The authors wish to acknowledge the many Alexandrov lab members who have contributed to the development of the LTE systems over the last 10 years, in particular Sergey Mureev who pioneered the system and developed the SITS ribosome entry site. Figure 1 was created by Biorender.com and reproduced under licence.

This protocol includes detailed media recipes and steps that involve culturing, centrifuging, measuring GFP fluorescence using a multimode platereader, measuring culture OD600nm, and assessing lysate Abs280nm. It also covers the setup and imaging of SDS-PAGE protein gels. The materials required or suggested for this protocol are listed in the Materials spreadsheet. It&#39;s important to note that typical laboratory resources such as media components, centrifuges, tubes, spectrophotometers, and gel electrophoresis setups can likely be used interchangeably unless specified otherwise. Figure 1 provides a summary of the LTE manufacturing process.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65592/65592fig01.jpg" /> 
Figure 1: Overview of LTE manufacturing protocol. This cartoon provides a concise summary of the LTE manufacturing protocol. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65592/65592fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
1. Growth of Leishmania tarentolae&#160; cultures
<ol>
	<li>Prepare at least 3 L of TBGG growth media (Bactotryptone 12 g/L, Yeast extract 24 g/L, glycerol 8 mL/L, glucose 1 g/L, KH2PO4 2.3 g/L, K2HPO4 2.5 g/L, see Table of Materials). Sterilize the media using a 0.22 &#181;m filter under vacuum or a similar setup.</li>
	<li>Store the media at room temperature (RT), with the final additions (Hemin, Antibiotics) added just before inoculation with&#160;L. tarentolae. Hemin (0.25% v/v in 50% triethanolamine) is added at 0.2% v/v, Penicillin (10,000 units/mL) plus Streptomycin (10,000 &#181;g/mL) mix at 0.5% v/v. 
	NOTE: The starting point of this protocol is a maintained 2 x 10 mL culture of wild type L. tarentolae. Maintenance cultures are grown at 27 &#176;C in standard 50 mL tissue culture flasks with low shaking (75 rpm). Such 10 mL cultures can be maintained indefinitely with ~1/20 dilutions in sterile (TBGG + hemin, penicillin, streptomycin) every 2-3 days. A standard biosafety cabinet in a PC2 laboratory is recommended; however, bacterial contaminations tend to be prevented by the added antibiotics, while fungal contaminations are generally outgrown by L. tarentolae.</li>
	<li>Over two days, expand the L. tarentolae maintenance cultures to 200 mL (day 1) and then 2 L (day 2) via 1:10 dilutions with an increasing volume of TBGG + hemin/antibiotics each day. Perform both dilutions in autoclave-sterilized baffled 5 L glass flasks (filled to a maximum of 1 L). The second dilution must occur in the afternoon between 3-6 pm, with the intention of starting lysate production the next day between 8-11 am. 
	NOTE: This protocol uses the minimum starting volume for LTE production (2 x 1 L cultures). It is also possible to expand the culture up to 10 L for LTE production by incorporating an additional expansion step (e.g., Day 1: 100 mL; Day 2: 1 L; Day 3: 10 L). Although this protocol uses baffled flasks (see Table of Materials) to grow L. tarentolae, optionally, conventional bioreactors designed for bacterial growth with Rushton impellers can be used, provided the stirring rate is kept below 100 rpm. Improved aeration and pH control in bioreactors generally extend the log-phase growth of the L. tarentolae cultures, allowing for a higher harvest OD600nm of 10 to be used in step 1.4.</li>
	<li>Record the OD600nm of the culture in triplicate via a 1:10 dilution in TBGG directly in the spectrophotometer cuvette. A suitable starting range for making lysate is OD600nm = 4.0-8.0.</li>
	<li>Provide additional incubation time if OD600nm &#60; 4.0. A culture with OD600nm &#62; 8 is usable and will result in a greater volume of cell-free expression lysate, but with lower quality due to the onset of the late-log growth phase. Place culture flasks on ice, awaiting subsequent steps. 
	&#8203;NOTE: Accurate measurement of the final culture OD600nm is critical, as it is used to calculate the final volume for concentrated cells prior to disruption. This calculation replaces a pellet weighing method used in earlier versions of LTE manufacture to calibrate cell concentration prior to disruption34, in order to simplify the protocol. Ensure to dilute in TBGG for OD600nm measurement, as otherwise, osmotic shock changes the cell shape, causing measurement error. Pipette mix the 1:10 dilution for OD600nm measurement (directly in the cuvette) seconds before taking the spectrophotometric read, as L. tarentolae cells rapidly settle out with a distinctive cloudy appearance. If the final volume of the expression culture is considered approximate, weighing flasks at harvest (with suitable empty flask tare) to get a better estimated volume (at 1 g = 1 mL) is also recommended. The maximum OD600nm possible from L. tarentolae growth in baffled flasks is 15-20, although this is inappropriate for lysate manufacture due to reaching the stationary phase.</li>
</ol>
2. Concentration of&#160;&#160;L. tarentolae cultures
<ol>
	<li>The Leishmania cells must be washed and concentrated approximately 60x prior to disruption. Calculate the target volume for cell concentration based on OD600nm = 300 for the final concentrate. The equation is V = harvest volume (mL) x (harvest OD600nm/300). For example, using a 2 L culture with a harvest OD600 = 5, the target volume is 33 mL. 
	NOTE: The OD600nm target of 300 can be modified; previous LTE production has used values in the range of 150-350. Higher concentrations of cells going into disruption will tend to yield final cell-free expression reactions with higher protein yields, but with an increased tendency for vulnerable proteins to aggregate. OD600nm = 300 represents a suitable default target for LTE production.</li>
	<li>Transfer the harvested cultures to suitable centrifuge bottles and spin them at 2500 x g for 10 min at 4 &#176;C. Carefully decant the supernatant into the culture waste. 
	NOTE: It is important to minimize the loss of cells into the discarded supernatant, as it affects the calculation of disruption loading. In previous LTE production protocols, the concentration of L. tarentolae cells for disruption was calibrated by spinning down the cell concentrate in a test microcentrifuge tube and measuring the pellet weight versus the total weight34. This simplified protocol instead uses a theoretical OD600nm target for the concentrate, based on the measured harvest OD600nm, and assumes low cell loss during cell concentration and washing.</li>
	<li>Wash the cell pellet in SEB buffer (45 mM HEPES-KOH pH 7.6, 250 mM sucrose, 100 mM KOAc, 3 mM Mg(OAc)2, kept on ice) three times, each time centrifuging at 2500 x g for 10 min at 4 &#176;C. For the first wash, resuspend each 1 L of pelleted culture in 100 mL of SEB buffer, then combine them into a single centrifuge flask. For the second wash, also use 100 mL of SEB for each 1 L of the original culture. 
	NOTE: For the final pellet resuspension, add SEB buffer to 50% of the final target resuspension volume (step 2.1). This allows the pooled concentrate to be carefully topped up to exactly the final target volume in step 2.4. Each resuspension must be as gentle as possible to avoid premature lysis of L. tarentolae, for example, by gently swirling the added SEB around the decanted pellet or pipetting SEB over the pellet adhering to the centrifuge tube wall. It may be more convenient to transfer supernatants to smaller centrifuge tubes for the final step.</li>
	<li>Pour the resuspended concentrate into a suitable washed glass volumetric cylinder, then top up the volume to the target volume (step 2.1) using additional cold SEB and gently mix.</li>
</ol>
3. Lysis of L. tarentolae&#160; concentrate
<ol>
	<li>Transfer the cell concentrate into the nitrogen cavitation device (see Table of Materials) pre-cooled to 4 &#176;C, pressurize it to 70 bars of nitrogen, and incubate for 45 min on ice. 
	NOTE: While nitrogen cavitation disrupters are not common laboratory items, they are recommended for LTE production. Alternative methods such as cellular freeze-thaw and French-press type disrupters have been tried; however, protein expression activity was &#60;50% compared to using the nitrogen cavitation method. The nitrogen cavitation device must be thoroughly cleaned before use and between runs, similar to all reused vessels that come into contact with the cell lysate from this step onward (such as the receiver flask). A suitable cleaning regimen involves washing with laboratory detergents followed by thorough rinsing with deionized water.</li>
	<li>Open the vent on the nitrogen cavitation device and expel the resulting lysate into a suitably robust container, such as a vacuum receiver flask on ice. Tilt the receiver flask to ensure all of the resulting lysate settles and can be pipetted into a fresh centrifuge tube or a similar vessel. 
	&#8203;CAUTION: Nitrogen cavitation disrupters rely on the abrupt transition of the cell concentrate from 70 bars of nitrogen to ambient pressure, achieved through a strong flow of first liquid and then nitrogen through the device&#39;s exit valve. Venting must be done with appropriate personal protective equipment (PPE) in a chemical safety hood. There is a risk of breaking the destination vessel and losing the lysate, which is why we use a sturdy vacuum receiver instead of a generic flask. If the device&#39;s exit valve is a tube, avoid placing the tube directly inside the receiver to prevent excessive pressure buildup at the venting point.</li>
</ol>
4. Centrifugation of cell lysate
<ol>
	<li>Transfer the lysate to suitable g force rated centrifuge tubes and centrifuge at 10,000 x g for 15 min at 4 &#176;C. Remove the supernatant to fresh, similar centrifuge tubes.</li>
	<li>Centrifuge the lysate at 30,000 x g for 15 min at 4 &#176;C, and then remove the final supernatant to a fresh centrifuge tube or a similar container placed on ice. Estimate the total volume.</li>
</ol>
5. Gel filtration of cell lysate
NOTE: Gel filtration is used to remove sucrose included in the SEB buffer. While sucrose assists in stabilizing cellular machinery during cell disruption, it decreases yield if retained in protein expression reactions.
<ol>
	<li>Set up a sufficient number of PD-10 gravity-fed gel filtration columns (see Table of Materials) in a rack format that allows them to drip into a collection tray or a similar container beneath, ensuring they can filter the entire lysate volume at 2.5 mL per column. Pre-equilibrate the columns by passing 10 mL of 4 &#176;C EB buffer (45 mM HEPES-KOH pH 7.6, 100 mM KOAc, 3 mM Mg(OAc)2) through them beforehand. 
	NOTE: All steps from this point benefit from being conducted in a 4 &#176;C cold room. However, it is also suitable to keep all lysates and reagents on a benchtop ice tray. One exception is the gel filtration step, in which the authors place a rack of columns inside a 4 &#176;C fridge while rebuffering. In the original versions of this protocol, new gel filtration columns were &#39;blocked&#39; by initially buffering the lysate and discarding the first output. Although this is not considered necessary, columns must be flushed with EB buffer and stored at 4 &#176;C between lysate batches. The first output lysate may have lower protein expression activity than subsequent outputs due to some background retention of lysate components on the new column.</li>
	<li>Add 2.5 mL of lysate to each column and wait until it passes into the column. Add an additional 0.5 mL of EB to settle the lysate into the column while discarding the eluate.</li>
	<li>Elute the gel-filtered lysate by adding an additional 2.5 mL of EB to each column, collecting the output by placing a fresh, clean tray or another receptacle beneath the columns.</li>
</ol>
6. Supplementation of cell lysate
<ol>
	<li>Use the nanodrop spectrophotometer (see Table of Materials) to measure Abs280nm of the gel-filtered lysate. If it exceeds 60, dilute it to reach Abs280nm = 60 using additional 4 &#176;C EB buffer. 
	NOTE: While controlling cell density input into disruption using OD600nm approximately determines lysate output strength, normalizing the Abs280nm after lysate disruption and processing further improves the batch consistency of lysate performance. Lysate Abs280nm can be adjusted up and down, with consequences for protein expression yield and aggregation (see Discussion section). If the unsupplemented lysate indicates an Abs280nm &#60; 60, it may be necessary to include more Leishmania biomass in the disruption step, i.e., increase the cell disrupter loading to OD600nm &#62; 300 in step 2.1.</li>
	<li>Add 5x Feeding Solution (5x FS, Table 1) to the lysate in a 2:5 ratio and vortex mix thoroughly. Aliquot it into suitable containers (e.g., 1.5 mL microfuge tubes), and snap-freeze it in liquid nitrogen. If one is following the optional steps 7.1-7.3 for LTE expression optimization below, use the reduced rNTP.Mg 5x FS from Table 1 instead of the default 5x FS. Include 5 x 100 &#181;L aliquots for freezing for use in the optimization experiments. 
	&#8203;NOTE: Freezing with the default 5x FS in a 2:5 ratio creates expression-ready supplemented LTE, used at 7 &#181;L/10 &#181;L expression (hence, the 5x FS becomes 1x FS in the final reaction). However, the authors recommend following the further optional steps where 0.6x the default amount of rNTPs and magnesium is provided in the 5x FS. This is followed by an optimization step where an equimolar mix of the two (referred to as rNTP.Mg) is added to top up test reactions to an optimized value. The partial 5x FS also contains an oligonucleotide that shuts down endogenous mRNA expression (see Introduction section). The sequence of the oligonucleotide is CAATAAAGTACAGAAACTGATACTTATATAGCGTT.</li>
</ol>
7. QC and optimization of final supplemented LTE
NOTE: The minimum necessary steps to determine the appropriate &#39;top-up&#39; addition of rNTP.Mg to the reduced rNTP and magnesium-supplemented lysate involve expressing eGFP or a similar fluorophore (e.g., sfGFP) without a fusion partner. Increasing concentrations of rNTP.Mg are added to the reactions to determine the point at which expression level (measured as eGFP RFU via a multimode plate reader) is optimized. Premature terminations of eGFP, which are not fluorescent, become evident by decreasing eGFP RFU at too high rNTP.Mg concentrations. However, short-product malfunctions of LTE occur more frequently in larger expressed proteins (&#62;50 kDa). Hence, it is possible to perform this optimization using a larger template than eGFP, especially if one is available in a suitable expression vector, providing a fluorophore fusion that is desired to be produced by LTE for a particular application or study (see Representative Results section).
<ol>
	<li>Thaw a 100 &#181;L aliquot and set up six 10 &#181;L expression reactions, each composed of 7 &#181;L partially supplemented lysate from step 6.2, 1 &#181;L of top-up solution as per Table 2, and 2 &#181;L of ultrapure water containing sufficient DNA control template to achieve a final concentration of 50 ng/&#181;L in the reaction.</li>
	<li>Incubate the reactions for 2 h at 25 &#176;C and monitor the increase in GFP fluorescence using a multimode plate reader. 
	NOTE: Suitable configuration values for GFP are excitation at 485 nm (bandwidth 5 nm), emission at 516 nm (bandwidth 5 nm), with a reading interval of 1 min for 2 h.</li>
	<li>Rank the final expression values to determine the rNTP.Mg concentration corresponding to the highest eGFP RFU. If kinetic data is available, an excess of rNTP.Mg will also be indicated by a biphasic increase in eGFP RFU during the 2 h expression period (see Representative Results section).</li>
	<li>Once the optimized top-up rNTP.Mg concentration is determined, add it to all further protein expressions using the batch of LTE that was partially supplemented in the previous steps. 
	NOTE: If aliquoting in step 6.2 is done carefully with fixed volumes, the top-up can be retrospectively added to each aliquot without thawing, e.g., with the aliquots placed on dry ice. These aliquots are now fully supplemented, as the correct rNTP.Mg top-up will be mixed through each when they are thawed and mixed for use.</li>
</ol>

Streamlined Protocol for Leishmania Translational Extract (LTE) Production

<ol>
	<li>Nirenberg, M. W., Matthaei, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dependence+of+cell-free+protein+synthesis+in+E.coli+upon+naturally+occurring+or+synthetic+polyribonucleotides.">The dependence of cell-free protein synthesis in E.coli upon naturally occurring or synthetic polyribonucleotides.</a> Proc Natl Acad Sci USA. 47 (10), 1588-1602 (1961).</li><li>Caschera, F., Noireaux, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2.3+mg/ml+of+protein+with+an+all+Escherichia+coli+cell-free+transcription-translation+system.">Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription-translation system.</a> Biochimie. 99, 162-168 (2014).</li><li>Kelwick, R., Webb, A. J., MacDonald, J. T., Freemont, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+Bacillus+subtilis+cell-free+transcription-translation+system+for+prototyping+regulatory+elements.">Development of a Bacillus subtilis cell-free transcription-translation system for prototyping regulatory elements.</a> Metab Eng. 38, 370-381 (2016).</li><li>Ezure, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+protein+synthesis+system+prepared+from+insect+cells+by+freeze-thawing.">Cell-free protein synthesis system prepared from insect cells by freeze-thawing.</a> Biotechnol Prog. 22 (6), 1570-1577 (2006).</li><li>Harbers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wheat+germ+systems+for+cell-free+protein+expression.">Wheat germ systems for cell-free protein expression.</a> FEBS Letters. 588 (17), 2762-2773 (2014).</li><li>Kobs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+the+cell-free+protein+expression+system+that+meets+your+experimental+goals.">Selecting the cell-free protein expression system that meets your experimental goals.</a> Promega Corporation. 21, 6-9 (2008).</li><li>Kovtun, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leishmania+cell-free+protein+expression+system.">Leishmania cell-free protein expression system.</a> Methods. 55 (1), 58-64 (2011).</li><li>Basile, G., Peticca, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+protein+expression+in+Leishmania+tarentolae.">Recombinant protein expression in Leishmania tarentolae.</a> Mol Biotechnol. 43 (3), 273-278 (2009).</li><li>Mureev, S., Kovtun, O., Nguyen, U. T., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species-independent+translational+leaders+facilitate+cell-free+expression.">Species-independent translational leaders facilitate cell-free expression.</a> Nat Biotechnol. 27 (8), 747-752 (2009).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+fluorescence+reveals+the+oligomerization+and+folding+steps+driving+the+prion-like+behavior+of+ASC.">Single-molecule fluorescence reveals the oligomerization and folding steps driving the prion-like behavior of ASC.</a> J Mol Biol. 430 (4), 491-508 (2018).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mapping+of+interactions+between+human+SNX-BAR+proteins+measured+in+vitro+by+AlphaScreen+and+single-molecule+spectroscopy.">Rapid mapping of interactions between human SNX-BAR proteins measured in vitro by AlphaScreen and single-molecule spectroscopy.</a> Mol Cell Proteomics. 13 (9), 2233-2245 (2014).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanomolar+oligomerization+and+selective+co-aggregation+of+alpha-synuclein+pathogenic+mutants+revealed+by+single-molecule+fluorescence.">Nanomolar oligomerization and selective co-aggregation of alpha-synuclein pathogenic mutants revealed by single-molecule fluorescence.</a> Sci Rep. 6, 37630 (2016).</li><li>Leitao, A., Bhumkar, A., Hunter, D. J. B., Gambin, Y., Sierecki, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unveiling+a+selective+mechanism+for+the+inhibition+of+alpha-synuclein+aggregation+by+beta-synuclein.">Unveiling a selective mechanism for the inhibition of alpha-synuclein aggregation by beta-synuclein.</a> Int J Mol Sci. 19 (2), 334 (2018).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+analysis+reveals+self+assembly+and+nanoscale+segregation+of+two+distinct+cavin+subcomplexes+on+caveolae.">Single-molecule analysis reveals self assembly and nanoscale segregation of two distinct cavin subcomplexes on caveolae.</a> Elife. 3, e01434 (2013).</li><li>Ve, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+of+TIR-domain-assembly+formation+in+MAL-+and+MyD88-dependent+TLR4+signaling.">Structural basis of TIR-domain-assembly formation in MAL- and MyD88-dependent TLR4 signaling.</a> Nat Struct Mol Biol. 24 (9), 743-751 (2017).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organisation+of+in+vitro+reconstituted+HOPS+and+CORVET+multisubunit+membrane+tethering+complexes.">Subunit organisation of in vitro reconstituted HOPS and CORVET multisubunit membrane tethering complexes.</a> PLoS One. 8 (12), e81534 (2013).</li><li>Ruehrer, S., Michel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+Leishmania+tarentolae+cell-free+extracts+for+the+synthesis+of+human+solute+carriers.">Exploiting Leishmania tarentolae cell-free extracts for the synthesis of human solute carriers.</a> Mol Membr Biol. 30 (4), 288-302 (2013).</li><li>Varasteh Moradi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+Interactions+among+cell-free+expressed+Zika+virus+proteins.">Mapping Interactions among cell-free expressed Zika virus proteins.</a> J Proteome Res. 19 (4), 1522-1532 (2020).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+pipeline+for+discovery+of+thermotolerant+xylanases+and+endo-1,4-beta-glucanases.">Cell-free pipeline for discovery of thermotolerant xylanases and endo-1,4-beta-glucanases.</a> J Biotechnol. 259, 191-198 (2017).</li><li>Ergun Ayva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+performance+parameters+of+artificial+allosteric+protein+switches.">Exploring performance parameters of artificial allosteric protein switches.</a> J Mol Biol. 434 (17), 167678 (2022).</li><li>Lau, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+biosensor+for+real-time+interaction+dynamics+of+host+proteins+with+HIV-1+capsid+tubes.">Fluorescence biosensor for real-time interaction dynamics of host proteins with HIV-1 capsid tubes.</a> ACS Appl Mater Interfaces. 11 (38), 34586-34594 (2019).</li><li>Ryan, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+antiinflammatory+biologics+shaped+by+parasite-host+coevolution.">Novel antiinflammatory biologics shaped by parasite-host coevolution.</a> Proc Natl Acad Sci USA. 119 (36), e2202795119 (2022).</li><li>McMahon, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+cavin+target+proteins+reveals+cavin-PP1alpha+interactions+regulate+apoptosis.">Identification of intracellular cavin target proteins reveals cavin-PP1alpha interactions regulate apoptosis.</a> Nat Commun. 10 (1), 3279 (2019).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cell-free+approach+to+accelerate+the+study+of+protein-protein+interactions+in+vitro.">A cell-free approach to accelerate the study of protein-protein interactions in vitro.</a> Interface Focus. 3 (5), 20230018 (2013).</li><li>Johnston, W. A., Moradi, S. V., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaption+of+the+Leishmania+cell-free+expression+system+to+high-throughput+analysis+of+protein+interactions.">Adaption of the Leishmania cell-free expression system to high-throughput analysis of protein interactions.</a> Methods Mol Biol. 2025, 403-421 (2019).</li><li>Jung, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+formation+and+interactome+analysis+of+caveolae.">Cell-free formation and interactome analysis of caveolae.</a> J Cell Biol. 217 (6), 2141-2165 (2018).</li><li>Fontaine, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+domain+analysis+of+SOX18+transcription+factor+using+a+single-chain+variable+fragment-based+approach.">Functional domain analysis of SOX18 transcription factor using a single-chain variable fragment-based approach.</a> MAbs. 10 (4), 596-606 (2018).</li><li>Overman, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pharmacological+targeting+of+the+transcription+factor+SOX18+delays+breast+cancer+in+mice.">Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice.</a> Elife. 6, e21221 (2017).</li><li>Kubala, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+farnesyltransferase+alpha+subunit+regulates+vacuolar+protein+sorting-associated+protein+4A+(Vps4A)--dependent+intracellular+trafficking+through+recycling+endosomes.">Mammalian farnesyltransferase alpha subunit regulates vacuolar protein sorting-associated protein 4A (Vps4A)--dependent intracellular trafficking through recycling endosomes.</a> Biochem Biophys Res Commun. 468 (4), 580-586 (2015).</li><li>Han, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortactin+scaffolds+Arp2/3+and+WAVE2+at+the+epithelial+zonula+adherens.">Cortactin scaffolds Arp2/3 and WAVE2 at the epithelial zonula adherens.</a> J Biol Chem. 289 (11), 7764-7775 (2014).</li><li>Das Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Class+IIa+histone+deacetylases+drive+toll-like+receptor-inducible+glycolysis+and+macrophage+inflammatory+responses+via+pyruvate+kinase+M2.">Class IIa histone deacetylases drive toll-like receptor-inducible glycolysis and macrophage inflammatory responses via pyruvate kinase M2.</a> Cell Rep. 30 (8), 2712-2728.e8 (2020).</li><li>Leit&#227;o, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selectivity+of+protein+interactions+along+the+aggregation+pathway+of+&#945;-synuclein.">Selectivity of protein interactions along the aggregation pathway of &#945;-synuclein.</a> BioRxiv. , (2021).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+benchmarking+of+four+cell-free+protein+expression+systems.">Performance benchmarking of four cell-free protein expression systems.</a> Biotechnol Bioeng. 113 (2), 292-300 (2016).</li><li>Johnston, W. A., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+eukaryotic+cell-free+lysate+from+Leishmania+tarentolae.">Production of eukaryotic cell-free lysate from Leishmania tarentolae.</a> Methods Mol Biol. 1118, 1-15 (2014).</li><li>Hunter, D. J. B., Bhumkar, A., Giles, N., Sierecki, E., Gambin, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+instabilities+explain+batch-to-batch+variability+in+cell-free+protein+expression+systems.">Unexpected instabilities explain batch-to-batch variability in cell-free protein expression systems.</a> Biotechnol Bioeng. 115 (8), 1904-1914 (2018).</li></ol>

No competing financial interests are present.

Protocols for creating LTE have been published over the past decade7 and have undergone periodic updates25,34. However, newcomers to the technique often encounter a steep learning curve, resulting in delays in achieving high-quality and high-yield protein expression. Similar challenges have been reported by other research groups working with LTE35, particularly concerning significant batch-to-batch variations. The video-based protocol format can potentially provide additional, less obvious setup knowledge that benefits prospective users34. Modifications have been introduced to the protocol, aiming to increase the likelihood of success, simplify the procedure, reduce time, and minimize errors related to complexity.
In cell disruption, precise control over loading cells into the nitrogen cavitation cell disrupter is crucial34. Achieving this can be challenging due to high cell density after cell concentration and washing. In the original protocols, various methods were used, such as spinning down a small volume of the final concentrated culture and quantifying the fractional cell pellet. However, in this protocol, a simpler approach is adopted. The culture harvest volume and OD600nm are measured, and these measurements are used to calculate a target volume for the cell concentrate in milliliters, aiming for a desired final OD600nm of 300. This calculation assumes that no significant cell loss occurs during washing. If there is suspicion of cell loss, an alternative method involving triplicated serial 1/10 dilutions of the concentrated cells post-washing is employed, ultimately resulting in a 1/1000 dilution. This allows measuring the actual concentrate&#39;s OD600nm, ensuring it reaches the target OD600nm = 300 before loading it into the disrupter.
Even with careful control of cell disrupter loading, significant variability in post-disruption lysate protein content can occur, as indicated by the Abs280nm of the gel-filtered unsupplemented lysate34. Therefore, a measurement of Abs280nm before lysate supplementation is introduced, and the lysate is diluted to achieve an Abs280nm = 60. Since protein expression reactions eventually include 0.5 v/v lysate, this results in a standardized reaction lysate with Abs280nm = 30. Lysate performance configured with lower than Abs280nm = 30 tends to yield long-duration, low-expression reactions, while values greater than Abs280nm = 30 tend to yield higher expression but an increased tendency for output protein aggregation.
Lysate performance optimization involves adjusting the transcriptional inputs in the feeding solution that supplements the lysate, specifically rNTPs and magnesium, in optional reaction steps 7.0-7.3. It&#39;s important to note that rNTPs and magnesium have complex and multiple roles in a coupled transcription-translation system like LTE25. However, LTE has been shown to have an approximate magnesium expression optimum at rNTP (mM) + 1.5. As the lysate itself contributes 1.5 mM Mg to the final reaction mixture, this provides a straightforward way to vary and optimize rNTP input without co-optimizing Mg by varying equimolar rNTP.Mg.
Lysate performance exhibits significant variation when increasing rNTP.Mg, with protein expression generally increasing up to a threshold where optimization reverses, resulting in expression malfunctions in the form of short products instead of full-length proteins25. Therefore, final optimization of the system to identify this threshold is beneficial. The original LTE protocol employed a fixed feeding solution recipe, with some Mg optimization suggested34. This approach was later modified with more extensive rNTP optimization. However, this method required snap-freezing the lysate in unsupplemented form to enable optimization on an aliquot, which tended to decrease eventual lysate expression levels. This reduction was attributed to the loss of the cryoprotective properties of the feeding solution when snap-freezing unsupplemented lysate immediately following the gel filtration step. The current protocol strikes a balance by supplementing with a feeding solution containing reduced rNTP.Mg before freezing, which can be topped up to the optimized level at the point of expression.
These protocol improvements are expected to enhance the utility of the LTE system for novice users by mitigating the primary sources of variation and improving protein expression output consistency.

In the 1960s, cell-free protein expression systems played a pivotal role in uncovering the genetic code1. However, prokaryotic cell-free protein expression systems, mainly based on E. coli, currently dominate both laboratory and commercial applications. While E. coli-based systems offer advantages such as cost-effectiveness, scalability, and high expression yields, they face challenges when producing multi-domain proteins in their active forms and facilitating the assembly of protein complexes2,3. In the present day, commonly used forms of eukaryotic Cell-Free Protein Synthesis (CFPS) include wheat germ extract (WGE), rabbit reticulocyte lysate (RRL), and insect cell lysate (ICL)4,5,6. This work introduces an alternative eukaryotic cell-free system that is both straightforward and scalable, based on the unicellular flagellate parasite Leishmania tarentolae.
Leishmania tarentolae can be cultivated easily in flasks using cost-effective media and can also be scaled up in bioreactors to achieve higher cell density. The presence of endogenous mRNAs in cell lysate, which might otherwise compete with introduced messages, can be neutralized using antisense oligonucleotides targeting the conserved Leishmania mRNA splice leader sequence7. Unlike its close relative Leishmania major, which causes human disease, L. tarentolae infects the moorish gecko (Tarentolae mauritanica), making it suitable for cultivation in PC2 laboratory environments without the need for special precautions. It has previously been used as a transgenic organism for in vivo protein expression8.
To facilitate template priming in cell-free systems, universal sequences have been designed based on polymeric RNA structures that enhance translational initiation9. These species-independent translation sequences (SITS) are applicable to both prokaryotic and eukaryotic cell-free systems and are suitable for introducing genetic information into LTE. While this protocol does not provide a detailed explanation of vector construction for LTE cell-free protein expression, optimization and quality control require suitable vectors containing fluorophore fusions of the desired proteins of interest downstream of the SITS site. For this purpose, appropriate LTE vectors have been deposited with the Addgene gene repository, such as the pCellFree_G03 vector, which encodes an N-terminal eGFP fusion to the desired protein of interest using Gateway cloning sites.
LTE has proven its value in a wide range of applications requiring protein expression, including the analysis of protein self-assembly10,16, production of human integral membrane proteins17, research on antiviral drug candidates18, the development of biotechnologically useful enzymes19, prototyping protein biosensors20,21, and the study of biologics from hookworms22. LTE has also been instrumental in mapping Protein-Protein interaction networks in the fields of virology and cellular structures21,32. LTE has been benchmarked to perform similarly to other eukaryotic cell-free systems in expressing full-length, monodispersed, and non-aggregated proteins33, all while offering more cost-effective and scalable production.
This protocol provides techniques for cultivating and disrupting the host organism, preparing lysate, and supplementing a feeding solution (FS) for coupled transcription/translation protein expression. Additionally, it includes a protocol for optimizing production batches. In the initial version of the Leishmania cell-free system, undesired batch-to-batch variation was observed in expression levels, the fraction of full-length proteins, and the presence of protein aggregates, leading to the disposal of batches34. Subsequent protocol improvements were made to address this issue25. The current protocol builds upon these improvements, allowing individual batches to be optimized for peak protein expression and size. It achieves this by closely controlling cell-disrupter loading (measured as optical density at 600 nm; OD600nm) and normalizing the resulting lysate output using absorbance at 280 nm (Abs280nm). Furthermore, it incorporates a method for partially supplementing the lysate with rNTP and magnesium during manufacturing, with subsequent optimization of these feed solution components during test expressions. Although this optimization is presented as an option in the protocol, it is strongly recommended by the authors.

<table><tbody><tr><td>PD-10 SuperDex 25 Columns</td><td>Cytiva</td><td>17085101</td><td>Gel filtration columns</td></tr><tr><td>Nitrogen Cavitation cell disrupter</td><td>Parr Industries</td><td>4635 or 4639</td><td>Cell Disrupter</td></tr><tr><td>Bovine derived Hemin</td><td>Sigma-Aldrich</td><td>H5533</td><td>Culture additive</td></tr><tr><td>Penicillin/Streptomycin 10000U/ml</td><td>Thermo-Fisher</td><td>15140122</td><td>Antibiotic mix</td></tr><tr><td>Optiplate 384</td><td>Perkin-Elmer</td><td>6007290</td><td>Multiwell plate for 10ul expressions</td></tr><tr><td>Oligonucleotide</td><td>IDT synthesis</td><td></td><td>&amp;nbsp;Oligo with sequence CAATAAAGTACAGAAACTGATAC&lt;br/&gt;TTATATAGCGTT</td></tr><tr><td>Creatine Phosphokinase</td><td>Sigma-Aldrich</td><td>9001-15-4</td><td>Enzyme</td></tr><tr><td>Tecan Spark</td><td>Tecan</td><td></td><td>or similar Multimode Platereader</td></tr><tr><td>Chemidoc MP Imager</td><td>Biorad</td><td></td><td>or similar SDS-PAGE gel Imager</td></tr><tr><td>4-12% Bis-Tris Gels</td><td>Invitrogen</td><td>NW04125</td><td>SDS-PAGE gels</td></tr><tr><td>Biophotometer</td><td>Eppendorf</td><td></td><td>or similar Cuvette Specrophotometer</td></tr><tr><td>Nanodrop One</td><td>Thermofisher</td><td></td><td>Nanodrop spectrophotometer</td></tr><tr><td>Avanti JXN-26 centrifuge</td><td>Beckman Coulter</td><td></td><td>or similar centrifuge, with rotors/tubes rated 10K and 50K g</td></tr><tr><td>5424R microcentrifuge</td><td>Eppendorf</td><td></td><td>or similar microcentrifuge, with 1.5ml microcentrifuge tubes</td></tr><tr><td>Flask Incubator Inova S44i</td><td>Eppendorf</td><td></td><td>or similar flask incubator shaker suitable for 5L Flasks</td></tr><tr><td>5L glass culture flasks</td><td></td><td></td><td>Baffled glass flasks for culture growth</td></tr><tr><td>Bactotryptone</td><td>BD</td><td>211705</td><td>Growth medium</td></tr><tr><td>Yeast Extract</td><td>Merck</td><td>VM930053</td><td>Growth medium</td></tr><tr><td>Glycerol</td><td></td><td></td><td>Any analytical grade</td></tr><tr><td>Glucose</td><td></td><td></td><td>Any analytical grade</td></tr><tr><td>KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td></td><td></td><td>Any analytical grade</td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td></td><td></td><td>Any analytical grade</td></tr><tr><td>UltraPure water</td><td>Invitrogen</td><td>10977-015</td><td>Or output from any MilliQ-type water dispenser</td></tr></tbody></table>

production and optimization of lte, a leishmania tarentolae derived cell-free protein expression system for recombinant protein production

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate Leishmania tarentolae, referred to as Leishmania Translational Extract or LTE. Although this organism originally evolved as a parasite of geckos, it can be cultivated easily and inexpensively in flasks or bioreactors. Unlike Leishmania major, it is non-pathogenic to humans and does not require special laboratory precautions. Another advantage of using Leishmania for CFPS is that the addition of a single antisense oligonucleotide to the CFPS, targeting a conserved splice leader sequence on the 5'-end of all protein-coding RNAs, can suppress endogenous protein expression. We provide procedures for cell disruption and lysate processing, which have been simplified and improved compared to previous versions. These procedures start with simple flask cultures. Additionally, we explain how to introduce genetic information using vectors containing species-independent translation initiation sites (SITS) and how to perform straightforward batch optimization and quality control to ensure consistent protein expression quality.

The purpose of cell-free protein expression is to produce full-length proteins in a folded, active form suitable for a wide range of applications. LTE (Leishmania tarentolae extract) has previously been compared to other prokaryotic and eukaryotic cell-free expression systems, demonstrating a high capacity to avoid truncation and aggregation when operating optimally, particularly in comparison to E. coli-based cell-free expression33. However, this was previously accompanied by significant batch-to-batch variation in output quality. The current method incorporates further improvements to ensure consistent output quality, primarily through partial supplementation of the necessary feeding solution before initial freezing of the LTE in aliquots. This is followed by the optimization of the transcriptional input rNTP.Mg in a top-up solution that can be added to each subsequent reaction or used to complete the frozen aliquots directly. It is noteworthy that the optimization reactions also represent typical use of LTE to express proteins practically, with reactions carried out at 25 &#176;C for 2 h.
Data from optimizing the concentration of rNTP.Mg in cell-free reactions provides a representative dataset. Expression levels typically increase as the transcriptional input (rNTP.Mg) rises, indicating successful expression. However, a threshold is reached where the system tends toward non-productive expression of truncated products, particularly in the case of larger proteins (&#62;50 kDa). This suboptimal expression leads to a loss of fluorescence signal with increasing rNTP.Mg, particularly evident with C-terminal fluorophore fusions, where translation of the polypeptide does not reach the fluorophore itself. For N-terminal fusions, while a reduction in overall RFU (Relative Fluorescence Units) does not necessarily occur with excess rNTP.Mg, failed expression is visibly apparent on SDS-PAGE gels as multiple fluorescent products of decreasing sizes. This approach leverages the ability of GFP (Green Fluorescent Protein) to maintain fluorescence even when visualized on a conventional SDS-PAGE gel, provided samples are not heated after mixing. Instead, they are mixed with gel loading buffer and loaded directly onto the gel. While SDS-PAGE gel materials and equipment are generally interchangeable, the gel imager must be capable of visualizing GFP fluorescence. A typical configuration for GFP visualization is provided with excitation at 485 nm (bandwidth 5 nm), emission at 516 nm (bandwidth 5 nm), and a 1 min reading interval over 2 h.
Optimizing the system using the expression of eGFP alone is possible. Figure 2A,B (inset) depict typical expression outputs of optimization reactions for two LTE batches, with eGFP RFU increasing with rising rNTP.Mg concentrations, reaching an optimal level of +0.6x rNTP.Mg (Figure 2A) and +0.3x rNTP.Mg (Figure 2B) for maximum RFU. The reduced rNTP feed solution includes 0.6x rNTP.Mg, resulting in total rNTP.Mg levels of 1.2x and 0.9x the default amount for these LTE batches. Figure 2C illustrates the kinetics of RFU increase during the reaction for the LTE batch in Figure 2B, demonstrating a biphasic reaction with two discrete phases over the duration of the reaction.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65592/65592fig02.jpg" /> 
Figure 2: Optimization of rNTP.Mg top-up addition in LTE with reduced rNTP 5x FS. (A) Expression levels of eGFP after 140 min of expression from a control plasmid at varying rNTP.Mg top-up levels in the cell-free expression reaction (n = 3, Mean &#177; SD plotted). (B) Optimization of a different LTE production batch, showing reduced expression beyond a certain rNTP.Mg threshold. (C) Kinetics of eGFP accumulation in the same reactions as (B), with increasing rNTP.Mg topup. This data also represents the typical kinetics of protein accumulation in LTE batch expression. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65592/65592fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
However, it should be noted that eGFP, being a small protein (27 kDa) that is easy to fold, is likely to be expressed, folded, and matured regardless of the cell-free expression system used. Failure of the system is more likely when expressing larger proteins of interest, with truncated products becoming more apparent at input protein sizes greater than 70 kDa33. Therefore, optimizing the system with the protein(s) intended for actual use is superior, with eGFP still present for quantification but as an N-terminal fusion with the protein of interest.
Figure 3&#160;represents a typical optimization of the rNTP.Mg top-up level when using a larger protein template prone to delivering truncated products (eGFP-Sox18). Using a semi-native gel SDS-PAGE format (i.e., without heating samples), it is possible to visualize the progressive failure of expression. Optimum rNTP.Mg addition at +0.1x (combined with the 0.6x rNTP.Mg in the partial feeding solution, totaling 0.7x) clearly reduces the full-length protein band&#39;s fraction as a part of total fluorescent expression products, signifying system failure with excess rNTP.Mg addition.
As mentioned in the protocol, it is possible to skip the rNTP.Mg optimization step and directly add the full amount of rNTP.Mg in the &#34;default&#34; feeding solution during supplementation immediately after gel filtration in step 6.2. By doing this, the protocol essentially reverts to the original published methods for creating LTE34. However, the authors believe that tailoring the system for optimal performance, as demonstrated in Figure 3 (Lane D to Lane E), outweighs the additional protocol complexity and increases the value of LTE as a protein expression tool.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65592/65592fig03.jpg" /> 
Figure 3: Effect of increasing rNTP.Mg top-up on eGFP-Sox18 expression in partially supplemented LTE. Semi-native SDS-PAGE gel depicting the impact of increasing rNTP.Mg top-up on eGFP-Sox18 expression. Lane A: +0.1x (rNTP.Mg) top-up, Lane B: +0.2x (rNTP.Mg), Lane C: +0.3x (rNTP.Mg), Lane D: +0.4x (rNTP.Mg). The N-terminal eGFP fusion is visualized by fluorescence scanning of the gel. The primary band in Lane A represents full-length eGFP-Sox18. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65592/65592fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td rowspan="2">Component</td>
			<td rowspan="2">Stock&#160; concentration</td>
			<td>5x Feed Solution</td>
			<td>&#181;L stock/mL 5x Feed Solution</td>
		</tr>
		<tr>
			<td>Default (reduced rNTP)</td>
			<td>Default (reduced rNTP)</td>
		</tr>
		<tr>
			<td>Spermidine</td>
			<td>100 mM</td>
			<td>1.25 mM</td>
			<td>12</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>500 mM</td>
			<td>10 mM</td>
			<td>20</td>
		</tr>
		<tr>
			<td>Creatine Phosphate</td>
			<td>1000 mM</td>
			<td>200 mM</td>
			<td>200</td>
		</tr>
		<tr>
			<td>HEPES-KOH pH7.6</td>
			<td>2500 mM</td>
			<td>100 mM</td>
			<td>40</td>
		</tr>
		<tr>
			<td>PEG3000</td>
			<td>0.5 v/v</td>
			<td>0.05 v/v</td>
			<td>100</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail</td>
			<td>120x</td>
			<td>5x</td>
			<td>43</td>
		</tr>
		<tr>
			<td>Amino Acids</td>
			<td>3.6 mM (ea)</td>
			<td>0.68 mM (ea)</td>
			<td>190</td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>100 mM</td>
			<td>8.5 (5.1) mM</td>
			<td>85 (51)</td>
		</tr>
		<tr>
			<td>GTP</td>
			<td>100 mM</td>
			<td>3.2 (1.9) mM</td>
			<td>32 (19)&#160;</td>
		</tr>
		<tr>
			<td>UTP</td>
			<td>100 mM</td>
			<td>2.5 (1.5) mM</td>
			<td>25 (15)</td>
		</tr>
		<tr>
			<td>CTP</td>
			<td>100 mM</td>
			<td>2.5 (1.5) mM</td>
			<td>25 (15)</td>
		</tr>
		<tr>
			<td>Mg(OAc)2</td>
			<td>1M</td>
			<td>16.7 (10) mM</td>
			<td>16.7 (10)</td>
		</tr>
		<tr>
			<td>Anti-splice leader oligo</td>
			<td>1mM</td>
			<td>0.05 mM</td>
			<td>50</td>
		</tr>
		<tr>
			<td>T7 RNA polymerase</td>
			<td>5 mg/mL</td>
			<td>0.5 mg/mL</td>
			<td>100</td>
		</tr>
		<tr>
			<td>Creatine Phosphokinase</td>
			<td>5 units/&#181;L</td>
			<td>0.2 units/&#181;L</td>
			<td>42</td>
		</tr>
		<tr>
			<td>Ultrapure water</td>
			<td></td>
			<td></td>
			<td>19 (93)</td>
		</tr>
	</tbody>
</table>
Table 1: Composition of 5x Feed Solution (5x FS) for LTE. 1 mL of 5x FS is required for every 2.5 mL of unsupplemented lysate after gel filtration. Supplementing with the default 5x FS creates an expression-ready LTE for use in expression reactions at a ratio of 7 &#181;L/10 &#181;L. The reduced rNTP.Mg recipe (quantities in italics) is recommended for LTE expression optimization and contains 0.6 times the default levels of rNTPs and magnesium. These can be adjusted to variable levels (0.6 to 1.1 times) in the subsequent optimization experiment using the additions outlined in Table 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>rNTP topup</td>
			<td>ATP (100 mM)</td>
			<td>GTP (100 mM)</td>
			<td>UTP (100 mM)</td>
			<td>CTP (100 mM)</td>
			<td>MgOAc (1 M)</td>
			<td rowspan="2">Ultrapure water</td>
		</tr>
		<tr>
			<td>(1 &#181;L/10 &#181;L rxn)</td>
			<td>&#181;L/200 &#181;L</td>
			<td>&#181;L/200 &#181;L</td>
			<td>&#181;L/200 &#181;L</td>
			<td>&#181;L/200 &#181;L</td>
			<td>&#181;L/200 &#181;L</td>
		</tr>
		<tr>
			<td>+0x</td>
			<td>0</td>
			<td>0</td>
			<td>0</td>
			<td>0</td>
			<td>0</td>
			<td>200</td>
		</tr>
		<tr>
			<td>+0.1x</td>
			<td>3.4</td>
			<td>1.3</td>
			<td>1</td>
			<td>1</td>
			<td>0.7</td>
			<td>193</td>
		</tr>
		<tr>
			<td>+0.2x</td>
			<td>6.8</td>
			<td>2.5</td>
			<td>2</td>
			<td>2</td>
			<td>1.3</td>
			<td>185</td>
		</tr>
		<tr>
			<td>+0.3x</td>
			<td>10.2</td>
			<td>3.8</td>
			<td>3</td>
			<td>3</td>
			<td>2</td>
			<td>178</td>
		</tr>
		<tr>
			<td>+0.4x</td>
			<td>13.6</td>
			<td>5.1</td>
			<td>4</td>
			<td>4</td>
			<td>2.7</td>
			<td>171</td>
		</tr>
		<tr>
			<td>+0.5x</td>
			<td>17</td>
			<td>6.4</td>
			<td>5</td>
			<td>5</td>
			<td>3.3</td>
			<td>163</td>
		</tr>
	</tbody>
</table>
Table 2: Composition of (rNTP.Mg) top-up solutions for LTE optimization. These solutions are used to optimize LTE by adding 1 &#181;L of top-up solution per 10 &#181;L of protein expression reaction. Once a top-up level is determined in the optimization experiment, it can be added consistently to all subsequent protein expression reactions using the same LTE batch aliquots. Alternatively, it can be added directly to the aliquots themselves at 1 &#181;L addition per 7 &#181;L (without thawing). After thawing and mixing, these lysates are used at 8 &#181;L LTE per 10 &#181;L protein expression, maintaining the rNTP.Mg topup level established during optimization.

Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Leishmania Translational Extract (LTE) is a eukaryotic cell-free protein expression system derived from the single-celled parasite, Leishmania tarentolae. This optimized protocol makes LTE simple and cost-effective to manufacture. It is suitable for various applications focused on the multiparallel expression and study of complex eukaryotic proteins and their interactions.

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate ...

production-optimization-lte-leishmania-tarentolae-derived-cell-free

Nanyang Technological University

Without Section

Research

JoVE Journal

Bioengineering

891 Views.  Queensland University of Technology. Ons celvrije eiwitexpressiesysteem, dat doorgaans een koudeketen nodig heeft voor transport, heeft nu een baanbrekende gevriesdroogde versie. Deze versie blijft stabiel bij omgevingstemperaturen en is daarmee het eerste eukaryote systeem dat in dit formaat beschikbaar is. Dit vereenvoudigt het transport naar laboratoria en veldtoepassingen.De huidige experimentele uitdagingen van celvrije eiwitproductie omvatten het optimaliseren van reactieomstandighe...

Video: Auteur in de schijnwerpers: Eiwitproductie met behulp van het LTE eukaryote celvrije eiwitexpressiesysteem

A Parasite Rescue and Transformation Assay for Antileishmanial Screening Against Intracellular Leishmania donovani Amastigotes in THP1 Human Acute Monocytic Leukemia Cell Line

Leishmaniasis is one of the world's most neglected diseases, largely affecting the poorest of the poor, mainly in developing countries. Over 350 million people are considered at risk of contracting leishmaniasis, and approximately 2 million new cases occur yearly1. Leishmania donovani is the causative agent for visceral leishmaniasis (VL), the most fatal form of the disease. The choice of drugs available to treat leishmaniasis is limited 2;current treatments provide limited efficacy and many are toxic at therapeutic doses. In addition, most of the first line treatment drugs have already lost their utility due to increasing multiple drug resistance 3. The current pipeline of anti-leishmanial drugs is also severely depleted. Sustained efforts are needed to enrich a new anti-leishmanial drug discovery pipeline, and this endeavor relies on the availability of suitable in vitro screening models.
In vitro promastigotes 4 and axenic amastigotes assays5 are primarily used for anti-leishmanial drug screening however, may not be appropriate due to significant cellular, physiological, biochemical and molecular differences in comparison to intracellular amastigotes. Assays with macrophage-amastigotes models are considered closest to the pathophysiological conditions of leishmaniasis, and are therefore the most appropriate for in vitro screening. Differentiated, non-dividing human acute monocytic leukemia cells (THP1) (make an attractive) alternative to isolated primary macrophages and can be used for assaying anti-leishmanial activity of different compounds against intracellular amastigotes.
Here, we present a parasite-rescue and transformation assay with differentiated THP1 cells infected in vitro with Leishmania donovani for screening pure compounds and natural products extracts and determining the efficacy against the intracellular Leishmania amastigotes. The assay involves the following steps: (1) differentiation of THP1 cells to non-dividing macrophages, (2) infection of macrophages with L. donovani metacyclic promastigotes, (3) treatment of infected cells with test drugs, (4) controlled lysis of infected macrophages, (5) release/rescue of amastigotes and (6) transformation of live amastigotes to promastigotes. The assay was optimized using detergent treatment for controlled lysis of Leishmania-infected THP1 cells to achieve almost complete rescue of viable intracellular amastigotes with minimal effect on their ability to transform to promastigotes. Different macrophage:promastigotes ratios were tested to achieve maximum infection. Quantification of the infection was performed through transformation of live, rescued Leishmania amastigotes to promastigotes and evaluation of their growth by an alamarBlue fluorometric assay in 96-well microplates. This assay is comparable to the currently-used microscopic, transgenic reporter gene and digital-image analysis assays. This assay is robust and measures only the live intracellular amastigotes compared to reporter gene and image analysis assays, which may not differentiate between live and dead amastigotes. Also, the assay has been validated with a current panel of anti-leishmanial drugs and has been successfully applied to large-scale screening of pure compounds and a library of natural products fractions (Tekwani et al. unpublished).

A Parasite Rescue and Transformation Assay for Antileishmanial Screening Against Intracellular Leishmania donovani Amastigotes in THP1 Human Acute Monocytic Leukemia Cell Line

A parasite-rescue and transformation assay with THP1 cells infected in vitro with Leishmania donovani has been optimized for anti-leishmanial drug screening. The assay involves differentiation of THP1 cells, infection with promastigotes, treatment with test drugs, controlled lysis of the infected macrophages, rescue of amastigotes, transformation to promastigotes and monitoring promastigote growth and proliferation with a fluorometric assay.

Leishmaniasis is  one of the world's most neglected diseases, largely affecting the  poorest of the poor, mainly in developing countries. Over 350 million ...

Immunology and Infection

Development of Leishmania Species Strains with Constitutive Expression of eGFP

Protozoan parasites of the genus Leishmania cause leishmaniasis, a disease with variable clinical manifestations that affects millions of people worldwide. Infection with L. donovani can result in fatal visceral disease. In Panama, Colombia, and Costa Rica, L. panamensis is responsible for most of the reported cases of cutaneous and mucocutaneous leishmaniasis. Studying a large number of drug candidates with the methodologies available to date is quite difficult, given that they are very laborious for evaluating the activity of compounds against intracellular forms of the parasite or for performing in vivo assays. In this work, we describe the generation of L. panamensis and L. donovani strains with constitutive expression of the gene that encodes for an enhanced green fluorescent protein (eGFP) integrated into the locus that encodes for 18S rRNA (ssu). The gene encoding eGFP was obtained from a commercial vector and amplified by polymerase chain reaction (PCR) to enrich it and add restriction sites for the BglII and KpnI enzymes. The eGFP amplicon was isolated by agarose gel purification, digested with the enzymes BglII and KpnI, and ligated into the Leishmania expression vector pLEXSY-sat2.1 previously digested with the same set of enzymes. The expression vector with the cloned gene was propagated in E. coli, purified, and the presence of the insert was verified by colony PCR. The purified plasmid was linearized and used to transfect L. donovani and L. panamensis parasites. The integration of the gene was verified by PCR. The expression of the eGFP gene was evaluated by flow cytometry. Fluorescent parasites were cloned by limiting dilution, and clones with the highest fluorescence intensity were selected using flow cytometry.

Development of Leishmania Species Strains with Constitutive Expression of eGFP

Here, we describe the methodology used for generating L. panamensis and L. donovani strains expressing the gene for eGFP as a stable integrated transgene using the pLEXSY system. Transfected parasites were cloned by limiting dilution, and clones with the highest fluorescence intensity in both species were selected for further use in drug screening assays.

Protozoan parasites of the genus Leishmania cause leishmaniasis, a disease with variable clinical manifestations that affects millions of people ...

Genetics

CFPS Protocols for Micro-Compartmentalized Synthetic Cells

Cell-Free Protein Synthesis System for Building Synthetic Cells

The Cell-Free Protein Synthesis (CFPS) system has been widely employed to facilitate the bottom-up assembly of synthetic cells. It serves as the host for the core machinery of the Central Dogma, standing as an optimal chassis for the integration and assembly of diverse artificial cellular mimicry systems. Despite its frequent use in the fabrication of synthetic cells, establishing a tailored and robust CFPS system for a specific application remains a nontrivial challenge. In this methods paper, we present a comprehensive protocol for the CFPS system, routinely employed in constructing synthetic cells. This protocol encompasses key stages in the preparation of the CFPS system, including the cell extract, template preparation, and routine expression optimization utilizing a fluorescent reporter protein. Additionally, we show representative results by encapsulating the CFPS system within various micro-compartments, such as monolayer droplets, double-emulsion vesicles, and chambers situated atop supported lipid bilayers. Finally, we elucidate the critical steps and conditions necessary for the successful assembly of these CFPS systems in distinct environments. We expect that our approach will facilitate the establishment of good working practices among various laboratories within the continuously expanding synthetic cell community, thereby accelerating progress in the field of synthetic cell development.

Author Spotlight: Optimizing CFPS Systems for Synthetic Cell Construction

This protocol describes the Cell-Free Protein Synthesis (CFPS) system used in constructing synthetic cells. It outlines key stages with representative results in different micro-compartments. The protocol aims to establish best practices for diverse laboratories in the synthetic cell community, advancing progress in synthetic cell development.

The Cell-Free Protein Synthesis (CFPS) system has been widely employed to facilitate the bottom-up assembly of synthetic cells. It serves as the host for ...

Biochemistry

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

A Convenient and General Expression Platform for the Production of Secreted Proteins from Human Cells

Recombinant protein expression in bacteria, typically E. coli, has been the most successful strategy for milligram quantity expression of proteins. However, prokaryotic hosts are often not as appropriate for expression of human, viral or eukaryotic proteins due to toxicity of the foreign macromolecule, differences in the protein folding machinery, or due to the lack of particular co- or post-translational modifications in bacteria. Expression systems based on yeast (P. pastoris or S. cerevisiae) 1,2, baculovirus-infected insect (S. frugiperda or T. ni) cells 3, and cell-free in vitro translation systems 2,4 have been successfully used to produce mammalian proteins. Intuitively, the best match is to use a mammalian host to ensure the production of recombinant proteins that contain the proper post-translational modifications. A number of mammalian cell lines (Human Embryonic Kidney (HEK) 293, CV-1 cells in Origin carrying the SV40 larget T-antigen (COS), Chinese Hamster Ovary (CHO), and others) have been successfully utilized to overexpress milligram quantities of a number of human proteins 5-9. However, the advantages of using mammalian cells are often countered by higher costs, requirement of specialized laboratory equipment, lower protein yields, and lengthy times to develop stable expression cell lines. Increasing yield and producing proteins faster, while keeping costs low, are major factors for many academic and commercial laboratories.
Here, we describe a time- and cost-efficient, two-part procedure for the expression of secreted human proteins from adherent HEK 293T cells. This system is capable of producing microgram to milligram quantities of functional protein for structural, biophysical and biochemical studies. The first part, multiple constructs of the gene of interest are produced in parallel and transiently transfected into adherent HEK 293T cells in small scale. The detection and analysis of recombinant protein secreted into the cell culture medium is performed by western blot analysis using commercially available antibodies directed against a vector-encoded protein purification tag. Subsequently, suitable constructs for large-scale protein production are transiently transfected using polyethyleneimine (PEI) in 10-layer cell factories. Proteins secreted into litre-volumes of conditioned medium are concentrated into manageable amounts using tangential flow filtration, followed by purification by anti-HA affinity chromatography. The utility of this platform is proven by its ability to express milligram quantities of cytokines, cytokine receptors, cell surface receptors, intrinsic restriction factors, and viral glycoproteins. This method was also successfully used in the structural determination of the trimeric ebolavirus glycoprotein 5,10.
In conclusion, this platform offers ease of use, speed and scalability while maximizing protein quality and functionality. Moreover, no additional equipment, other than a standard humidified CO2 incubator, is required. This procedure may be rapidly expanded to systems of greater complexity, such as co-expression of protein complexes, antigens and antibodies, production of virus-like particles for vaccines, or production of adenoviruses or lentiviruses for transduction of difficult cell lines.

In the post-human genomics era, the availability of recombinant proteins in native conformations is crucial to structural, functional and therapeutic research and development. Here, we describe a test- and large-scale protein expression system in human embryonic kidney 293T cells that can be used to produce a variety of recombinant proteins.

Recombinant protein expression in bacteria, typically E. coli, has been the most successful strategy for milligram quantity expression of proteins. ...

Biology

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Cell-Free Scaled Production and Adjuvant Addition to a Recombinant Major Outer Membrane Protein from Chlamydia muridarum for Vaccine Development

Subunit vaccines offer advantages over more traditional inactivated or attenuated whole-cell-derived vaccines in safety, stability, and standard manufacturing. To achieve an effective protein-based subunit vaccine, the protein antigen often needs to adopt a native-like conformation. This is particularly important for pathogen-surface antigens that are membrane-bound proteins. Cell-free methods have been successfully used to produce correctly folded functional membrane protein through the co-translation of nanolipoprotein particles (NLPs), commonly known as nanodiscs. 
This strategy can be used to produce subunit vaccines consisting of membrane proteins in a lipid-bound environment. However, cell-free protein production is often limited to small scale (&lt;1 mL). The amount of protein produced in small-scale production runs is usually sufficient for biochemical and biophysical studies. However, the cell-free process needs to be scaled up, optimized, and carefully tested to obtain enough protein for vaccine studies in animal models. Other processes involved in vaccine production, such as purification, adjuvant addition, and lyophilization, need to be optimized in parallel. This paper reports the development of a scaled-up protocol to express, purify, and formulate a membrane-bound protein subunit vaccine. 
Scaled-up cell-free reactions require optimization of plasmid concentrations and ratios when using multiple plasmid expression vectors, lipid selection, and adjuvant addition for high-level production of formulated nanolipoprotein particles. The method is demonstrated here with the expression of a chlamydial major outer membrane protein (MOMP) but may be widely applied to other membrane protein antigens. Antigen effectiveness can be evaluated in vivo through immunization studies to measure antibody production, as demonstrated here.

Cell-Free Scaled Production and Adjuvant Addition to a Recombinant Major Outer Membrane Protein from Chlamydia muridarum for Vaccine Development

This protocol describes using commercial, cell-free protein expression kits to produce membrane proteins supported in nanodisc that can be used as antigens in subunit vaccines.

Subunit vaccines offer advantages over more traditional inactivated or attenuated whole-cell-derived vaccines in safety, stability, and standard ...

Recombinant Protein Expression for Structural Biology in HEK 293F Suspension Cells: A Novel and Accessible Approach

The expression and purification of large amounts of recombinant protein complexes is an essential requirement for structural biology studies. For over two decades, prokaryotic expression systems such as E. coli have dominated the scientific literature over costly and less efficient eukaryotic cell lines. Despite the clear advantage in terms of yields and costs of expressing recombinant proteins in bacteria, the absence of specific co-factors, chaperones and post-translational modifications may cause loss of function, mis-folding and can disrupt protein-protein interactions of certain eukaryotic multi-subunit complexes, surface receptors and secreted proteins. The use of mammalian cell expression systems can address these drawbacks since they provide a eukaryotic expression environment. However, low protein yields and high costs of such methods have until recently limited their use for structural biology. Here we describe a simple and accessible method for expressing and purifying milligram quantities of protein by performing transient transfections of suspension grown HEK (Human Embryonic Kidney) 293F cells.

The expression of recombinant proteins by mammalian systems is becoming an attractive method for producing protein complexes for structural biology. Here we present a simple yet highly efficient expression system using suspension grown mammalian cells to purify protein complexes for structural studies.

The expression and purification of large amounts of recombinant protein complexes is an essential requirement for structural biology studies. For over two ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...

HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins

Malaria causes significant global morbidity and mortality. No routine vaccine is currently available. One of the major reasons for lack of a vaccine is the challenge of identifying suitable vaccine candidates. Malarial proteins expressed using prokaryotic and eukaryotic cell based expression systems are poorly glycosylated, generally insoluble and undergo improper folding leading to reduced immunogenicity. The wheat germ, rabbit reticulocyte lysate and Escherichia coli lysate cell free expression systems are currently used for expression of malarial proteins. However, the length of expression time and improper glycosylation of proteins still remains a challenge. We demonstrate expression of Plasmodium proteins in vitro using HeLa based cell free expression systems, termed &#8220;in vitro human cell free expression systems&#8221;. The 2 HeLa based cell free expression systems transcribe mRNA in 75 min and 3 &#181;l of transcribed mRNA is sufficient to translate proteins in 90 min. The 1-step expression system is a transcription and translation coupled expression system; the transcription and co-translation occurs in 3 hr. The process can also be extended for 6 hr by providing additional energy. In the 2-step expression system, mRNA is first transcribed and then added to the translation mix for protein expression. We describe how to express malaria proteins; a hydrophobic PF3D7_0114100 Maurer&#8217;s Cleft &#8211; 2 transmembrane (PfMC-2TM) protein, a hydrophilic PF3D7_0925900 protein and an armadillo repeats containing protein PF3D7_1361800, using the HeLa based cell free expression system. The proteins are expressed in micro volumes employing 2-step and 1-step expression strategies. An affinity purification method to purify 25 &#181;l of proteins expressed using the in vitro human cell free expression system is also described. Protein yield is determined by Bradford&#8217;s assay and the expressed and purified proteins can be confirmed by western blotting analysis. Expressed recombinant proteins can be used for immunizations, immunoassays and protein sequencing.

HeLa Based Cell Free Expression Systems for Expression of Plasmodium Rhoptry Proteins

Expression of malarial proteins in cell based systems remains challenging. We demonstrate two step and one step IVT (in vitro translation) cell free expression systems for expressing malarial recombinant rhoptry proteins from HeLa cells. We use a Ni-resin affinity based purification system to purify the rhoptry proteins.

Malaria causes significant global morbidity and mortality. No routine vaccine is currently available. One of the major reasons for lack of a vaccine is ...

Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Samenvatting

Meer video's verkennen