</li>
	<li>Remove the PYNFH and replace it with sterile encystment media (120 mM sodium chloride, 0.03 mM magnesium chloride, 1 mM disodium phosphate, 1 mM potassium dihydrogen phosphate, 0.03 mM calcium chloride, 0.02 mM iron chloride, pH 6.8)22 to encyst the N. gruberi. 
	NOTE: The majority of trophozoites become encysted by 72 h (Figure 2C). Excystment should be completed within 72 h.</li>
	<li>Remove cysts from flasks, centrifuge at 600 x g for 10 min at 20&#160;&#176;C, and resuspend cysts in PYNFH media with 10% fetal calf serum to excyst the cells. Incubate at 25&#160;&#176;C for 24 h until trophozoites begin to emerge.</li>
</ol>
2. Transfecting trophozoites
<ol>
	<li>Plate the trophozoites into a 6-well flat-bottomed tissue culture plate (1 mL of 1 x 106 trophozoites/mL) and culture at 25&#160;&#176;C.</li>
	<li>Transfect the cells when they reach 70%-80% confluent (~10.4 x 104 cells/cm2 in 6-well clusters). Warm the transfection reagent to room temperature before use.</li>
	<li>Prepare the plasmid-transfection reagent mixture as follows: 75 ng of plasmid DNA and 0.225 &#181;L of the transfection reagent in 200 &#181;L of PYNFH media without FBS. Prepare sufficient plasmid-transfection reagent mixture to perform transfection in duplicate. 
	NOTE: A bacterial plasmid containing a full-length clone of N. gruberi CERE (pGRUB) was used in this study. Empty plasmid (pGEM) was used as a negative control (Figure 3).</li>
	<li>Incubate the plasmid-transfection reagent mixture at room temperature for 10 min.</li>
	<li>Remove ~800 &#181;L of medium from the trophozoite monolayers just prior to transfection.</li>
	<li>Put the plasmid-transfection reagent mixture on the trophozoites.</li>
	<li>Gently swirl the plate every 15 min to prevent the media from aggregating at the edges of the plate.</li>
	<li>Wash the monolayers once with 2 mL of growth medium after 1 h incubation at 25&#160;&#176;C.</li>
	<li>Treat the monolayers with 10 U DNase in 1 mL of 10x DNase buffer for 15 min at 37&#160;&#176;C to remove residual plasmid DNA, wash once with growth medium, add 2 mL of fresh media, and place at 25&#176;C. Incubate the plate for 24-36 h.</li>
	<li>Place the plate on ice for 10 min to release cells.</li>
	<li>Split one well (1:2) into two&#160;new wells.</li>
	<li>Collect trophozoites from the remaining wells for experimental purposes. 
	NOTE: All cultures are performed in duplicate. For each condition, 1 well is used for passage, and 1 is used for CERE isolation.</li>
</ol>
3. Isolating CERE from Naegleria
<ol>
	<li>Calculate the number of trophozoites in each well used for CERE isolation by trypan blue exclusion staining and a hemocytometer23.</li>
	<li>Place the trophozoites in a 2.0 mL tube.</li>
	<li>Wash trophozoites once in 100 mM sodium chloride (pH 7.5) via centrifugation (600 x g, 10 min, 4 &#176;C). 
	NOTE: Sodium chloride prevents the trophozoites from adhering to the sides of the tube.</li>
	<li>Remove the supernatant and resuspend cell pellets in 100 &#181;L of 100 mM EDTA (pH 7.5).</li>
	<li>Place the tube in a heat block for 15 min at 98&#160;&#176;C to lyse the cells and inactivate the enzymes in the trophozoites. 
	NOTE: This step inactivates DNases, which are abundant in Naegleria trophozoites. DNases may interfere with the ability to detect native CERE and the molecular clone in step 4. DNA yield is decreased when over ~3 x 106 cells are used in step 3.4.</li>
	<li>Centrifuge the tubes at top speed (16,000 x g) at 4&#160;&#176;C for 10 min to pellet the debris.</li>
	<li>Transfer the supernatants to a new tube.</li>
	<li>Ethanol precipitate the supernatants with 0.5 volumes of 7.5 M ammonium acetate (pH 7.5), 3 volumes of absolute ethanol, and 1 &#181;L of 10 mg/mL glycogen as a carrier.</li>
	<li>Invert the tube several times and place the tube at -80&#160;&#176;C for at least 1&#160;h or overnight.</li>
	<li>Warm the samples to room temperature.</li>
	<li>Centrifuge the tubes at room temperature for 10 min at 16,000 x g.</li>
	<li>Remove the supernatant and wash the pellet with 70% ethanol by centrifugation for 5 min at 16,000 x g (at room temperature).</li>
	<li>Remove ethanol and air-dry the pellet for 5 min.</li>
	<li>Resuspend the dried pellet in sterile deionized (DI) water. Normalize volume to 10,000 trophozoites per &#181;L.</li>
	<li>Store at -80&#160;&#176;C until use in PCR.</li>
</ol>
4. PCR detection of transformed trophozoites
<ol>
	<li>Use 20,000 cell equivalents of DNA, 600 nM primers (Table 1), and Taq polymerase and perform the PCR24. 
	NOTE: Primers that distinguish between native CERE and the cloned CERE are listed in Table 1, as are the PCR conditions. Figure 3 shows the location of the primers on the constructs. PCR will require optimization depending on the primers used as well as the specific PCR mix utilized.</li>
	<li>Microwave 0.8% agarose in 1x Tris base, acetic acid, and EDTA (TAE) buffer until the agarose is dissolved.</li>
	<li>Cool the agarose to ~50&#160;&#176;C at room temperature.</li>
	<li>Pour the solution into a gel casting tray containing a comb to form wells.</li>
	<li>Let the gel sit at room temperature until solidified.</li>
	<li>Place the gel in the electrophoresis apparatus.</li>
	<li>Decant 1x TAE into the electrophoresis chamber until the gel is covered.</li>
	<li>Remove the comb.</li>
	<li>Add 6x loading dye (0.25% bromphenol blue, 0.25% xylene cyanol, 30% glycerol) to samples and load the gel. Use a DNA ladder to determine the size of the PCR product.</li>
	<li>Attach the electrode, turn on the power supply, and run the gel at 80 V for ~1.5-2 h.</li>
	<li>Turn off the power and remove the gel.</li>
	<li>Stain the gel with DNA dye (e.g., 10 &#181;L of 10 mg/mL ethidium bromide) in 100 mL of DI water for 10 min.</li>
	<li>Destain the gel for 20 min in DI water.</li>
	<li>Visualize gel on an ultraviolet (UV) light system and document the results.</li>
</ol>

Using a CERE-Based Vector for Transfection of Naegleria gruberi Trophozoites

<ol>
	<li>De Jonckheere, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+do+we+know+by+now+about+the+genus+Naegleria.">What do we know by now about the genus Naegleria.</a> Exp Parasitol. 145, S2-S9 (2014).</li><li>De Jonckheere, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+century+of+research+on+the+Amoeboflagellate+genus+Naegleria.">A century of research on the Amoeboflagellate genus Naegleria.</a> Acta Protozool. 41, 309-342 (2002).</li><li>Fulton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+differentiation+in+Naegleria+gruberi.">Cell differentiation in Naegleria gruberi.</a> Annu Rev Microbiol. 31, 597-629 (1977).</li><li>Grace, E., Asbill, S., Virga, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naegleria+fowleri:+Pathogenesis,+diagnosis,+and+treatment+options.">Naegleria fowleri: Pathogenesis, diagnosis, and treatment options.</a> AAC. 59 (11), 6677-6681 (2015).</li><li>Moseman, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Battling+brain-eating+amoeba:+enigmas+surrounding+immunity+to+Naegleria+fowleri.">Battling brain-eating amoeba: enigmas surrounding immunity to Naegleria fowleri.</a> PLOS Pathog. 16 (4), e1008406 (2020).</li><li>Marciano-Cabral, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+of+Naegleria+spp.">Biology of Naegleria spp.</a> Microbiol Rev. 52 (1), 114-133 (1988).</li><li>Pi&#241;ero, J. E., Oma&#241;a-Molina, M., Ch&#225;vez-Mungu&#237;a, B., Lorenzo-Morales, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naegleria+fowleri.">Naegleria fowleri.</a> Trends Parasitol. 35 (10), 848-849 (2019).</li><li>Zysset-Burri, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+identification+of+pathogenicity+factors+of+the+free-living+amoeba+Naegleria+fowleri.">Genome-wide identification of pathogenicity factors of the free-living amoeba Naegleria fowleri.</a> BMC Genomics. 15, 496-510 (2014).</li><li>Liechti, N., Sch&#252;rch, N., Bruggmann, R., Wittwer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+Naegleria+lovaniensis,+the+basis+for+a+comparative+approach+to+unravel+pathogenicity+factors+of+the+human+pathogenic+amoeba+N.+fowleri.">The genome of Naegleria lovaniensis, the basis for a comparative approach to unravel pathogenicity factors of the human pathogenic amoeba N. fowleri.</a> BMC Genom. 19, 654-665 (2018).</li><li>Liechti, N., Sch&#252;rch, N., Bruggmann, R., Wittwer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanopore+sequencing+improves+the+draft+genome+of+the+human+pathogenic+amoeba+Naegleria+fowleri.">Nanopore sequencing improves the draft genome of the human pathogenic amoeba Naegleria fowleri.</a> Sci Reports. 9, 16040-16049 (2019).</li><li>Fritz-Laylin, L. K., Ginger, M. L., Walsh, C., Dawson, S. C., Fulton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Naegleria+genome:+A+free-living+microbial+eukaryote+lends+unique+insights+into+core+eukaryotic+cell+biology.">The Naegleria genome: A free-living microbial eukaryote lends unique insights into core eukaryotic cell biology.</a> Res Microbiol. 162, 607-618 (2011).</li><li>Clark, C. G., Cross, G. A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=rRNA+genes+of+Naegleria+gruberi+are+carried+exclusively+on+a+14-kilobase-pair+plasmid.">rRNA genes of Naegleria gruberi are carried exclusively on a 14-kilobase-pair plasmid.</a> Mol Cell Biol. 7 (9), 3027-3031 (1987).</li><li>Clark, C. G., Cross, G. A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circular+ribosomal+RNA+genes+are+a+general+feature+of+schizopyrenid+amoebae.">Circular ribosomal RNA genes are a general feature of schizopyrenid amoebae.</a> J Protozool. 35 (2), 326-329 (1988).</li><li>Dao, F. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identify+origin+of+replication+in+Saccharomyces+cerevisiae+using+two-step+feature+selection+technique.">Identify origin of replication in Saccharomyces cerevisiae using two-step feature selection technique.</a> Bioinformatics. 35 (12), 2075-2083 (2019).</li><li>Mullican, J. C., Chapman, N. M., Tracy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+genome+sequence+of+the+circular+extrachromosomal+element+of+Naegleria+gruberi+strain+EGB+ribosomal+DNA.">Complete genome sequence of the circular extrachromosomal element of Naegleria gruberi strain EGB ribosomal DNA.</a> Genome Announc. 6 (6), e00020-e00021 (2018).</li><li>Mullican, J. C., Drescher, K. M., Chapman, N. M., Tracy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+genome+sequence+of+the+Naegleria+fowleri+(strain+LEE)+closed+circular+extrachromosomal+ribosomal+DNA+element.">Complete genome sequence of the Naegleria fowleri (strain LEE) closed circular extrachromosomal ribosomal DNA element.</a> Microbiol Resource Announce. 9 (49), e01055 (2020).</li><li>Nguyen, B. T., Chapman, N. M., Tracy, S., Drescher, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+extrachromosomal+elements+of+the+Naegleria+amoebae:+How+little+we+know.">The extrachromosomal elements of the Naegleria amoebae: How little we know.</a> Plasmid. 115, 102567 (2021).</li><li>Nguyen, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+sequence+of+the+closed+circular+extrachromosomal+element+(CERE)+of+Naegleria+australiensis+De+Jonckheere+(strain+PP+397).">Complete sequence of the closed circular extrachromosomal element (CERE) of Naegleria australiensis De Jonckheere (strain PP 397).</a> Microbiol Resource Announce. 12, e0032123 (2023).</li><li>Nguyen, B. T., Chapman, N. M., Stessman, H. A. F., Tracy, S., Drescher, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+sequence+of+the+closed+circular+extrachromosomal+element+of+Naegleria+jadini+Willaert+and+Ray+(Strain+ITMAP400).">Complete sequence of the closed circular extrachromosomal element of Naegleria jadini Willaert and Ray (Strain ITMAP400).</a> Microbiol Resource Announce. 12 (4), 0006123 (2023).</li><li>Nguyen, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+sequence+of+the+closed+circular+extrachromosomal+element+(CERE)+of+Naegleria+pringsheimi+De+Jonckheere+(strain+Singh).">Complete sequence of the closed circular extrachromosomal element (CERE) of Naegleria pringsheimi De Jonckheere (strain Singh).</a> Microbiol Resource Announce. 13 (4), (2024).</li><li>Mullican, J. C., Chapman, N. M., Tracy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+single+origin+of+replication+in+the+Naegleria+gruberi+extrachromosomal+DNA+element.">Mapping the single origin of replication in the Naegleria gruberi extrachromosomal DNA element.</a> Protist. 170, 141-152 (2019).</li><li>Sohn, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+liquid+media+for+encystation+of+pathogenic+free-living+amoebae.">Efficient liquid media for encystation of pathogenic free-living amoebae.</a> Korean J Parasitol. 55 (3), 233-238 (2017).</li><li>Strober, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypan+blue+exclusion+test+of+cell+viability.">Trypan blue exclusion test of cell viability.</a> Curr Protoc Immunol. 111, 1-3 (2001).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase Chain Reaction: Basic protocol plus troubleshooting and optimization strategies.</a> J Vis Exp. (63), e3998 (2012).</li><li>Jeong, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+nfa1+gene+cloned+from+pathogenic+Naegleria+fowleri+in+non-pathogenic+N.+gruberi+enhances+cytotoxicity+against+CHO+target+cells+in+vitro.">Expression of the nfa1 gene cloned from pathogenic Naegleria fowleri in non-pathogenic N. gruberi enhances cytotoxicity against CHO target cells in vitro.</a> Infect Immun. 73 (7), 4098-4105 (2005).</li><li>Clark, C. G., Cross, G. A. M., De Jonckheere, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+evolutionary+divergence+in+the+genus+Naegleria+by+analysis+of+ribosomal+DNA+plasmid+restriction+patterns.">Evaluation of evolutionary divergence in the genus Naegleria by analysis of ribosomal DNA plasmid restriction patterns.</a> Mol Biochem Parasitol. 34 (3), 281-296 (1989).</li><li>De Jonckheere, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+variation+in+the+ribosomal+internal+transcribed+spacers,+including+the+5.8S+rDNA,+of+Naegleria+spp.">Sequence variation in the ribosomal internal transcribed spacers, including the 5.8S rDNA, of Naegleria spp.</a> Protist. 149 (3), 221-228 (1998).</li><li>Rawal, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+prediction+of+G4+DNA+as+regulatory+motifs:+Role+in+Escherichia+coli+global+regulation.">Genome-wide prediction of G4 DNA as regulatory motifs: Role in Escherichia coli global regulation.</a> Genome Res. 16 (5), 644-655 (2006).</li><li>Yadav, V. K., Abraham, J. K., Mani, P., Kulshrestha, R., Chowdhury, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QuadBase:+Genome-wide+database+of+G4+DNA+-+occurrence+and+conservation+in+human,+chimpanzee,+mouse+and+rat+promoters+and+146+microbes.">QuadBase: Genome-wide database of G4 DNA - occurrence and conservation in human, chimpanzee, mouse and rat promoters and 146 microbes.</a> Nucleic Acids Res. 36, D381-D385 (2007).</li></ol>

No financial conflicts of interest were declared.

The protocol outlined herein is very straightforward, although every construct will likely require some degree of optimization, particularly of the DNA-transfection reagent ratio, depending on the nature of the construct and the species of Naegleria used. We have only tested one commercially available transfection reagent using this protocol, but it is likely that several others may be effective. Given that a full-length clone of the CERE is used, containing a functional origin of replication and thus replicating autonomously, the construct possesses all necessary eukaryotic replication machinery. If a partial clone were to be inserted in the pGEM vector, the transfected clone would be predicted to be lost very soon after transfection if it does not contain a functional eukaryotic origin of replication, similar to the empty pGEM vector (Figure 2B). Furthermore, these data demonstrate that the presence of prokaryotic DNA does not interfere with the ability of the molecular clone to be retained by the trophozoite.
While there has been one reported instance of transfection of N. gruberi trophozoites25, the insert used in the present study is considerably larger (~17 kbp) than what was transfected in the prior study (&#60;1 kbp). While it is unknown what the maximum size plasmid can be tolerated by the Naegleria, unpublished data from our laboratory has determined that amebae of another genus (Willaertia) contain CERE that are approximately 24 kbp in size.
A key step in ensuring that this protocol detects DNA within the trophozoite is the DNase treatment step (step 2.9), which ensures that residual DNA (that is, DNA that has not been transfected) is eliminated from the cultures. A couple of quality control procedures were performed to ensure the integrity of the protocol. First, the constructs were sequenced. Second, the PCR products were also sequenced to confirm their identity and ensure that there was no contamination of the assay and confirmed that the PCR products were not the result of mispriming.
While successful transfection of a plasmid with a eukaryotic origin of replication was demonstrated, it is clear from Figure 4 that there is a diminution of the PCR signal following the first passage of the trophozoites. qPCR was performed on the transfected trophozoites over time, and it was determined that the level of pGRUB drops from approximately 1,600 copies in passage 1 to 35 in passage 7 (data not shown), indicating that the transfected plasmid will likely be lost within the next several passages. This is not unexpected, as the transfected plasmid is foreign to the trophozoites and would either be viewed as unnecessary or detrimental to the survival of the amoeba.
There is a fundamental lack of knowledge regarding the CERE of the Naegleria. The majority of CERE sequences in GenBank are partial sequences, with the main focus being on the rDNA and the internal transcribed spacer (ITS) regions, which are used for identifying genus (ITS1) and species (ITS2)1,26,27. While the sequence of the rDNA subunits is highly conserved between Naegleria sp., the NRS of the Naegleria sp. varies greatly, both in size and sequence, ranging from approximately 5.5 kbp to 10 kbp1,15,16,17,18,19,20. The function of the NRS in Naegleria is largely unexplored territory, but it is presumed to contain regulatory elements including, but not limited to, an origin of replication, a promoter, and a termination sequence17. Based on the complete CERE sequences in GenBank, a common feature of Naegleria CERE is the presence of repeat regions in the NRS that are A-T rich. The function of these regions is currently unknown.
The ability to transfect Naegleria trophozoites permits the study of several aspects of CERE NRS biology, particularly the dynamics and requirements of CERE replication. In Escherichia coli, G-quadruplexes have been identified in the promoter regions of some genes28. G-quadruplex structures have also been identified in the promoters of a wide variety of eukaryotes, including mice, rats, humans, and non-human primates29. In silico analysis of several different full-length CERE sequences demonstrates that multiple areas of the NRS are predicted to form G-quadruplex structures. One area of predicted G quadruplex structures in the NRS of several Naegleria sp. is upstream of the beginning of the 18S gene. The ability to transfect trophozoites would permit exploration of identifying the promoter region of the rDNA in the CERE of Naegleria by deleting/mutating sequences upstream of the rDNA. Likewise, similar studies could be performed to identify sequences that terminate rDNA transcription.
The retention of the full-length CERE in the trophozoites for a number of passages will allow for studies that focus on identifying the minimal area of the NRS needed for replication of the CERE. While a region of the CERE has been identified as the putative origin of replication20, it is unknown whether secondary structures outside of the region are required for CERE replication or whether the region could be significantly truncated and the ori remain functional. The repetitive elements in the NRS are found in all Naegleria sp. sequenced to date15,16,17,18,19,20. The purpose of these sequences is currently unknown. Whether they exist as a regulatory element, or if they are deleted, will the CERE replicate in the trophozoites is still unknown. The repetitive sequences are species-specific in Naegleria, but whether the sequences from one species can function in another is not known. In short, there are myriad questions regarding CERE biology that can now be addressed using the technique described herein.

The Naegleria genus contains over 45 species, although it is unlikely that all members of the species have been identified1. Naegleria can exist in different forms: as trophozoites (amoebae), as flagellates, or, when resources are severely limited, as cysts1,2,3,4. The Naegleria genus is recognized for its one particularly dangerous species, Naegleria fowleri, known as &#39;the brain-eating amoeba&#39; (reviewed in1,2,3,4,5,6,7), which is the cause of the almost universally fatal primary amoebic meningoencephalitis.
Naegleria encode their rDNA on the CERE located in the nucleolus. Complete sequencing of three Naegleria species&#39; genomes confirms the absence of rDNA in the nuclear genome8,9,10,11. Based on the limited full-length CERE sequences, the CERE ranges from approximately 10 kbp to 18 kbp in length. CERE of each species of Naegleria carry a single rDNA cistron (containing the 5.8, 18, and 28S ribosomal DNA) on each of approximately 4,000 CERE per cell12,13,14. Other than rDNA, each CERE has a large non-rDNA sequence (NRS). CERE sizes vary between species; the differences are mainly due to the varying length of the NRS, as the rDNA sequences are highly conserved across the genus1,15,16,17,18,19,20. The mapping of a single origin of DNA replication within the N. gruberi CERE NRS21 provides strong support for the hypothesis that Naegleria CERE replicates independently of the nuclear genome.
N. gruberi is a non-pathogenic amoeba often used to study Naegleria biology. We developed a methodology for transforming N. gruberi trophozoites with a CERE clone from the same species to test the hypothesis that Naegleria amoebae tolerate and independently replicate CERE within the trophozoites. This was accomplished by transforming N. gruberi with a full-length clone of N. gruberi CERE into trophozoites and following the fates of the donor CERE clone by polymerase chain reaction (PCR). A general overview of the protocol is outlined in Figure 1. The data presented herein demonstrate that the donor clone can be detected through at least seven passages in tissue culture, as well as be maintained through encystment and excystment. These studies form the basis for a means to dissect how CERE replicates, as well as explore its use as a vector to transfect Naegleria.

<table><tbody><tr><td>Agarose</td><td>Bio Rad</td><td>161-3102</td><td></td></tr><tr><td>Ammonium Acetate</td><td>Sigma Aldrich</td><td>A-7330</td><td></td></tr><tr><td>Calcium Chloride</td><td>Sigma Aldrich</td><td>C-4901</td><td></td></tr><tr><td>Crushed ice</td><td></td><td></td><td></td></tr><tr><td>Culture Flasks, T-75</td><td>Thermo Scientific</td><td>130190</td><td></td></tr><tr><td>Culture Plate, 6-well</td><td>Corning</td><td>3506</td><td></td></tr><tr><td>DNAse</td><td>Sigma Aldrich</td><td>D-4527</td><td></td></tr><tr><td>EDTA, 0.5 M</td><td>Affymetrix</td><td>15694</td><td></td></tr><tr><td>Electropheresis Gel Apparatus</td><td>Amersham Biosciences</td><td>80-6052-45</td><td></td></tr><tr><td>Eppendorf Tubes, 1.5 mL</td><td>Fisher Scientific</td><td>05-408-129</td><td></td></tr><tr><td>Eppendorf Tubes, 2 mL</td><td>Fisher Scientific</td><td>05-408-138</td><td></td></tr><tr><td>Ethanol, 100%</td><td>Decon Laboratories</td><td>2716</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sigma Aldrich</td><td>E-8751</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco</td><td>26140</td><td></td></tr><tr><td>Folic Acid</td><td>Sigma Aldrich</td><td>F7876-25G</td><td></td></tr><tr><td>GeneRuler 1 kb Plus Ladder</td><td>Thermo Scientific</td><td>SM1331</td><td></td></tr><tr><td>Glacial Acetic Acid</td><td>Fisher Scientific</td><td>UN2789</td><td></td></tr><tr><td>GoTaq Green PCR Master Mix</td><td>Promega</td><td>M7122</td><td></td></tr><tr><td>Heating Block</td><td>Thermo Scientific</td><td>88871001</td><td></td></tr><tr><td>Hemacytometer</td><td>Hausser Scientific</td><td>1483</td><td></td></tr><tr><td>Hemin</td><td>Sigma Aldrich</td><td>51280</td><td></td></tr><tr><td>Iron Chloride</td><td>Sigma Aldrich</td><td>372870-256</td><td></td></tr><tr><td>Ligase</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Magneisum Chloride</td><td>Fisher Scientific</td><td>M33-500</td><td></td></tr><tr><td>Microfuge</td><td>Thermo Scientific</td><td>MySpin 12</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>TMS</td><td></td></tr><tr><td>&lt;em&gt;N. gruberi&lt;/em&gt;</td><td>ATCC</td><td>30224</td><td></td></tr><tr><td>Nucleic Acid</td><td>Chem Impex Int&amp;rsquo;l</td><td>#01625</td><td></td></tr><tr><td>Peptone</td><td>Gibco</td><td>211677</td><td></td></tr><tr><td>pGEM</td><td>Promega</td><td>P2251</td><td></td></tr><tr><td>Potassium Phosphate</td><td>Sigma Aldrich</td><td>P0662-500G</td><td></td></tr><tr><td>PowerPac HC Electropharesis Power Supply Unit</td><td>Bio Rad</td><td>1645052</td><td></td></tr><tr><td>Sodium Chloride</td><td>MCB Reagents</td><td>SX0420</td><td></td></tr><tr><td>Sodium Phosphate, dibasic</td><td>Sigma Aldrich</td><td>S2554</td><td></td></tr><tr><td>Tabletop Centrifuge</td><td>eppendorf</td><td>5415R</td><td></td></tr><tr><td>Tris, base</td><td>Sigma Aldrich</td><td>T1503-1KG</td><td></td></tr><tr><td>Trypan Blue, 0.4%</td><td>Gibco</td><td>15250-061</td><td></td></tr><tr><td>ViaFect Reagent</td><td>Promega</td><td>E4981</td><td></td></tr><tr><td>Weigh Scale</td><td>Denver Instruments</td><td>APX-60</td><td></td></tr><tr><td>Yeast Extract</td><td>Gibco</td><td>212750</td><td></td></tr></tbody></table>

transfection of a molecular clone of naegleria gruberi rdna into n. gruberi trophozoites

All ribosomal genes of Naegleria trophozoites are maintained in a closed circular extrachromosomal ribosomal DNA (rDNA) containing element (CERE). While little is known about the CERE, a complete genome sequence analysis of three Naegleria species clearly demonstrates that there are no rDNA cistrons in the nuclear genome. Furthermore, a single DNA origin of replication has been mapped in the N. gruberi CERE, supporting the hypothesis that CERE replicates independently of the nuclear genome. This CERE characteristic suggests that it may be possible to use engineered CERE to introduce foreign proteins into Naegleria trophozoites. As the first step in exploring the use of a CERE as a vector in Naegleria, we developed a protocol to transfect N. gruberi with a molecular clone of the N. gruberi CERE cloned into pGEM7zf+ (pGRUB). Following transfection, pGRUB was readily detected in N. gruberi trophozoites for at least seven passages, as well as through encystment and excystment. As a control, trophozoites were transfected with the backbone vector, pGEM7zf+, without the N. gruberi sequences (pGEM). pGEM was not detected after the first passage following transfection into N. gruberi, indicating its inability to replicate in a eukaryotic organism. These studies describe a transfection protocol for Naegleria trophozoites and demonstrate that the bacterial plasmid sequence in pGRUB does not inhibit successful transfection and replication of the transfected CERE clone. Furthermore, this transfection protocol will be critical in understanding the minimal sequence of the CERE that drives its replication in trophozoites, as well as identifying regulatory regions in the non-ribosomal sequence (NRS).

PCR of trophozoites that have been transfected with pGRUB demonstrates that the transfected CERE is detected through at least seven passages of the trophozoites, as well as encystment and excystment (Figure 4). The primers used in the PCR anneal to both the pGEM vector and the CERE sequence, thereby ensuring that the PCR does not detect native CERE. PCR following transfection of pGEM into trophozoites indicated that pGEM was negative (Figure 4), indicating that the empty plasmid was not retained by the amoebas. Figure 4 demonstrates that pGEM was lost by the first passage - subsequent passages, encystment, and excystment were all negative.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66726/66726fig01v3.jpg" /> 
Figure 1: Flow chart of the transfection procedure. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66726/66726fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66726/66726fig02.jpg" /> 
Figure 2: N. gruberi (NEG-M strain) trophozoites in culture. (A) Under standard culture conditions at 25&#160;&#176;C, N. gruberi trophozoites are ameboid in morphology and adherent to the culture flasks/plates. The arrow indicates a pseudopod that is used to propel the trophozoite directionally. (B) Following incubation of the N. gruberi culture on ice, trophozoites become round in morphology and non-adherent. (C) Following incubation in encystment media for 24-48 h, N. gruberi trophozoites become encysted. Scale bars: 10 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66726/66726fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66726/66726fig03.jpg" /> 
Figure 3: pGRUB construct used to transfect N. gruberi (NEG-M). The full-length CERE of N. gruberi (EBM strain, 14,007 bp; red) was cloned into pGEM7Zf(+) (2,997 bp; green), resulting in a construct of 17,004 bp. Arrows on each plasmid indicate the location of the PCR primers. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66726/66726fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/66726/66726fig04.jpg" /> 
Figure 4: PCR results detecting transfected pGRUB and pGEM into N. gruberi trophozoites. PCR demonstrates that pGRUB is detected in transfected trophozoites through at least seven passages, encystment (En), and excystment (Ex). pGEM is lost after the first passage of the trophozoites. P1 = passage 1, P7 = passage 7. Negative controls (neg) received no DNA in the PCR, while positive controls (pos) are either pGRUB or pGEM input into the PCR. Expected product sizes are 656 bp (pGRUB) and 337 bp (pGEM). Figures on the left of panel A indicate the size of the brightest bands of the DNA ladder. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66726/66726fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer Name</td>
			<td colspan="2">Sequence - 5&#39;-&#62;3&#39;</td>
			<td>Tm</td>
			<td>Product Size</td>
		</tr>
		<tr>
			<td>pGEM-forward</td>
			<td colspan="2">CTCTTCGCTATTACGCCAGC</td>
			<td>54</td>
			<td>337 bp</td>
		</tr>
		<tr>
			<td>pGEM-reverse</td>
			<td colspan="2">TTGTGTGGAATTGTGAGCGG</td>
			<td></td>
			<td>337 bp</td>
		</tr>
		<tr>
			<td>pGRUB-forward</td>
			<td colspan="2">AGCCCCCGATTTAGAGCTTG</td>
			<td>60.5</td>
			<td>656 bp</td>
		</tr>
		<tr>
			<td>pGRUB-reverse</td>
			<td colspan="2">TCGGCTAGAAATGAAGTGAGGAC</td>
			<td></td>
			<td>656 bp</td>
		</tr>
	</tbody>
</table>
Table 1: PCR primers and conditions used in these studies.
Supplementary File 1: The sequence of the 17,004 base pair pGRUB construct. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66726/Supplementary File 1.zip" target="_blank">Please click here to download this File.</a>

Author Spotlight: Understanding the Propagation of Closed Circular Extrachromosomal rDNA Containing Element (CERE) in Naegleria gruberi

This protocol describes a methodology to transfect Naegleria gruberi trophozoites with a construct that is maintained throughout passaging trophozoites in vitro, as well as through encystment and excystment.

Transfection of a Molecular Clone of Naegleria gruberi rDNA into N. gruberi Trophozoites

All ribosomal genes of Naegleria trophozoites are maintained in a closed circular extrachromosomal ribosomal DNA (rDNA) containing element (CERE). While ...

transfection-molecular-clone-naegleria-gruberi-rdna-into-n-gruberi

Nanyang Technological University

Research

JoVE Journal

Biology

499 Views.  Creighton University School of Medicine. Ons onderzoek vertegenwoordigt de eerste stap om te begrijpen welke sequentie zich bevindt in het gesloten cirkelvormige extrachromosomale ribosomale DNA-bevattende element, of CERE, die van cruciaal belang is om replicatie van de CERE mogelijk te maken. Evenals het begrijpen van de DNA-replicatiemachinerie van de CERE. Dit protocol pakt lacunes aan in het begrip hoe de CERE een naegleria gruberi vermeerdert en welke componenten van de CERE nodig zijn voor ef...

Video: Auteur in de schijnwerpers: inzicht in de voortplanting van gesloten circulair extrachromosomaal rDNA-bevattend element (CERE) in Naegleria gruberi

Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells

Telomeres are transcribed, giving rise to telomeric repeat-containing long noncoding RNAs (TERRA), which have been proposed to play important roles in telomere biology, including heterochromatin formation and telomere length homeostasis. Recent findings revealed that TERRA molecules also interact with internal chromosomal regions to regulate gene expression in mouse embryonic stem (ES) cells. In line with this evidence, RNA fluorescence in situ hybridization (RNA-FISH) analyses have shown that only a subset of TERRA transcripts localize at chromosome ends. A better understanding of the dynamics of TERRA molecules will help define their function and mechanisms of action. Here, we describe a method to label and visualize single-telomere TERRA transcripts in cancer cells using the MS2-GFP system. To this aim, we present a protocol to generate stable clones, using the AGS human stomach cancer cell line, containing MS2 sequences integrated at a single subtelomere. Transcription of TERRA from the MS2-tagged telomere results in the expression of MS2-tagged TERRA molecules that are visualized by live-cell fluorescence microscopy upon co-expression of a MS2 RNA-binding protein fused to GFP (MS2-GFP). This approach enables researchers to study the dynamics of single-telomere TERRA molecules in cancer cells, and it can be applied to other cell lines.

Here, we present a protocol to generate cancer cell clones containing a MS2 sequence tag at a single subtelomere. This approach, relying on the MS2-GFP system, enables visualization of the endogenous transcripts of telomeric repeat-containing RNA (TERRA) expressed from a single telomere in living cells.

Telomeres are transcribed, giving rise to telomeric repeat-containing long noncoding RNAs (TERRA), which have been proposed to play important roles in ...

Genetics

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGF&beta; and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown.
Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.

Adenoviral gene transfer into naive CD4 T cells with transgenic expression of the Coxsackie adenovirus receptor enables the molecular analysis of regulatory T cell differentiation in vitro.

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 ...

Immunology and Infection

Genetic Manipulation in &Delta;ku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene function and phenotype(s). The development of mutant strains with targeted gene deletions, targeted mutations, complemented gene function, and/or tagged genes provides powerful strategies to address gene function, particularly if these genetic manipulations can be efficiently targeted to the gene locus of interest using integration mediated by double cross over homologous recombination.
Due to very high rates of nonhomologous recombination, functional genomic analysis of Toxoplasma gondii has been previously limited by the absence of efficient methods for targeting gene deletions and gene replacements to specific genetic loci. Recently, we abolished the major pathway of nonhomologous recombination in type I and type II strains of T. gondii by deleting the gene encoding the KU80 protein1,2. The &Delta;ku80 strains behave normally during tachyzoite (acute) and bradyzoite (chronic) stages in vitro and in vivo and exhibit essentially a 100% frequency of homologous recombination. The &Delta;ku80 strains make functional genomic studies feasible on the single gene as well as on the genome scale1-4.
Here, we report methods for using type I and type II &Delta;ku80&Delta;hxgprt strains to advance gene targeting approaches in T. gondii. We outline efficient methods for generating gene deletions, gene replacements, and tagged genes by targeted insertion or deletion of the hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) selectable marker. The described gene targeting protocol can be used in a variety of ways in &Delta;ku80 strains to advance functional analysis of the parasite genome and to develop single strains that carry multiple targeted genetic manipulations. The application of this genetic method and subsequent phenotypic assays will reveal fundamental and unique aspects of the biology of T. gondii and related significant human pathogens that cause malaria (Plasmodium sp.) and cryptosporidiosis (Cryptosporidium).

Here we report a method for using type I and type II &Delta;ku80 strains of Toxoplasma gondii to efficiently generate targeted gene deletions and gene replacements for functional genomic analysis.

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene ...

Transient Transduction of the Strobilated Forms of Echinococcus granulosus

Cystic echinococcosis or hydatid disease is one of the most important zoonotic parasitic diseases caused by Echinococcus granulosus, a small tapeworm harbored in the intestine of canines. There is an urgent need for applied genetic research to understand the mechanisms of pathogenesis and disease control and prevention. However, the lack of an effective gene evaluation system impedes direct interpretation of the functional genetics of cestode parasites, including the Echinococcus species. The present study demonstrates the potential of lentiviral gene transient transduction in the metacestode and strobilated forms of E. granulosus. Protoscoleces (PSCs) were isolated from hydatid cysts and transferred to specific biphasic culture media to develop into strobilated worms. The worms were transfected with harvested third-generation lentivirus, along with HEK293T cells as a transduction process control. A pronounced fluorescence was detected in the strobilated worms over 24 h and 48 h, indicating transient lentiviral transduction in E. granulosus. This work presents the first attempt at lentivirus-based transient transduction in tapeworms and demonstrates the promising outcomes with potential implications in experimental studies on flatworm biology.

Transient Transduction of the Strobilated Forms of Echinococcus granulosus

We describe a rapid transient transduction technique in different developmental stages of Echinococcus granulosus using third-generation lentiviral vectors.

Cystic echinococcosis or hydatid disease is one of the most important zoonotic parasitic diseases caused by Echinococcus granulosus, a small tapeworm ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. Transfection with siRNA and plasmid DNA is an efficient tool for studying their function, but transfection of macrophages is not a trivial matter. Although many different approaches for transfection of eukaryotic cells are available, only few allow reliable and efficient transfection of macrophages, but reduced cell vitality and severely altered cell behavior like diminished capability for differentiation or polarization are frequently observed. Therefore a transfection protocol is required that is capable of transferring siRNA and plasmid DNA into macrophages without causing serious side-effects thus allowing the investigation of the effect of the siRNA or plasmid in the context of normal cell behavior. The protocol presented here provides a method for reliably and efficiently transfecting human THP-1 macrophages and monocytes with high cell vitality, high transfection efficiency, and minimal effects on cell behavior. This approach is based on Nucleofection and the protocol has been optimized to maintain maximum capability for cell activation after transfection. The protocol is adequate for adherent cells after detachment as well as cells in suspension, and can be used for small to medium sample numbers. Thus, the method presented is useful for investigating gene regulatory effects during macrophage differentiation and polarization. Apart from presenting results characterizing macrophages transfected according to this protocol in comparison to an alternative chemical method, the impact of cell culture medium selection after transfection on cell behavior is also discussed. The presented data indicate the importance of validating the selection for different experimental settings.

This protocol presents an efficient and reliable method to transfect human THP-1 macrophages with siRNA or plasmid DNA by electroporation with high transfection efficiency while maintaining high cell vitality and full macrophage capacity for differentiation and polarization.

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Nucleofection of Rodent Neuroblasts to Study Neuroblast Migration In vitro

The subventricular zone (SVZ) located in the lateral wall of the lateral ventricles plays a fundamental role in adult neurogenesis. In this restricted area of the brain, neural stem cells proliferate and constantly generate neuroblasts that migrate tangentially in chains along the rostral migratory stream (RMS) to reach the olfactory bulb (OB). Once in the OB, neuroblasts switch to radial migration and then differentiate into mature neurons able to incorporate into the preexisting neuronal network. Proper neuroblast migration is a fundamental step in neurogenesis, ensuring the correct functional maturation of newborn neurons. Given the ability of SVZ-derived neuroblasts to target injured areas in the brain, investigating the intracellular mechanisms underlying their motility will not only enhance the understanding of neurogenesis but may also promote the development of neuroregenerative strategies.
This manuscript describes a detailed protocol for the transfection of primary rodent RMS postnatal neuroblasts and the analysis of their motility using a 3D in vitro migration assay recapitulating their mode of migration observed in vivo. Both rat and mouse neuroblasts can be quickly and efficiently transfected via nucleofection with either plasmid DNA, small hairpin (sh)RNA or short interfering (si)RNA oligos targeting genes of interest. To analyze migration, nucleofected cells are reaggregated in &#39;hanging drops&#39; and subsequently embedded in a three-dimensional matrix. Nucleofection per se does not significantly impair the migration of neuroblasts. Pharmacological treatment of nucleofected and reaggregated neuroblasts can also be performed to study the role of signaling pathways involved in neuroblast migration.

Nucleofection of Rodent Neuroblasts to Study Neuroblast Migration In vitro

Neuroblast migration is a crucial step in postnatal neurogenesis. The protocol described here can be used to investigate the role of candidate regulators of neuroblast migration by employing DNA/small hairpin RNA (shRNA) nucleofection and a 3D migration assay with neuroblasts isolated from the rodent postnatal rostral migratory stream.

The subventricular zone (SVZ) located in the lateral wall of the lateral ventricles plays a fundamental role in adult neurogenesis. In this restricted ...

Neuroscience

Assay to Measure Nucleocytoplasmic Transport in Real Time within Motor Neuron-like NSC-34 Cells

Nucleocytoplasmic transport refers to the import and export of large molecules from the cell nucleus. Recently, a number of studies have shown a connection between amyotrophic lateral sclerosis (ALS) and impairments in the nucleocytoplasmic pathway. ALS is a neurodegenerative disease affecting the motor neurons and resulting in paralysis and ultimately in death, within 2-5 years on average. Most cases of ALS are sporadic, lacking any apparent genetic linkage, but 10% are inherited in a dominant manner. Recently, hexanucleotide repeat expansions (HREs) in the chromosome 9 open reading frame 72 (C9orf72) gene were identified as a genetic cause of ALS and frontotemporal dementia (FTD). Importantly, different groups have recently proposed that these mutants affect nucleocytoplasmic transport. These studies have mostly shown the final outcome and manifestations caused by HREs on nucleocytoplasmic transport, but they do not demonstrate nuclear transport dysfunction in real time. As a result, only severe nucleocytoplasmic transport deficiency can be determined, mostly due to high overexpression or exogenous protein insertion. 
This protocol describes a new and very sensitive assay to evaluate and quantify nucleocytoplasmic transport dysfunction in real time. The rate of import of a NLS-NES-GFP protein (shuttle-GFP) can be quantified in real time using fluorescent microscopy. This is performed by using an exportin inhibitor, thus allowing the shuttle GFP only to enter the nucleus. To validate the assay, the C9orf72 HRE translated dipeptide repeats, poly(GR) and poly(PR), which have been previously shown to disrupt nucleocytoplasmic transport, were used. Using the described assay, a 50% decrease in the nuclear import rate was observed compared to the control. Using this system, minute changes in nucleocytoplasmic transport can be examined and the ability of different factors to rescue (even partially) a nucleocytoplasmic transport defect can be determined.

This protocol describes a method to sensitively measure the nucleocytoplasmic transport rate within motor neuron-like NSC-34 cells by quantifying the real-time change in the nuclear import of a NLS-NES-GFP protein.

Nucleocytoplasmic transport refers to the import and export of large molecules from the cell nucleus. Recently, a number of studies have shown a ...

Generating Genetically Modified Plasmodium berghei Sporozoites

Malaria is a deadly disease caused by the parasite Plasmodium and is transmitted through the bite of female Anopheles mosquitoes. The sporozoite stage of Plasmodium deposited by mosquitoes in the skin of vertebrate hosts undergoes a phase of mandatory development in the liver before initiating clinical malaria. We know little about the biology of Plasmodium development in the liver; access to the sporozoite stage and the ability to genetically modify such sporozoites are critical tools for studying the nature of Plasmodium infection and the resulting immune response in the liver. Here, we present a comprehensive protocol for the generation of transgenic Plasmodium berghei sporozoites. We genetically modify blood-stage P. berghei and use this form to infect Anopheles mosquitoes when they take a blood meal. After the transgenic parasites undergo development in the mosquitoes, we isolate the sporozoite stage of the parasite from the mosquito salivary glands for in vivo and in vitro experimentation. We demonstrate the validity of the protocol by generating sporozoites of a novel strain of P. berghei expressing the green fluorescent protein (GFP) subunit 11 (GFP11), and show how it could be used to investigate the biology of liver-stage malaria.

Generating Genetically Modified Plasmodium berghei Sporozoites

Malaria is transmitted through inoculation of the sporozoite stage of Plasmodium by infected mosquitoes. Transgenic Plasmodium has allowed us to understand the biology of malaria better and has contributed directly to malaria vaccine development efforts. Here, we describe a streamlined methodology to generate transgenic Plasmodium berghei sporozoites.

Malaria is a deadly disease caused by the parasite Plasmodium and is transmitted through the bite of female Anopheles mosquitoes. The sporozoite stage of ...

Retroviral Transduction of Guide RNA for Gene Editing in Th17 Differentiation

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.
Conventional Th17 polarization methods typically involve obtaining na&#239;ve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate na&#239;ve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells ...

Nucleofection of Parasite Forms: An Electroporation-Based Transfection Method to Deliver Fluorescent Protein Encoding-Plasmids Into Sporozoite Nucleus

Source: Duan, C., et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/v/60552">Nucleofection and In Vivo Propagation of Chicken Eimeria Parasites.</a> J. Vis. Exp. (2020)
In this video, we describe nucleofection, an electroporation-based transfection procedure to deliver fluorescent reporter protein-encoding plasmid DNA into sporozoite form of the chicken Eimeria parasite.

Transfection of a Molecular Clone of Naegleria gruberi rDNA into N. gruberi Trophozoites

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video