This work is supported by the National Natural Science Foundation of China (82060341,81560304) and by the Academician Innovation Platform Scientific Research Project of Hainan Province (YSPTZX202134).

This study was approved by the Ethics Committee of Hainan Medical University. The tissue samples used in this study are not considered to be studies involving human subjects. These specimens were obtained for the purpose of forensic pathological diagnosis, and the rest were used for the extraction of diatom DNA in this experiment. Researchers cannot readily identify individuals to obtain informed consent from relevant stakeholders.
NOTE: To ensure the general applicability of the research method reported in this experiment, this experiment basically followed the operating instructions of the kit used, and only some steps were modified. The water samples used in this experiment were randomly taken from ponds near the laboratory (Supplementary Figure 1A). In this experiment, the lung tissue of the drowned body was confirmed as the research tissue to demonstrate the extraction protocol (Supplementary Figure 1B). In forensic practice, it is also sometimes necessary to use other organs and tissues of drowned bodies (such as liver, spleen, kidney, bone marrow, etc.) to extract diatoms DNA, which requires minor corresponding improvements to this experimental method, which will be explained in the corresponding section of the experiment. The lung tissue samples used in this experiment came from corpses that were clearly drowned in forensic cases. Morphological tests have been conducted to prove that the lung tissue contains diatoms (Supplementary&#160;Figure 2).
1. Pretreatment of samples
<ol>
	<li>Pretreatment of water samples
	<ol>
		<li>Take 10 mL of water sample into the centrifuge tube and centrifuge at 13,400 x g for 5 min. Carefully discard 9.8 mL of supernatant with a pipette gun, and transfer about 200 &#181;L of enriched diatom water sample remaining at the bottom into a 2 mL centrifuge tube. 
		NOTE: Pre-experiment can be carried out first, and the initial amount can be increased if a 10 mL water sample is not enough for enrichment.</li>
	</ol>
	</li>
	<li>Pretreatment of tissue samples
	<ol>
		<li>Take 0.5 g of the lung margin tissue from the drowned body, fully chop or grind the lung tissue until it becomes muddy. Preventing contamination of exogenous diatoms is the core of this step. Cut the tissue into pieces repeatedly using scissors.</li>
	</ol>
	</li>
</ol>
2. DNA extraction
NOTE: All centrifugation steps are completed at room temperature. Using a desktop centrifuge with a centrifugal force of 14,500 x g; a water bath (or metal bath) preheated to 70 &#176;C needs to be prepared before the experiment starts. All steps must strictly follow the principles of aseptic operation.
<ol>
	<li>Assembly of water samples and tissues 
	NOTE: Water sample and tissue diatom DNA extraction method are the same.
	<ol>
		<li>Add glass beads to a 2 mL centrifuge tube containing the pretreated water sample. Invert 10x-15x to mix well. The added glass beads are composed of large and small glass beads mixed in a mass ratio of 1:1. The diameter of large glass beads is 1.5-2.0 mm and of the small glass beads is 0.4-0.6 mm.</li>
		<li>Take 0.5 g of finely chopped tissue, add glass beads to a 2 mL centrifuge tube containing the tissue as described above. Invert 10x-15x to mix.</li>
	</ol>
	</li>
	<li>Add 40 &#181;L of proteinase K (20 mg/mL) to the tubes. Place at room temperature for 15 min, during this period, invert, and mix 10x every 3 min. 
	NOTE: If the tissue is not fully digested, the amount of proteinase K can be appropriately increased until the solution becomes clear.</li>
	<li>Add 200 &#181;L of binding buffer to the centrifuge tubes, immediately vortex, and mix for 4 min (oscillation mixing frequency: 3000 rpm). 
	NOTE: In this step, the shaking intensity and time should be strictly controlled to ensure sufficient mixing intensity and time.</li>
	<li>Put the centrifuge tubes in a 70 &#176;C water bath for 10 min, and the solution becomes clear.</li>
	<li>Add 100 &#181;L of isopropanol to the centrifuge tubes, vortex and mix for 15 s, flocculent precipitation may appear at this time. 
	NOTE: It is very important to mix well with appropriate strength in the above operation steps, but vigorous shaking should be avoided to prevent DNA shearing.</li>
	<li>Put the solution obtained in the previous step together with the flocculent precipitate into the adsorption column (the adsorption column is placed in the collection tube). The adsorption column length is 3.0 cm, the diameter is 1.0 cm, and the adsorption matrix is silicon matrix membrane.</li>
	<li>Centrifuge at 8,000 x g for 30 s, discard the waste liquid in the collection tube and put the adsorption column back into the collection tube.</li>
	<li>Add 500 &#181;L of inhibitor removal buffer to the adsorption column. Centrifuge at 13,400 x g for 30 s and discard the waste liquid in the collection tube.</li>
	<li>Add 700 &#181;L of washing buffer to the adsorption column. Centrifuge at 13,400 x g for 30 s and discard the waste liquid in the collection tube. 
	NOTE: Add the specified amount of absolute ethanol to the wash buffer bottle before first use.</li>
	<li>Add 500 &#181;L of wash buffer to the adsorption column. Centrifuge at 13,400 x g for 30 s and discard the waste liquid in the collection tube.</li>
	<li>Put the adsorption column back into the empty collection tube. Centrifuge at 14,500 x g for 2 min, and remove the washing buffer as much as possible, to avoid the residual ethanol in the washing buffer from inhibiting downstream reactions.</li>
	<li>Take out the adsorption column and put it into a clean centrifuge tube. Add 100 &#181;L of elution buffer to the middle part of the adsorption membrane.</li>
	<li>Place the adsorption column at room temperature for 3-5 min, and centrifuge at 13,400 x g for 1 min.</li>
	<li>Add the solution obtained in the previous step to the centrifugal adsorption column again. Place the centrifugal adsorption column at room temperature for 2 min, and centrifuge at 13,400 x g for 1 min. 
	NOTE: The elution buffer should be preheated in a 70 &#176;C water bath for about 10 min. The elution volume should not be less than 50 &#181;L; otherwise, the DNA yield will be reduced.</li>
	<li>Store the extracted diatom DNA at 2-8 &#176;C for future use. If the DNA solution is to be stored for a long time, store it at -20 &#176;C.</li>
</ol>
3. PCR test
NOTE: Since the content of diatoms in forensic samples is often low, the tissue sample extracts of the drowned bodies may also contain varying degrees of tissue and organs (such as the lungs in this experiment) with their own DNA. Therefore, direct detection of total DNA in DNA extracts does not reflect the situation of diatom DNA extraction. In this experiment, diatom-specific primers were selected, and PCR products were used to evaluate the diatom DNA extraction in the extract. The products can be observed and analyzed by agarose gel electrophoresis and can also be analyzed by real-time fluorescent quantitative PCR-melting curve, which has higher sensitivity.
<ol>
	<li>Add 2 &#181;L of the extracted DNA from water samples and tissues as the template. Choose one of the following two methods for inspection.</li>
	<li>Conventional PCR test
	<ol>
		<li>Use primers22 that can specifically amplify diatom 18S rDNA fragments. For details, see Table 1.</li>
		<li>Establish the PCR reaction system and amplification conditions according to the characteristics of the primers. For details, see Table 2.</li>
		<li>Run the products of PCR amplification on 2% agarose gel. Observe and analyze the imaging with a gel imager.</li>
	</ol>
	</li>
	<li>Fluorescent quantitative PCR test
	<ol>
		<li>Use the above primers that can specifically amplify diatom 18S rDNA fragments to prepare a real-time fluorescent quantitative PCR reaction system. For details, see Table 3.</li>
		<li>Perform PCR amplification and analyze the obtained amplification curve and Ct values. At the same time, set a program, melt the double-strands of the amplified products into single-strands gradually through fluorescent quantitative PCR-melting curve technology, and then analyze the obtained melting curves.</li>
	</ol>
	</li>
</ol>

Economical Diatom DNA Extraction Using a Modified Kit

<ol>
	<li>Liu, C., Cong, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+prospect+of+diagnosis+of+drowning+deaths+in+water.">Review and prospect of diagnosis of drowning deaths in water.</a> Fa Yi Xue Za Zhi. 38 (1), 3-13 (2022).</li><li>Frisoni, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forensic+diagnosis+of+freshwater+or+saltwater+drowning+using+the+marker+aquaporin+5:+An+immunohistochemical+study.">Forensic diagnosis of freshwater or saltwater drowning using the marker aquaporin 5: An immunohistochemical study.</a> Medicina (Kaunas). 58 (10), 1458 (2022).</li><li>Mann, D. G., Vanormelingen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+inordinate+fondness?+The+number,+distributions,+and+origins+of+diatom+species.">An inordinate fondness? The number, distributions, and origins of diatom species.</a> J Eukaryot Microbiol. 60 (4), 414-420 (2013).</li><li>Pfister, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terrestrial+diatoms+as+tracers+in+catchment+hydrology:+a+review.">Terrestrial diatoms as tracers in catchment hydrology: a review.</a> WIREs Water. 4, 1241 (2017).</li><li>Yu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+automated+diatom+detection+method+based+on+YOLOv5+framework+and+its+preliminary+study+for+taxonomy+recognition+in+the+forensic+diatom+test.">An improved automated diatom detection method based on YOLOv5 framework and its preliminary study for taxonomy recognition in the forensic diatom test.</a> Front Microbiol. 13, 963059 (2022).</li><li>Zhang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+length+and+width+of+diatoms+in+drowning+cases+as+the+evidence+of+diatoms+penetrating+the+alveoli-capillary+barrier.">The length and width of diatoms in drowning cases as the evidence of diatoms penetrating the alveoli-capillary barrier.</a> Int J Legal Med. 134 (3), 1037-1042 (2020).</li><li>Kihara, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+water+injection+into+lungs+using+an+animal+model:+Verification+of+the+diatom+concentration+test+to+diagnose+drowning.">Experimental water injection into lungs using an animal model: Verification of the diatom concentration test to diagnose drowning.</a> Forensic Sci Int. 327, 110983 (2021).</li><li>Shen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+false-positive+results+of+diatom+test+in+the+diagnosis+of+drowning-would+not+be+an+impediment.">Analysis of false-positive results of diatom test in the diagnosis of drowning-would not be an impediment.</a> Int J Legal Med. 133 (6), 1819-1824 (2019).</li><li>Manoylov, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxonomic+identification+of+algae+(morphological+and+molecular):+species+concepts,+methodologies,+and+their+implications+for+ecological+bioassessment.">Taxonomic identification of algae (morphological and molecular): species concepts, methodologies, and their implications for ecological bioassessment.</a> J Phycol. 50 (3), 409-424 (2014).</li><li>Uchiyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+molecular+approach+to+help+conclude+drowning+as+a+cause+of+death:+simultaneous+detection+of+eight+bacterioplankton+species+using+real-time+PCR+assays+with+TaqMan+probes.">A new molecular approach to help conclude drowning as a cause of death: simultaneous detection of eight bacterioplankton species using real-time PCR assays with TaqMan probes.</a> Forensic Sci Int. 222 (1-3), 11-26 (2012).</li><li>Kakizaki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+diverse+aquatic+microbes+in+blood+and+organs+of+drowning+victims:+first+metagenomic+approach+using+high-throughput+454-pyrosequencing.">Detection of diverse aquatic microbes in blood and organs of drowning victims: first metagenomic approach using high-throughput 454-pyrosequencing.</a> Forensic Sci Int. 220 (1-3), 135-146 (2012).</li><li>Cai, J., Wang, B., Chen, J. H., Deng, J. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+Progress+of+High-Throughput+Sequencing+Technology+in+Forensic+Diatom+Detection.">Application Progress of High-Throughput Sequencing Technology in Forensic Diatom Detection.</a> Fa Yi Xue Za Zhi. 38 (1), 20-30 (2022).</li><li>Xiao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+multiplex+PCR+system+for+drowning+diagnosis.">Development and application of a multiplex PCR system for drowning diagnosis.</a> Electrophoresis. 42 (11), 1270-1278 (2021).</li><li>Yarimizu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+absolute+quantification+method+for+ribosomal+RNA+gene+copy+numbers+per+eukaryotic+single+cell+by+digital+PCR.">Development of an absolute quantification method for ribosomal RNA gene copy numbers per eukaryotic single cell by digital PCR.</a> Harmful Algae. 103, 102008 (2021).</li><li>Dalgic, A. D., Atila, D., Karatas, A., Tezcaner, A., Keskin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diatom+shell+incorporated+PHBV/PCL-pullulan+co-electrospun+scaffold+for+bone+tissue+engineering.">Diatom shell incorporated PHBV/PCL-pullulan co-electrospun scaffold for bone tissue engineering.</a> Mater Sci Eng C Mater Biol Appl. 100, 735-746 (2019).</li><li>Malviya, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+global+diatom+distribution+and+diversity+in+the+world's+ocean.">Insights into global diatom distribution and diversity in the world's ocean.</a> Proc Natl Acad Sci U S A. 113 (11), 1516-1525 (2016).</li><li>Brunner, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analytical+studies+of+silica+biomineralization:+towards+an+understanding+of+silica+processing+by+diatoms.">Analytical studies of silica biomineralization: towards an understanding of silica processing by diatoms.</a> Appl Microbiol Biotechnol. 84 (4), 607-616 (2009).</li><li>Annunziata, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimised+method+for+intact+nuclei+isolation+from+diatoms.">An optimised method for intact nuclei isolation from diatoms.</a> Sci Rep. 11 (1), 1681 (2021).</li><li>Zhao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnostic+value+of+quantitative+assessment+of+diatom+test+for+drowning:+An+analysis+of+128+water-related+death+cases+using+microwave+digestion-vacuum+filtration-automated+scanning+electron+microscopy.">The diagnostic value of quantitative assessment of diatom test for drowning: An analysis of 128 water-related death cases using microwave digestion-vacuum filtration-automated scanning electron microscopy.</a> J Forensic Sci. 62 (6), 1638-1642 (2017).</li><li>Zhao, J., Liu, C., Hu, S., He, S., Lu, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microwave+digestion-vacuum+filtration-automated+scanning+electron+microscopy+as+a+sensitive+method+for+forensic+diatom+test.">Microwave digestion-vacuum filtration-automated scanning electron microscopy as a sensitive method for forensic diatom test.</a> Int J Legal Med. 127 (2), 459-463 (2013).</li><li>Cai, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+glass+bead-vortex+oscillation+method+for+DNA+extraction+from+diatom.">Improved glass bead-vortex oscillation method for DNA extraction from diatom.</a> Fa Yi Xue Za Zhi. 38 (1), 119-126 (2022).</li><li>Zimmermann, J., Jahn, R., Gemeinholzer, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Barcoding+diatoms:+evaluation+of+the+V4+subregion+on+the+18S+rRNA+gene,+including+new+primers+and+protocols.">Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols.</a> Org Divers Evol. 11 (3), 173-192 (2011).</li><li>Vinayak, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chloroplast+gene+markers+detect+diatom+DNA+in+a+drowned+mice+establishing+drowning+as+a+cause+of+death.">Chloroplast gene markers detect diatom DNA in a drowned mice establishing drowning as a cause of death.</a> Electrophoresis. , (2020).</li><li>Plante, C. J., Hill-Spanik, K., Cook, M., Graham, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+and+Spatial+Influences+on+Biogeography+and+Community+Structure+of+Saltmarsh+Benthic+Diatoms.">Environmental and Spatial Influences on Biogeography and Community Structure of Saltmarsh Benthic Diatoms.</a> Estuaries and Coasts. 44, 147-161 (2021).</li><li>Heid, C. A., Stevens, J., Livak, K. J., Williams, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real+time+quantitative+PCR.">Real time quantitative PCR.</a> Genome Res. 6 (10), 986-994 (1996).</li><li>Ben Amor, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+novel+TaqMan+qPCR+assay+for+rapid+detection+and+quantification+of+Gymnodinium+catenatum+for+application+to+harmful+algal+bloom+monitoring+in+coastal+areas+of+Tunisia.">Development of a novel TaqMan qPCR assay for rapid detection and quantification of Gymnodinium catenatum for application to harmful algal bloom monitoring in coastal areas of Tunisia.</a> Environ Sci Pollut Res Int. 29 (42), 63953-63963 (2022).</li><li>Doddaraju, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reliable+and+early+diagnosis+of+bacterial+blight+in+pomegranate+caused+by+Xanthomonas+axonopodis+pv.+punicae+using+sensitive+PCR+techniques.">Reliable and early diagnosis of bacterial blight in pomegranate caused by Xanthomonas axonopodis pv. punicae using sensitive PCR techniques.</a> Sci Rep. 9 (1), 10097 (2019).</li><li>Lunetta, P., Miettinen, A., Spilling, K., Sajantila, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=False-positive+diatom+test:+a+real+challenge?+A+post-mortem+study+using+standardized+protocols.">False-positive diatom test: a real challenge? A post-mortem study using standardized protocols.</a> Leg Med (Tokyo). 15 (5), 229-234 (2013).</li><li>Marquesda Silva, J., Cruz, S., Cartaxana, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inorganic+carbon+availability+in+benthic+diatom+communities:+photosynthesis+and+migration.">Inorganic carbon availability in benthic diatom communities: photosynthesis and migration.</a> Philos Trans R Soc Lond B Biol Sci. 372 (1728), 20160398 (2017).</li><li>Yu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+enzyme+digestion+time+on+the+detection+of+diatom+species.">The effect of enzyme digestion time on the detection of diatom species.</a> Pak J Pharm Sci. 27 (3 Suppl), 691-694 (2014).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diatom+DNA+barcodes+for+forensic+discrimination+of+drowning+incidents.">Diatom DNA barcodes for forensic discrimination of drowning incidents.</a> FEMS Microbiol Lett. 367 (17), 145 (2020).</li><li>Mizushima, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+novel+heart-specific+RING+finger+protein+207+is+involved+in+energy+metabolism+in+cardiomyocytes.">The novel heart-specific RING finger protein 207 is involved in energy metabolism in cardiomyocytes.</a> J Mol Cell Cardiol. 100, 43-53 (2016).</li><li>Zimmermann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxonomic+reference+libraries+for+environmental+barcoding:+a+best+practice+example+from+diatom+research.">Taxonomic reference libraries for environmental barcoding: a best practice example from diatom research.</a> PLoS One. 9 (9), 108793 (2014).</li></ol>

The authors declare that they have no competing financial interests.

Diatom cells are protected by hard siliceous cell walls17, and this structure must be destroyed to extract diatom DNA. Ordinary kits do not easily destroy the siliceous shell of diatoms; thus it is difficult to successfully extract diatom DNA21. Our laboratory improved the most commonly used blood DNA extraction kit, adding glass beads of different diameters and different mass ratio in the process of diatom extraction. Vortex oscillation is carried out at the same time, which can fully break the diatom shell and improve the diatom DNA extraction effect. As shown in the previous report21, the diameter of glass beads, oscillation intensity and time would directly affect the quality of DNA extraction. The vortex oscillation time should not be too long (no more than 10 min). If the time is too long, the DNA will break due to excessive vibration. At the same time, the time should not be too short. If the time is too short (not less than 2 min), the diatom shell will not be completely removed, which will make the DNA extraction inefficient. While selecting glass beads choose beads with different circumferential diameters, the large glass beads ensure the collision strength, and the small glass beads ensure that there is no dead collision between the glass beads during the collision fragmentation process, which improves the efficiency of shell breaking.
To extract diatom DNA from samples, it is generally necessary to enrich diatoms. This process will have a great impact on the extraction of diatom DNA. The purpose of enrichment is to increase the concentration of diatom in samples so that the concentration of diatom DNA extracted can be in detectable range; for the next-step applications such as real-time fluorescent quantitative PCR and high-throughput sequencing.
Since diatoms are widely distributed in nature4, preventing laboratory contamination is a top priority28. Contamination during DNA extraction process will lead to deviations from the actual results and loss of use value. Therefore, always pay attention to the principle of aseptic operation when extracting diatom DNA and take all possible measures to reduce and avoid contamination of exogenous diatoms. When the tissue is extracted from the dead body, measures should be taken to prevent it from being contaminated by exogenous diatoms. After the tissue is extracted, it should be stored in a container or sample bag free of diatom contamination. The tissue should not be treated with formaldehyde. The equipment for extracting and processing tissues should be washed 2-3 times with distilled water repeatedly, and then sterilized by ultraviolet light or high temperature to ensure that there is no contamination of diatoms from other sources. The tissue before the test should be cut off from the superficial tissue with a diatom-free instrument, and then the instrument should be replaced to pick out the lower tissue for examination. At the same time, standardizing the operation process can also effectively avoid the problem of laboratory contamination.
Since diatoms are the food of many aquatic organisms, they will be lost during long-term storage29. Diatoms can also grow and reproduce under light conditions. Therefore, the DNA extraction step should be initiated as soon as possible after sampling and quick sample processing should be done to prevent loss of diatoms in the sample. If the DNA extraction cannot be carried out immediately, all samples should be frozen and kept in the dark to prevent the reduction of diatoms as much as possible.
Our research selected a common and cheap blood DNA extraction kit based on the proteinase K digestion method, which has been improved to extract diatom DNA from water samples and tissues with good results30. The tissue is sufficiently cut to be in full contact with proteinase K and the tissue gets fully digested. The possible principle of successful extraction is as follows: during the shaking step, the hard shell of diatom is repeatedly impacted and fragmented between fast-moving glass beads, exposing the cell membrane; the configuration of glass beads of different sizes can fill the gap between the collision of single size glass beads, so as to cover the collision contact surface as fully as possible; after losing the silicon shell, proteinase K helps to release DNA from the diatom. Compared with the currently used soil DNA extraction kit, the improved blood DNA extraction kit can meet the requirements of diatom DNA extraction, which is more economical and easier to obtain. It not only facilitates the use of forensic diatom inspection, but is suitable for application to other diatom research-related disciplines and can also be used for other plankton DNA extraction. When extracting diatom DNA from water samples, the amount of proteinase K used needs to be adjusted according to the number of plankton in the water. The amount of proteinase K can be increased or decreased based on preliminary experiments. When extracting diatom DNA from tissues, different organ tissue types, tissue contamination, and other factors will affect the amount of proteinase K required for digestion. In the experiment, the proteinase K in the kit should be stored at -20 &#176;C after use, otherwise, the inactivation of proteinase K will affect the extraction process. 
In conclusion, diatom DNA extraction should be performed as soon as possible after sampling and sample processing, otherwise stored at -20 &#176;C for preservation. Sample handling, storage, and the entire extraction process should be done carefully to prevent contamination by exogenous diatoms. Otherwise, it cannot be assessed that the extracted diatom DNA was in the sample or exogenous contamination. When using proteinase K to digest tissue, its dosage may be a problem. Insufficient tissue digestion can increase the amount of proteinase K. Therefore, it is important to shear the tissue adequately. Sufficient digestion of the tissue also prevents the tissue debris from clogging the plasma membrane inside the adsorption column. After the membrane is blocked, it is not possible to use the pipette tip to pick out the blockage or to centrifuge repeatedly, which will damage the membrane. The final DNA solution contains many impurities, which will affect the detection of diatom DNA. Oscillation intensity and time are also key issues. The first vortex oscillation time is controlled at 4-5 min, and the oscillation frequency is controlled at 3000 rpm, otherwise, the DNA extraction will be affected. If the electrophoretic bands are not clear after PCR, it may be necessary to further increase the amount of DNA template. The DNA extracted in this study is a mixture of DNA, including diatom DNA and DNA from other species, so the concentration of diatom DNA cannot be determined. Therefore, it is not suitable for applications requiring high purity of DNA templates.
Studies have shown that different diatom species can be amplified by different primers31,32. In this study, only the diatom-specific primers D512 and D978 on the diatom 18S rDNA were used to test whether the diatom DNA was successfully extracted, which could not cover all diatom species22,33. In addition, since the length of the amplification product fragment of the pair of primers is 390-410 bp, the improved method selects all fragment sizes of diatom DNA to test whether there is an impact on the experimental parameters, which needs further study. Subsequent studies will also use primers of different regions and different amplification lengths to explore the effect of extraction.
Compared with the traditional diatom DNA extraction method, this method has the main advantages of low-cost and large-scale diatom DNA extraction. It can complement the advantages of diatom morphological methods and can meet the needs of drowning diagnosis in primary forensic laboratories. At the same time, it also expands the selection range of diatom DNA extraction kits and has a good application prospect. In future, this method will be not only limited to the extraction of diatom DNA but be used for the extraction of DNA from other algae.

In forensic practice, determining whether a corpse found in the water drowning or was thrown into the water after death is essential for the proper resolution of the case1. It is also one of the difficult issues that need to be solved urgently in forensic practice2. Diatoms are abundant in the natural environment (especially in water)3,4. In the process of drowning, due to hypoxia and stress response, people will have intense breathing movements and inhale a large amount of drowning liquid. Therefore, the diatoms in the water enter the lung with the drowning liquid, and some diatoms can enter the blood circulation through the alveolar-capillary barrier and spread to internal organs with the blood flow5,6. The detection of diatoms in internal tissues and organs such as lung, liver, and bone marrow is a strong evidence of drowning before death7,8. Currently, forensic diatom testing is mainly based on morphological testing methods. After a series of pre-digestion of the tissue, the morphological qualitative and quantitative estimations of undigested diatoms are carried out under the microscope. During this period, dangerous and environmentally unfriendly reagents such as nitric acid need to be used. This process is time-consuming and requires researchers to have solid taxonomic expertise and extensive experience. These all bring certain challenges to the forensic staff9. Diatom DNA testing technology is a new technology for diatom testing developed in recent years10,11,12. This technology realizes the species identification of diatoms by analyzing the specific DNA sequence composition of diatoms13,14. PCR technology and sequencing technology are commonly used technical methods, but their basis is the successful extraction of DNA from diatoms. However, diatoms have a special structure different from other organisms, making their DNA extraction techniques also different.
The cell wall of diatom has a high degree of silicification, and its main component is silicon dioxide15,16,17. The siliceous cell wall is very hard, and it must be destroyed before extract the DNA. Ordinary DNA extraction kits are often difficult to use directly for the extraction of diatom DNA because they cannot destroy the siliceous shell of diatoms18. Therefore, destroying the siliceous shell of diatoms is one of the key technical problems to be solved in extracting diatom DNA.
At the same time, since the number of diatoms contained in forensic research samples, whether water samples or organs and tissues of drowned bodies, is often limited, it is necessary to enrich diatoms. The essence of enrichment is the separation of substances. While trying to gather diatoms together, minimize the content of other material components (interfering components). In forensic work, laboratories often use centrifugation or membrane filtration enrichment methods to separate diatom cells19. However, since vacuum pumping equipment is not widely used, the membrane enrichment method is not often used in ordinary primary forensic laboratories. So, the centrifugation method is still commonly diatom enrichment in forensic laboratories20.
DNA extraction from diatoms is currently used primarily in forensic practice, and there are significant limitations to its application. At present, there are few diatom DNA extraction kits used in forensic science on the market and they are generally expensive21. This article provides an improved diatom DNA extraction method, making diatom DNA extraction simple, convenient and cost effective. This increases the application of subsequent molecular biology testing of diatoms and can better solve problems related to drowning in forensic medicine through diatom testing. This method breaks the siliceous cell walls of diatoms by adding glass beads and setting an appropriate time for vortex. In this way, the proteinase K and the binding solution rapidly lyse the cells and inactivate various enzymes in the cells. The genomic DNA is absorbed in the matrix membrane in the adsorption column and finally eluted by the elution buffer. Such an improved whole blood gene extraction kit improves the diatom DNA extraction effect of the blood kit in forensic examination materials, reduces the cost of diatom DNA extraction in forensic practice, and can be better applied to grassroot forensic research.

<table><tbody><tr><td>Binding Buffer</td><td>BioTeke</td><td>B010006022</td><td>rapidly lysing cells</td></tr><tr><td>ChemoHS qPCR Mix</td><td>Monad</td><td>00007547-120506</td><td>qPCR Mix</td></tr><tr><td>D2000 DNA ladder</td><td>Real-Times(Beijing) Biotechnology</td><td>RTM415</td><td>Measure the position of electrophoretic bands</td></tr><tr><td>D512</td><td>Taihe Biotechnology</td><td>TW21109196</td><td>forword primer</td></tr><tr><td>D978</td><td>Taihe Biotechnology</td><td>TW21109197</td><td>reverse primer</td></tr><tr><td>Elution buffer</td><td>BioTeke</td><td>B010006022</td><td>A low-salt elution buffer washes off the DNA</td></tr><tr><td>Glass bead</td><td>Yingxu Chemical Machinery(Shanghai)&amp;nbsp;</td><td>70181000</td><td>Special glass beads for dispersing and grinding</td></tr><tr><td>Import adsorption column</td><td>BioTeke</td><td>B2008006022</td><td>Adsorption column with silica matrix membrane</td></tr><tr><td>Inhibitor Removal Buffer</td><td>BioTeke</td><td>B010006022</td><td>Removal of Inhibitors in DNA Extraction</td></tr><tr><td>Isopropanol</td><td>BioTeke</td><td>B010006022</td><td>Precipitate or isolate DNA</td></tr><tr><td>MIX-30S Mini Mixer</td><td>Miulab</td><td>MUC881206</td><td>oscillatory action</td></tr><tr><td>Proteinase K</td><td>BioTeke</td><td>B010006022</td><td>Inactivation of intracellular nucleases and other proteins</td></tr><tr><td>Rotor-Gene Q 5plex HRM</td><td>Qiagen</td><td>R1116175</td><td>real-time fluorescence quantification PCR</td></tr><tr><td>Speed Micro-Centrifuge</td><td>Scilogex</td><td>9013001121</td><td>centrifuge</td></tr><tr><td>Tanon 3500R Gel Imager</td><td>Tanon</td><td>16T5553R-455</td><td>gel imaging</td></tr><tr><td>Taq Mix Pro</td><td>Monad</td><td>00007808-140534</td><td>PCR Mix</td></tr><tr><td>Thermo Cycler</td><td>Zhuhai Hema</td><td>VRB020A</td><td>ordinary PCR</td></tr><tr><td>Wash Buffer</td><td>BioTeke</td><td>B010006022</td><td>Remove impurities such as cell metabolites</td></tr></tbody></table>

extraction of diatom dna from water samples and tissues

Diatom testing is an essential auxiliary means in forensic practice to determine whether the corpse drowned in water and to infer the drowning location. Diatom testing is also an important research content in the field of the environment and plankton. The diatom molecular biology testing technology, which focuses on diatom DNA as the primary research object, is a new method of diatom testing. Diatom DNA extraction is the basis of diatom molecular testing. At present, the kits commonly used for diatom DNA extraction are expensive, which increases the cost of carrying out related research. Our laboratory improved the general whole blood genomic DNA rapid extraction kit and obtained a satisfactory diatom DNA extraction effect, thus providing an alternative economical and affordable DNA extraction solution based on glass beads for related research. The diatom DNA extracted using this protocol could satisfy many downstream applications, such as PCR and sequencing.

Since the DNA solution extracted by the currently used DNA extraction method contains all DNA components from different sources in the sample, the DNA obtained by this protocol was no exception. So, the DNA solution was not just a solution of diatom genomic DNA. The primers that can specifically amplify diatom 18S rDNA fragments were selected by consulting the literature22,23,24. The primers were verified by NCBI-Blast Primer, and the results showed that the forward primer D512 and reverse primer D978 of 18S rDNA were algae-specific primers and covered many diatom species. The amplification results did not show any human genes. They were used a reliable DNA biomarker for diatom testing, so they were selected for verification of the results of this experiment. Using the extracted DNA as a template for diatom-specific PCR amplification, the amplification product by agarose gel electrophoresis showed that water samples and tissues had diatom DNA bands, these electrophoresis bands were between 250- 500 bp (closer to 500 bp), in line with the primer target amplification product length size (390 -410 bp). This showed that the extraction protocol was successful in extracting diatom DNA (Figure 1A,B).
Real-time fluorescence quantitative PCR technology is a kind of gene testing technology with stringent specificity and high sensitivity. By adding fluorescent groups in the PCR reaction system, the accumulation of fluorescent signals can make the whole PCR process be monitored in real-time, and the sensitivity is high25,26. Products specifically amplified by conventional PCR can sometimes be difficult to observe in agarose gel electrophoresis due to the low content and other reasons27 (Figure 1C). Through the specific amplification of real-time fluorescent quantitative PCR, a typical amplification curve with four characteristic stages was obtained (Figure 2). At the same time, through the real-time fluorescent quantitative PCR-melting curve technology, the DNA double strands of the amplified product were melted into single strands at high temperature, the dye was freed from the double strands, and the fluorescence value decreased. By detecting the change in the fluorescence value, the melting curve was obtained (Figure 3). The obtained melting curves had characteristic peaks, and the peak value was around 85.5 &#176;C, which proved that there was a specific amplification of the target DNA, indicating that there was diatom DNA in the extracted DNA solution. The dye could also be directly added to the conventional PCR amplification product, and the melting curve could be obtained by real-time fluorescence quantitative PCR-melting curve technology to prove whether there was specific amplification. Therefore, when conventional PCR-agarose gel electrophoresis could not prove whether there was diatom DNA in the extracted DNA solution, the real-time fluorescent quantitative PCR technology with higher sensitivity could be selected for verification and evaluation. In this experiment, the real-time fluorescent quantitative PCR-melting curve technology was only used for qualitative analysis.
As shown in a previous report21, the traditional soil DNA extraction kit and the modified blood DNA extraction kit were basically the same for diatom DNA extraction from water samples and tissues. The cost difference of diatom DNA extraction was mainly the price difference of the two kits, and the cost of other consumables was basically the same. In this study, a simple improvement of the blood DNA extraction kit commonly used in molecular biology experiments could obtain better experimental results, which not only increased the scope for the researchers to select the test kit in research activities related to diatom DNA extraction but also reduced the cost of testing.
The improvement process of this protocol has been published21. By designing the combination of different mass ratios of glass beads and vortex oscillating time, the optimal DNA extraction conditions of the oscillation of glass beads were added into the conventional kit, therefore, the method could improve the extraction effect of diatom DNA in forensic samples, especially in tissue samples. The optimal combination of DNA extraction was obtained when the vortex oscillating frequency was 3000 rpm; the vortex oscillating time was 4 min, the mass ratio of large glass beads with diameter of 1.5-2.0 mm and small glass beads with diameter of 0.4-0.6 mm was 1:1. A comparison between the conventional method of the kit and the improved method was performed. It was shown that the used kit could meet the needs of amplifying diatom DNA, and the brightness of electrophoretic bands after amplification performed by the improved method in water samples was similar to the brightness of the conventional method, and the electrophoretic bands after amplification performed by the improved method in tissue samples were brighter (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65792/65792fig01.jpg" /> 
Figure 1: Electrophoresis results of DNA extracted using the protocol after PCR amplification. A total of 2 &#181;L of DNA extract was used as a DNA template for PCR-specific amplification. The PCR amplification products were electrophoresed on 1x TAE buffer solution through 2% agarose gel, and run at a constant voltage of 100V for 25-30 min. A D2000 DNA ladder was used for all gels. (A)&#160;The electrophoresis results of diatom DNA in water samples after PCR amplification, lane 1 is blank control; lanes 2-7 are water samples from different locations in the same area. (B)&#160;The results of electrophoresis after PCR amplification of diatom DNA in the tissue. Lanes 1-6 are the tissues excised from different positions of the same lung tissue; lane 7 is the blank control. (C)&#160;In an unsuccessful experiment,after diatom DNA amplification, the electrophoresis results did not show electrophoresis bands at the corresponding positions, indicating that there were no amplification products or too few amplification products. At this time, the electrophoresis results could not indicate whether there was diatom DNA in the proposed DNA solution, which needed to be carried out by more sensitive methods (such as a PCR-melting curve). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/65792fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65792/65792fig02.jpg" /> 
Figure 2: Diatom DNA qPCR amplification curve. A total of&#160;2 &#181;L of DNA solution extract that showed no bands by conventional PCR and agarose gel electrophoresis was used as a template to prepare a real-time fluorescence quantitative PCR system and set up a program. Finally, typical amplification curves with four characteristic stages of linear baseline phase, the beginning of exponential phase, exponential phase, and plateau phase were obtained. The Ct value of each curve was also obtained through analysis, indicating that DNA extraction was successful. Each number represents the Ct value of the corresponding curve. The threshold is 5.2. The unit of the y-axis is Rn. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/65792fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65792/65792fig03.jpg" /> 
Figure 3: Diatom DNA melting curve. Using a real-time fluorescence quantitative PCR system, a program was set where the temperature rises from 60-95 &#176;C. This generated a melting curve and the specifically amplified double-stranded DNA melted into single strands at high temperatures, the dye was free from the double strands, and the fluorescence value decreased until it was 0. The graph was obtained by taking the negative reciprocal of the original graph. The abscissa represented the temperature, the abscissa corresponding to the highest peak value was the Tm value, and the Tm value of the melting curve in the graph was 85.5 &#176;C. The numbering of each curve corresponds to the numbering of each lane in Figure 1C. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/65792fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65792/65792fig04.jpg" /> 
Figure 4: Electrophoresis results of the improved process. (A) Electrophoresis results for different combinations of glass bead ratios and vortex oscillation times. Lanes 1, 4, 7, 10, and 13 where the mixed mass ratio of large and small glass beads is 1:2, lanes 2, 5, 8, 11, and 14 where the mixed mass ratio of large and small glass beads is 1:1, lanes 3, 6, 9, 12, and 15 where the mixed mass ratio of large and small glass beads is 2:1, and the oscillation times were 2 min for lanes 1-3, 3 min for lanes 4-6, 4 min for lanes 7-9, 5 min for lanes 10-12, and 6 min for lanes 13-15. Lane 16 is the blank control. (B) Electrophoresis results after PCR amplification of the kit extraction products before and after improvement. Lanes 1-3 are conventional methods for extracting water samples, lanes 4-6 are improved methods for extracting water samples, lanes 7-9 are conventional methods for extracting tissues, lanes 10-12 are improved methods for extracting tissues, lane 13 is a blank control. The results have been modified from21. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/65792fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplementary Figure 1: Water samples and tissue samples. The water samples used were taken from a pond near the laboratory, and the tissue samples used were confirmed as lung tissue of the drowned body.&#160;(A) The experimental water sample collection site was a pond near the laboratory. (B) Enriched water samples and shredded lung tissue samples. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/Supplemental Figure S1.zip" target="_blank">Please click here to download this File.</a>
Supplementary Figure 2: Micrograph of diatom. Images (A)&#160;and (B) were taken under a 400x optical microscope. The arrow points to diatoms. Images (C) and (D)&#160;were taken under an electron microscope. Images (A) and (B) show the diatoms in the water at the drowning site. The diatoms named Fragilaria and Navicula. Images (C) and (D) show diatoms in the lungs, which are called Nitzschia and Navicula. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65792/Supplementary Figure 2.zip" target="_blank">Please click here to download this File.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target</td>
			<td>Primer name</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td rowspan="2">18S rDNA</td>
			<td>forword primer D512</td>
			<td>ATTCCAGCTCCAATAGCG</td>
		</tr>
		<tr>
			<td>reverse primer D978</td>
			<td>GACTACGATGGTATCTAATC</td>
		</tr>
	</tbody>
</table>
Table 1: List of primers used. This table describes the sequences, names, and target regions of specific primers used in this paper.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">PCR reaction system</td>
		</tr>
		<tr>
			<td colspan="2">&#160;2x Taq Mix Pro</td>
			<td colspan="2">10 &#956;L</td>
		</tr>
		<tr>
			<td colspan="2">forword primer D512</td>
			<td colspan="2">0.5 &#956;L (10 &#956;mol/L)</td>
		</tr>
		<tr>
			<td colspan="2">reverse primer D978</td>
			<td colspan="2">0.5 &#956;L (10 &#956;mol/L)</td>
		</tr>
		<tr>
			<td colspan="2">template DNA</td>
			<td colspan="2">2 &#956;L</td>
		</tr>
		<tr>
			<td colspan="2">Nuclease-free water</td>
			<td colspan="2">to 20 &#181;L</td>
		</tr>
		<tr>
			<td colspan="4">Note: The blank control template DNA is replaced by the same amount of Nuclease-free water.</td>
		</tr>
		<tr>
			<td colspan="4">PCR program</td>
		</tr>
		<tr>
			<td>temperature</td>
			<td colspan="2">time</td>
			<td>cycles</td>
		</tr>
		<tr>
			<td>94 &#176;C</td>
			<td colspan="2">10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>94 &#176;C</td>
			<td colspan="2">45 s</td>
			<td rowspan="3">40</td>
		</tr>
		<tr>
			<td>50 &#176;C</td>
			<td colspan="2">45 s</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td colspan="2">1 min</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td colspan="2">10 min</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 2: PCR components. This table describes the configuration of the reaction system for conventional PCR and the settings of the reaction temperature, time, and number of cycles for PCR. The total volume of the reaction system used was 20 &#181;L.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Real-time quantitative PCR reaction system</td>
		</tr>
		<tr>
			<td colspan="2">2x qPCR mix</td>
			<td colspan="2">10 &#956;L</td>
		</tr>
		<tr>
			<td colspan="2">forword primer D512</td>
			<td colspan="2">0.45 &#956;L (10 &#956;mol/L)</td>
		</tr>
		<tr>
			<td colspan="2">reverse primer D978</td>
			<td colspan="2">0.45 &#956;L (10 &#956;mol/L)</td>
		</tr>
		<tr>
			<td colspan="2">template DNA</td>
			<td colspan="2">2 &#956;L</td>
		</tr>
		<tr>
			<td colspan="2">Nuclease-free water</td>
			<td colspan="2">to 20 &#956;L</td>
		</tr>
		<tr>
			<td colspan="4">Note: The blank control template DNA is replaced by the same amount of Nuclease-free water.</td>
		</tr>
		<tr>
			<td colspan="4">Real-time quantitative PCR program</td>
		</tr>
		<tr>
			<td>temperature</td>
			<td colspan="2">time</td>
			<td>cycles</td>
		</tr>
		<tr>
			<td>94 &#176;C</td>
			<td colspan="2">10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>94 &#176;C</td>
			<td colspan="2">45 s</td>
			<td rowspan="3">40</td>
		</tr>
		<tr>
			<td>50 &#176;C</td>
			<td colspan="2">45 s</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td colspan="2">1 min</td>
		</tr>
	</tbody>
</table>
Table 3: Real-time quantitative PCR components.&#160;This table describes the configuration of the reaction system for real-time quantitative PCR and the settings of the reaction temperature, time, and number of cycles for PCR. The total volume of the reaction system used was 20 &#181;L.

Watch this Scientific Journal Video about Diatom Testing for Forensic Drowning Examination at JoVE.com

Author Spotlight: Diatom Testing for Forensic Drowning Examination 

This article describes a protocol for diatom DNA extraction using a modified common DNA extraction kit.

Extraction of Diatom DNA from Water Samples and Tissues

Diatom testing is an essential auxiliary means in forensic practice to determine whether the corpse drowned in water and to infer the drowning location. ...

extraction-of-diatom-dna-from-water-samples-and-tissues

Nanyang Technological University

Research

JoVE Journal

Medicine

1.8K Views.  Hainan Medical University, Hainan Provincial Academician Workstation (tropical forensic medicine). Ons onderzoek richt zich vooral op het onderwerp verdrinking. We wilden de vraag beantwoorden of het lichaam dat in het water werd gevonden stierf door verdrinking, maar ook een andere vraag beantwoorden over waar de persoon in het water viel. Dat betekent dat je de locatie van de verdrinking moet kennen.In vergelijking met andere technologieën bieden we een eenvoudig, handig en economisch diatomeeën-DNA-extractieprotocol dat we beter kunnen gebruiken in forensisch onderzoek, vooral ...

Video: Auteur in de schijnwerpers: diatomeeëntesten voor forensisch verdrinkingsonderzoek 

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Environment

Use of a Filter Cartridge for Filtration of Water Samples and Extraction of Environmental DNA

Recent studies demonstrated the use of environmental DNA (eDNA) from fishes to be appropriate as a non-invasive monitoring tool. Most of these studies employed disk fiber filters to collect eDNA from water samples, although a number of microbial studies in aquatic environments have employed filter cartridges, because the cartridge has the advantage of accommodating large water volumes and of overall ease of use. Here we provide a protocol for filtration of water samples using the filter cartridge and extraction of eDNA from the filter without having to cut open the housing. The main portions of this protocol consists of 1) filtration of water samples (water volumes &#8804;4 L or &gt;4 L); (2) extraction of DNA on the filter using a roller shaker placed in a preheated incubator; and (3) purification of DNA using a commercial kit. With the use of this and previously-used protocols, we perform metabarcoding analysis of eDNA taken from a huge aquarium tank (7,500 m3) with known species composition, and show the number of detected species per library from the two protocols as the representative results. This protocol has been developed for metabarcoding eDNA from fishes, but is also applicable to eDNA from other organisms.

We describe a protocol for filtration of water samples with a filter cartridge and extraction of environmental DNA (eDNA) without having to cut open the housing to remove the filter. This protocol is developed for metabarcoding eDNA from fishes, but is also applicable to eDNA from other organisms.

Recent studies demonstrated the use of environmental DNA (eDNA) from fishes to be appropriate as a non-invasive monitoring tool. Most of these studies ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

DNA Extraction from 0.22 &mu;M Sterivex Filters and Cesium Chloride Density Gradient Centrifugation

This method is used to extract high molecular weight genomic DNA from planktonic biomass concentrated on 0.22 &mu;M Sterivex filters that have been treated with storage/lysis buffer and archived at -80&deg;C, and to purify this DNA using a cesium chloride density gradient.  The protocol begins with two one-hour incubation steps to liberate DNA from cells and remove RNA.  Next, a series of Phenol:Chloroform and Chloroform extractions are performed followed by centrifugation to remove proteins and cell membrane components, collection of the aqueous DNA extract, and several buffer exchange steps to wash and concentrate the extract.  Part Five describes the optional purification via cesium chloride density gradient.  It is recommended to work with less than 15 samples at one time to avoid confusion and cut down protocol time. The total time required for this protocol depends on the number of samples to be extracted. For 10-15 samples and assuming the proper centrifugation equipment is available, this entire protocol should take 3 days. Make sure you have the hybridization ovens set to temperature at the outset of the process.

We describe a method for extraction of high molecular weight genomic DNA from planktonic biomass concentrated on 0.22 &mu;m Sterivex filters, followed by cesium chloride density gradient centrifugation for purification.

This method is used to extract high molecular weight genomic DNA from planktonic biomass concentrated on 0.22 &mu;M Sterivex filters that have been ...

Biology

Extraction of High Molecular Weight Genomic DNA from Soils and Sediments

The soil microbiome is a vast and relatively unexplored reservoir of genomic diversity and metabolic innovation that is intimately associated with nutrient and energy flow within terrestrial ecosystems. Cultivation-independent environmental genomic, also known as metagenomic, approaches promise unprecedented access to this genetic information with respect to pathway reconstruction and functional screening for high value therapeutic and biomass conversion processes. However, the soil microbiome still remains a challenge largely due to the difficulty in obtaining high molecular weight DNA of sufficient quality for large insert library production. Here we introduce a protocol for extracting high molecular weight, microbial community genomic DNA from soils and sediments. The quality of isolated genomic DNA is ideal for constructing large insert environmental genomic libraries for downstream sequencing and screening applications. 
The procedure starts with cell lysis. Cell walls and membranes of microbes are lysed by both mechanical (grinding) and chemical forces (&beta;-mercaptoethanol). Genomic DNA is then isolated using extraction buffer, chloroform-isoamyl alcohol and isopropyl alcohol. The buffers employed for the lysis and extraction steps include guanidine isothiocyanate and hexadecyltrimethylammonium bromide (CTAB) to preserve the integrity of the high molecular weight genomic DNA. Depending on your downstream application, the isolated genomic DNA can be further purified using cesium chloride (CsCl) gradient ultracentrifugation, which reduces impurities including humic acids. The first procedure, extraction, takes approximately 8 hours, excluding DNA quantification step. The CsCl gradient ultracentrifugation, is a two days process. During the entire procedure, genomic DNA should be treated gently to prevent shearing, avoid severe vortexing, and repetitive harsh pipetting.

A methodology to isolate high molecular weight and high quality genomic DNA from soil microbial community is described.

The soil microbiome is a vast and relatively unexplored reservoir of genomic diversity and metabolic innovation that is intimately associated with ...

Visualizing Methane-Cycling Microbial Dynamics in Coastal Wetlands

Coastal wetlands are the largest biotic source of methane, where methanogens convert organic matter into methane and methanotrophs oxidize methane, thus playing a critical role in regulating the methane cycle. The wetlands in South Texas, which are subject to frequent weather events, fluctuating salinity levels, and anthropogenic activities due to climate change, influence methane cycling. Despite the ecological importance of these processes, methane cycling in South Texas coastal wetlands remains insufficiently explored. To address this gap, we developed and optimized a method for detecting genes related to methanogens and methanotrophs, including mcrA as a biomarker for methanogens and pmoA1, pmoA2, and mmoX as biomarkers for methanotrophs. Additionally, this study aimed to visualize the spatial and temporal distribution patterns of methanogen and methanotroph abundance utilizing the geographic information system (GIS) software ArcGIS Pro. The integration of these molecular techniques with advanced geospatial visualization provided critical insights into the spatial and temporal distribution of methanogen and methanotroph communities across South Texas wetlands. Thus, the methodology established in this study offers a robust framework for mapping microbial dynamics in wetlands, enhancing our understanding of methane cycling under varying environmental conditions, and supporting broader ecological and environmental change studies.

The protocol detects key methane-cycling genes in South Texas coastal wetlands and visualizes their spatial distribution to enhance understanding of methane regulation and its environmental impacts in these dynamic ecosystems.

Coastal wetlands are the largest biotic source of methane, where methanogens convert organic matter into methane and methanotrophs oxidize methane, thus ...

DNA-based Fish Species Identification Protocol

We have developed a fast, simple, and accurate DNA-based screening method to identify the fish species present in fresh and processed seafood samples. This versatile method employs PCR amplification of genomic DNA extracted from fish samples, followed by restriction fragment length polymorphism (RFLP) analysis to generate fragment patterns that can be resolved on the Agilent 2100 Bioanalyzer and matched to the correct species using RFLP pattern matching software.
The fish identification method uses a simple, reliable, spin column- based protocol to isolate DNA from fish samples. The samples are treated with proteinase K to release the nucleic acids into solution. DNA is then isolated by suspending the sample in binding buffer and loading onto a micro- spin cup containing a silica- based fiber matrix. The nucleic acids in the sample bind to the fiber matrix. The immobilized nucleic acids are washed to remove contaminants, and total DNA is recovered in a final volume of 100 &mu;l. The isolated DNA is ready for PCR amplification with the provided primers that bind to sequences found in all fish genomes. The PCR products are then digested with three different restriction enzymes and resolved on the Agilent 2100 Bioanalyzer. The fragment lengths produced in the digestion reactions can be used to determine the species of fish from which the DNA sample was prepared, using the RFLP pattern matching software containing a database of experimentally- derived RFLP patterns from commercially relevant fish species.

This publication describes how to use the Agilent Fish Species Identification System to identify the species of a fish by extracting DNA and performing PCR and RFLP analysis.

We have developed a fast, simple, and accurate DNA-based screening method to identify the fish species present in fresh and processed seafood samples. ...

DNA Extraction from Paraffin Embedded Material for Genetic and Epigenetic Analyses

Disease development and progression are characterized by frequent genetic and epigenetic aberrations including chromosomal rearrangements, copy number gains and losses and DNA methylation. Advances in high-throughput, genome-wide profiling technologies, such as microarrays, have significantly improved our ability to identify and detect these specific alterations. However as technology continues to improve, a limiting factor remains sample quality and availability. Furthermore, follow-up clinical information and disease outcome are often collected years after the initial specimen collection. Specimens, typically formalin-fixed and paraffin embedded (FFPE), are stored in hospital archives for years to decades. DNA can be efficiently and effectively recovered from paraffin-embedded specimens if the appropriate method of extraction is applied. High quality DNA extracted from properly preserved and stored specimens can support quantitative assays for comparisons of normal and diseased tissues and generation of genetic and epigenetic signatures 1. To extract DNA from paraffin-embedded samples, tissue cores or microdissected tissue are subjected to xylene treatment, which dissolves the paraffin from the tissue, and then rehydrated using a series of ethanol washes. Proteins and harmful enzymes such as nucleases are subsequently digested by proteinase K. The addition of lysis buffer, which contains denaturing agents such as sodium dodecyl sulfate (SDS), facilitates digestion 2. Nucleic acids are purified from the tissue lysate using buffer-saturated phenol and high speed centrifugation which generates a biphasic solution. DNA and RNA remain in the upper aqueous phase, while proteins, lipids and polysaccharides are sequestered in the inter- and organic-phases respectively. Retention of the aqueous phase and repeated phenol extractions generates a clean sample. Following phenol extractions, RNase A is added to eliminate contaminating RNA. Additional phenol extractions following incubation with RNase A are used to remove any remaining enzyme. The addition of sodium acetate and isopropanol precipitates DNA, and high speed centrifugation is used to pellet the DNA and facilitate isopropanol removal. Excess salts carried over from precipitation can interfere with subsequent enzymatic assays, but can be removed from the DNA by washing with 70% ethanol, followed by centrifugation to re-pellet the DNA 3. DNA is re-suspended in distilled water or the buffer of choice, quantified and stored at -20&deg;C. Purified DNA can subsequently be used in downstream applications which include, but are not limited to, PCR, array comparative genomic hybridization 4 (array CGH), methylated DNA Immunoprecipitation (MeDIP) and sequencing, allowing for an integrative analysis of tissue/tumor samples.

This video demonstrates the protocol for DNA extraction from formalin-fixed paraffin-embedded material. This is a multi-day procedure in which tissue sections are deparaffinized with xylene, rehydrated with ethanol and treated with proteinase K to purify and isolate DNA for subsequent gene-specific or genome-wide analysis.

Disease development and progression are characterized by frequent genetic and epigenetic aberrations including chromosomal rearrangements, copy number ...

Extraction of High Molecular Weight DNA from Microbial Mats

Successful and accurate analysis and interpretation of metagenomic data is dependent upon the efficient extraction of high-quality, high molecular weight (HMW) community DNA. However, environmental mat samples often pose difficulties to obtaining large concentrations of high-quality, HMW DNA. Hypersaline microbial mats contain high amounts of extracellular polymeric substances (EPS)1 and salts that may inhibit downstream applications of extracted DNA. Direct and harsh methods are often used in DNA extraction from refractory samples. These methods are typically used because the EPS in mats, an adhesive matrix, binds DNA2,3 during direct lysis. As a result of harsher extraction methods, DNA becomes fragmented into small sizes4,5,6.
The DNA thus becomes inappropriate for large-insert vector cloning. In order to circumvent these limitations, we report an improved methodology to extract HMW DNA of good quality and quantity from hypersaline microbial mats. We employed an indirect method involving the separation of microbial cells from the background mat matrix through blending and differential centrifugation. A combination of mechanical and chemical procedures was used to extract and purify DNA from the extracted microbial cells. Our protocol yields approximately 2 &mu;g of HMW DNA (35-50 kb) per gram of mat sample, with an A260/280 ratio of 1.6. Furthermore, amplification of 16S rRNA genes7 suggests that the protocol is able to minimize or eliminate any inhibitory effects of contaminants. Our results provide an appropriate methodology for the extraction of HMW DNA from microbial mats for functional metagenomic studies and may be applicable to other environmental samples from which DNA extraction is challenging.

We provide an improved protocol for extracting high molecular weight DNA from hypersaline microbial mats. Microbial cells are separated from the mat matrix prior to DNA extraction and purification. This enhances the concentrations, quality, and size of the DNA. The protocol may be used for other refractory samples.

Successful and accurate analysis and interpretation of metagenomic data is dependent upon the efficient extraction  of high-quality, high molecular weight ...

Removal of Exogenous Materials from the Outer Portion of Frozen Cores to Investigate the Ancient Biological Communities Harbored Inside

The cryosphere offers access to preserved organisms that persisted under past environmental conditions. In fact, these frozen materials could reflect conditions over vast time periods and investigation of biological materials harbored inside could provide insight of ancient environments. To appropriately analyze these ecosystems and extract meaningful biological information from frozen soils and ice, proper collection and processing of the frozen samples is necessary. This is especially critical for microbial and DNA analyses since the communities present may be so uniquely different from modern ones. Here, a protocol is presented to successfully collect and decontaminate frozen cores. Both the absence of the colonies used to dope the outer surface and exogenous DNA suggest that we successfully decontaminated the frozen cores and that the microorganisms detected were from the material, rather than contamination from drilling or processing the cores.

The cryosphere offers access to preserved organisms that persisted under past environmental conditions. A protocol is presented to collect and decontaminate permafrost cores of soils and ice. The absence of exogenous colonies and DNA suggest that microorganisms detected represent the material, rather than contamination from drilling or processing.

The cryosphere offers access to preserved organisms that persisted under past environmental conditions. In fact, these frozen materials could reflect ...

Extraction of Diatom DNA from Water Samples and Tissues

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video