JEK is supported by grants from Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo [FAPESP-INCT-20214/50889-7 and 2013/17368-0] and Conselho Nacional de Desenvolvimento Cient&#237;fico e Tecnol&#243;gico-CNPq (INCT-465586/2014-7 and 309179/2013-0). AAM is supported by grants from Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP 2015/11139-5) and Conselho Nacional de Desenvolvimento Cient&#237;fico e Tecnol&#243;gico-CNPq (Universal - 407911/2021-9).

Unused segments of saphenous veins were obtained from patients undergoing aortocoronary bypass surgery at the Heart Institute (InCor), University of S&#227;o Paulo Medical School. All individuals gave informed consent to participate in the study, which was reviewed and approved by the local ethics committee.
1. Isolation, culture, and characterization of primary human saphenous vein endothelial cells (hSVECs)
<ol>
	<li>Preparation
	<ol>
		<li>Autoclave a pair of straight or curved forceps and tissue scissors (7-8 cm).</li>
		<li>Prepare sterile gelatin. Mix 0.1 g (0.1% w/v) or 3 g (3% w/v) of porcine skin gelatin with 100 mL of ultrapure water, autoclave for 15 min, and store at 4 &#176;C. Warm to 37 &#176;C to liquefy before coating the cell culture dishes and slides.</li>
		<li>Prepare sterile collagenase (1 mg/mL) inside the laminar flow hood. Dilute the collagenase in PBS and sterilize it with a 0.2 &#181;m filter.</li>
		<li>Coat a 60 mm cell culture dish and an 8-well chamber slide with 0.1% w/v gelatin for at least 30 min at 37 &#176;C. Remove the excess gelatin prior to seeding the cells.</li>
		<li>Prepare complete endothelial cell medium: endothelial cell growth basal medium (EBM-2) supplemented with EGM2 growth factors. 
		NOTE: The EGM2 growth factors is supplied as a kit by a company listed in the Table of Materials. The concentration of the factors is not disclosed by the company.</li>
		<li>Make 2% and 5% bovine serum albumin (BSA), 4% paraformaldehyde (PFA), and 0.1% Triton X-100 solutions, all in phosphate-buffered saline (PBS).</li>
	</ol>
	</li>
	<li>Isolation and culture of hSVECs
	<ol>
		<li>Collect at least a 2-3 cm long saphenous vein segment for this procedure. 
		NOTE. All the cell culture procedures must be carried out under sterile conditions and inside a laminar flow hood.</li>
		<li>Transfer the vein segment to a Petri dish filled with pre-warmed PBS. Insert a pipette tip into one end of the vein and gently flush with PBS to remove all the blood inside the lumen. Flush it until the washing flow becomes completely clear.</li>
		<li>Close one of the ends of the vein with a sterile cotton suture. Carefully fill the vessel with 1 mg/mL collagenase type II solution. Close the other end of the vessel with a cotton suture (Figure 1A). Incubate the vessel with collagenase solution in a humidified atmosphere of 5% CO2 at 37 &#176;C for 1 h.</li>
		<li>After that, cut one of the ends of the vessel inside a 15 mL tube and collect the collagenase solution. Cut the other end and flush the luminal surface with 1-2 mL of PBS to collect all the detached ECs. Put all the PBS together with collagenase solution inside the same tube.</li>
		<li>Centrifuge the tube at 400 x g for 5 min at room temperature (RT) to pellet the cells. 
		&#8203;NOTE. The cell pellet is very small and difficult to visualize. If the blood is not completely removed before collagenase treatment (step 1.2.2.), the blood cells will also precipitate, and the pellet will be reddish.</li>
		<li>Remove the supernatant and resuspend the cell pellet in 3-4 mL of complete endothelial cell medium (EBM-2 supplemented with EGM2 growth factors) and an additional heparin solution (5 U/mL, final concentration). Plate the cells in a 60 mm cell culture dish pre-coated with 3% w/v gelatin. 
		NOTE: Gelatin was the first choice due to its ease of accessibility and low cost. As the coating with gelatin successfully maintains the EC phenotype, no other coating substance was tested. Collagens and fibronectin can be tested in studies aiming to investigate the influence of different extracellular matrix components on EC adhesion and the phenotype.</li>
		<li>Incubate the cells at 37 &#176;C in a humidified atmosphere with 5% CO2 for 4 days without changing the medium. After that, change the media every other day. From this moment on, the additional cell media supplementation with heparin is no longer necessary. Examine the plate under the microscope to ensure that the red blood cells were removed.</li>
		<li>After 3-10&#160;days post-extraction, depending on the size and diameter of the vein segment, visualize the hSVECs by phase-contrast microscopy.</li>
		<li>Evaluate the degree of confluence and their cobblestone morphology in phase-contrast microscopy.</li>
		<li>Continue changing the media every 2 days until the cells reach 70%-80% confluency.</li>
		<li>Passage the hSVECs with 0.25% trypsin-0.02% ethylenediaminetetraacetic acid (EDTA) solution.
		<ol>
			<li>Wash the cells with pre-warmed PBS.</li>
			<li>Add 1 mL of trypsin-EDTA solution to the 60 mm cell culture dish. Incubate at 37 &#176;C for 2 min or until all the cells are detached.</li>
			<li>Add 2 mL of complete endothelial cell medium to inactivate the trypsin.</li>
			<li>Transfer the cell suspension to a 15 mL tube and centrifuge at 300 x g for 3 min at RT.</li>
			<li>Discard the supernatant and resuspend the cells in 1 mL of culture medium.</li>
			<li>Count the cell suspension in 1:1 trypan blue (0.4%) to plate viable cells.</li>
			<li>To expand the culture, plate the cells in a 100 mm cell culture dish with 10 mL of pre-warmed complete endothelial cell medium and culture it at 37 &#176;C in a humidified atmosphere with 5% CO2. 
			NOTE. On average, the seeding of 4 x 104 hSVEC/cm2 will be 100% confluent after 48 h.</li>
		</ol>
		</li>
		<li>To cryopreserve the cells, resuspend the pellet from step 1.2.11.5 in 5% dimethyl sulfoxide (DMSO) in fetal bovine serum (FBS) and store in liquid nitrogen.</li>
	</ol>
	</li>
	<li>Characterization of hSVECs: Flow cytometry staining for CD31
	<ol>
		<li>Transfer 1 x 105 hSVECs to one 1.5 mL tube and centrifuge at 300 x g for 3 min at RT. Discard the supernatant and resuspend the pellet in 100 &#181;L of PBS containing 2% BSA and CD31-FITC monoclonal antibody (1:100).</li>
		<li>Stain the cells for 30 min at RT in the dark.</li>
		<li>Wash the stained cells by adding 0.5 mL of PBS and centrifuge them at 300 x g for 3 min at RT. Discard the supernatant and resuspend the cell pellet in 400 &#181;L of PBS with 2% BSA.</li>
		<li>Use unlabeled hSVECs, without CD31 antibody, as the negative control.</li>
		<li>Proceed to flow cytometer acquisition analysis using a blue laser and FITC channel (excitation/emission max [Ex/Em] of 498/517 nm). If other fluorochromes are used, check whether the cytometer has appropriate filter sets for their detection. Separate the cells from debris in the function of their size and granularity, then gate single cells by forward scatter and side scatter.</li>
	</ol>
	</li>
	<li>Characterization of hSVECs: Fluorescent staining for CD31 and VE-cadherin
	<ol>
		<li>Plate 0.1 x 105 cells in the gelatin-coated 8-well chamber slide. Incubate the cells overnight at 37 &#176;C, 5 % CO2, to allow the cells to attach to the culture surface.</li>
		<li>Remove the medium and wash the cells once with PBS.</li>
		<li>Add 0.3 mL/well of 4% PFA to fix the cells. Incubate for 15 min at RT.</li>
		<li>Wash three times with PBS.</li>
		<li>Add 0.3 mL/well of 0.1% Triton X-100 solution to permeabilize the cells. Incubate for 15 min at RT.</li>
		<li>Wash three times with PBS.</li>
		<li>To block non-specific antibody binding sites, add 0.3 mL/well of 5% BSA solution to the cells. Incubate for 15 min at RT.</li>
		<li>Wash three times with PBS.</li>
		<li>Incubate the cells with the primary antibodies (CD31 and VE-cadherin, 1:100) diluted in PBS with 2% BSA overnight with gentle rocking at 4 &#176;C. Leave one well incubating with PBS with 2% BSA (no primary antibody) as the negative control.</li>
		<li>Wash three times with PBS.</li>
		<li>Incubate the cells with fluorescently labeled secondary antibodies diluted (1:500) in PBS for 1 h at RT. Add 4&#39;,6-diamidino-2-phenylindole (DAPI) for nuclear staining to a final concentration of 1 mg/mL.</li>
		<li>Wash three times with PBS.</li>
		<li>Remove the media chamber with the separator. Place one drop of the mounting medium reagent (50% glycerol in PBS) and place a glass slide (24 mm x 60 mm) while avoiding trapping bubbles.</li>
		<li>Observe the cells under a fluorescence microscope. 
		&#8203;NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm), and CD31/VE-cadherin is detected using a green fluorescent protein (GFP) light cube (Ex: 459-481 nm; Em: 500-550 nm). Light cubes with a similar excitation/emission wavelength range are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.</li>
	</ol>
	</li>
</ol>
2. Shear stress on hSVECs
<ol>
	<li>Preparation
	<ol>
		<li>Coat the flow chamber slide with 0.1% w/v gelatin for at least 30 min at 37 &#176;C. Remove excess gelatin prior to seeding the cells.</li>
		<li>Equilibrate the fluidic unit and sterile perfusion set with 10 mL reservoirs overnight inside the incubator in a humidified atmosphere of 5% CO2 at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Shear stress experiment
	<ol>
		<li>Seed 2 x 105 ECs suspended in 100 &#181;L of EC medium into the gelatin-coated flow chamber slide. Incubate the cells for 4 h at 37 &#176;C and 5% CO2 to allow the cells to attach to the culture surface.</li>
		<li>Place the perfusion set on the fluidic unit as described in the manufacturer&#39;s instructions. Fill the reservoirs and the perfusion set in&#160;about 12 mL of pre-warmed complete endothelial cell medium. Remove manually air bubbles from the perfusion set to equilibrate the level of both reservoirs at 5 mL.</li>
		<li>Place the fluidic unit with the mounted perfusion set, without the chamber slide, in the incubator and connect its electric cable to the computer-regulated pump. Remove all air bubbles from the reservoirs and perfusion set, running a predefined protocol in the pump control software. 
		NOTE. It is very important to remove air bubbles for the system to function correctly.</li>
		<li>Take the fluidic unit with the mounted perfusion set to the laminar flow hood and attach the slides with a confluent cell monolayer.</li>
		<li>Place the fluidic unit with the mounted perfusion and slides with cells in the incubator and connect its electric cable to the pump.</li>
		<li>In the pump control software, set up the following parameters: viscosity of the medium (0.0072), type of slide, perfusion set calibration factor, shear stress rate (20 dyn/cm2), type of flow (unidirectional), and time (72 h), and start the flow (see the equipment instructions for further details). Harvest the cells treated with the same media without exposure to flow as static controls.</li>
		<li>After the stimulus is completed, wash the cells once with PBS and proceed to harvest the samples according to the required assay. For fluorescent staining, see step 2.3.1, and for RNA extraction, see step 2.3.2.</li>
	</ol>
	</li>
	<li>Demonstration of the effectiveness of the shear stress protocol
	<ol>
		<li>Fluorescent staining of actin filaments (F-actin)
		<ol>
			<li>Fix and permeabilize the cells as indicated in steps 1.4.2-1.4.6. Use a volume of 100 &#181;L in the &#181;-slide.</li>
			<li>Stain the F-actin with fluorescent-labeled phalloidin (diluted at 1:200 in PBS) and counterstain the nucleus with DAPI (final concentration of 1 mg/mL in PBS) for 2 h at RT, protected from light.</li>
			<li>Wash three times with PBS.</li>
			<li>Observe the cells under a fluorescence microscope. 
			NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm) and phalloidin is detected with a GFP light cube (Ex: 459-481 nm; Em: 500-550 nm). Light cubes with a similar range of excitation/emission wavelength are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.</li>
		</ol>
		</li>
		<li>Gene expression by real-time quantitative reverse transcription (RT-qPCR)
		<ol>
			<li>Collect the cells from the &#181;-slide with 350 &#181;L of a commercial&#160;guanidine-thiocyanate-containing lysis buffer. Isolate the total RNA with column-based extraction kits, according to the manufacturer&#39;s instructions. 
			NOTE: Due to the limited number of cells cultured in the &#181;-slide, the use of column-based extraction of RNA is recommended.</li>
			<li>Prepare cDNA using a cDNA synthesis kit with transcriptase reverse enzyme, according to the manufacturer&#39;s instructions.</li>
			<li>Verify the expression of the gene(s) regulated by shear stress: KLF2, KLF4, and NOS3. Use the housekeeper gene PPIA/cyclophilin to normalize the results. The specific primers for the reaction are listed in Table 1.</li>
			<li>Perform RT-qPCR using an SYBR green fluorescent DNA stain kit under the following reaction conditions: i) 50 &#176;C for 2 min, ii) 95 &#176;C for 15 min, iii) 94 &#176;C for 15 s, iv) 60 &#176;C for 30 s, v) 72 &#176;C for 30 s. Repeat steps iii through v for 40 cycles. Add a melting step at the end of the reaction to verify the primer&#39;s specificity.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
3. Cyclic stretch on hSVECs
<ol>
	<li>Preparation
	<ol>
		<li>Apply silicone-based lubricant to the tops and sides of the 6-well equibiaxial loading station of 25 mm. 
		NOTE: This reduces friction between the culture plate membrane and the station, allowing better distribution of the cyclic strain. This step must be done before each experiment.</li>
	</ol>
	</li>
	<li>Cyclic stretch experiment
	<ol>
		<li>Seed 4 x 105 cells suspended in 3 mL to each well of the 6-well flexible-bottomed culture plates coated with collagen I (Table of Materials). Plan to have a plate(s) in static condition as a control group. Keep the cells in the incubator (37 &#176;C in humidified air with 5% CO2) until they reach 100% confluency (usually 48 h after seeding). Prior to the start of the stretch protocol, wash the cells once with pre-warmed PBS and add 3 mL of fresh culture medium per well.</li>
		<li>Insert the baseplate with all lubricated loading stations in the incubator and appropriately connect the tubing with the controller equipment of the tension cell stretching bioreactor system (see the equipment instructions for further details).</li>
		<li>Attach each culture plate to one red gasket, provided by the tension cell stretching bioreactor system. Then, put them into the baseplate inside the incubator.
		<ol>
			<li>Make sure the plates are fully seated, pressed, and sealed to the baseplate to avoid air leaking during the vacuum pumping. It is important to have all four culture plates in the baseplate to have the proper vacuum and the stretching loading.</li>
			<li>In case of having fewer experimental plates, use an empty one(s) to complete the four positions in the baseplate. Add the acrylic sheet (supplied with the equipment) on top of the culture plates to improve the baseplate sealing. Place the static plates in the same incubator.</li>
		</ol>
		</li>
		<li>Turn on the controller equipment and the computer system. Open the software icon and configure the desired regimen: size of the loading station to be used, type of strain, percentage of elongation, waveform shape, frequency, and time. For detailed information, see the manufacturer&#39;s instructions. Select and download the regimen. Here, the following regimen was used: 1/2 sinus waveform shape, 1 Hz frequency, 5% of elongation (to mimic venous stretch), and 15% of elongation (to mimic arterial stretch) up to 72 h.</li>
		<li>Turn on the vacuum system and click on Start on the computer screen&#160;to run the stretching. Check if the silicone membrane is moving and stretching the cells.</li>
		<li>After the stimulus is completed, wash the cells once with PBS and proceed to harvest the samples according to the required assay. Here, to demonstrate the effectiveness of cyclic stretch, collect the hSVEC culture medium, keep it at -80 &#176;C for further nitric oxide (NO) measurement, and fix the cells for fluorescent staining. 
		NOTE. The baseplate cannot be stored inside the incubator when not in use; otherwise, the temperature can modify the flat shape and make it useless.</li>
	</ol>
	</li>
	<li>Demonstration of the effectiveness of the cyclic stretch protocol
	<ol>
		<li>Fluorescent staining of F-actin
		<ol>
			<li>Fix the cells as indicated in step 1.4.3. Use a volume of 1 mL per well.</li>
			<li>Wash the cells three times with PBS. Maintain the cells in PBS so they do not dry while preparing the silicone membrane for the next steps.</li>
			<li>Use a cotton swab to remove the excess silicone-based lubricant from the bottom of the membrane. Then, gently apply window cleaner or hand soap with a new cotton swab. Repeat the process until all the lubricant is removed from the membrane. Then, clean with deionized water. 
			NOTE. It is important to completely remove the lubricant from the silicone membrane to have microscopy images of good quality.</li>
			<li>Carefully cut the silicone membranes into small pieces to fit on 8-well chamber slides for staining. Permeabilize the cells as indicated in step 1.4.5.</li>
			<li>After the washing steps, stain the F-actin using phalloidin and the nucleus with DAPI. Proceed to the analysis, as indicated in steps 2.3.1.2 and 2.3.1.3. Use a volume of 0.3 mL per chamber well.</li>
			<li>Remove the media chamber with the separator. Place one drop of mounting medium reagent (50% glycerol in PBS) and place a glass slide (24 mm x 60 mm).</li>
			<li>Observe the cells under a fluorescence microscope. 
			NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm) and phalloidin is detected with a red fluorescent protein (RFP) light cube (Ex: 511-551 nm; Em: 573-613 nm). Light cubes with a similar range of excitation/emission wavelength are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.</li>
		</ol>
		</li>
		<li>NO measurement-estimated by the nitrite (NO2) accumulation in the hSVEC conditioned medium using a potassium iodide-based reductive chemiluminescence assay
		<ol>
			<li>Preparation
			<ol>
				<li>Prepare a standard curve from 0.01-10 mM of sodium nitrite (NaNO2 in ultrapure water) solution.</li>
				<li>Add 5 mL of acetic acid and 1 mL of potassium iodide (50 mg in 1 mL of ultrapure water) into the purge vessel of the nitric oxide analyzer.</li>
			</ol>
			</li>
			<li>NO measurement
			<ol>
				<li>Add 20 &#181;L of the NaNO2 standard curve into the purge vessel of the nitric oxide analyzer. Measure it according to the manufacturer&#39;s protocol.</li>
			</ol>
			</li>
		</ol>
		</li>
		<li>Add 20 &#181;L of the conditioned medium into the purge vessel of the nitric oxide analyzer. Measure it according to the manufacturer&#39;s protocol.</li>
		<li>Calculate the NO2 concentrations based on the standard curve calibration. Adjust the values obtained by the total volume of the conditioned medium analyzed6,11.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Allaire, E., Clowes, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+injury+in+cardiovascular+surgery:+the+intimal+hyperplastic+response.">Endothelial cell injury in cardiovascular surgery: the intimal hyperplastic response.</a> The Annals of Thoracic Surgery. 63 (2), 582-591 (1997).</li><li>Ali, M. H., Schumacker, P. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+responses+to+mechanical+stress:+where+is+the+mechanosensor.">Endothelial responses to mechanical stress: where is the mechanosensor.</a> Critical Care Medicine. 30 (5), S198-S206 (2002).</li><li>Ward, A. O., Caputo, M., Angelini, G. D., George, S. J., Zakkar, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+and+inflammation+of+the+venous+endothelium+in+vein+graft+disease.">Activation and inflammation of the venous endothelium in vein graft disease.</a> Atherosclerosis. 265, 266-274 (2017).</li><li>Ward, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-&#954;B+inhibition+prevents+acute+shear+stress-induced+inflammation+in+the+saphenous+vein+graft+endothelium.">NF-&#954;B inhibition prevents acute shear stress-induced inflammation in the saphenous vein graft endothelium.</a> Scientific Reports. 10 (1), 15133 (2020).</li><li>Golledge, J., Turner, R. J., Harley, S. L., Springall, D. R., Powell, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circumferential+deformation+and+shear+stress+induce+differential+responses+in+saphenous+vein+endothelium+exposed+to+arterial+flow.">Circumferential deformation and shear stress induce differential responses in saphenous vein endothelium exposed to arterial flow.</a> The Journal of Clinical Investigation. 99 (11), 2719-2726 (1997).</li><li>Gir&#227;o-Silva, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+stretch+induces+endothelial+dysfunction+accompanied+by+oxidative+stress+and+actin+remodeling+in+human+saphenous+vein+endothelial+cells.">High stretch induces endothelial dysfunction accompanied by oxidative stress and actin remodeling in human saphenous vein endothelial cells.</a> Scientific Reports. 11 (1), 13493 (2021).</li><li>Ataollahi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+method+for+the+isolation+of+endothelial+cells+from+large+vessels.">New method for the isolation of endothelial cells from large vessels.</a> Cytotherapy. 16 (8), 1145-1152 (2014).</li><li>Torres, C., Machado, R., Lima, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+characterization+of+the+saphenous+veins+endothelial+cells+in+patients+with+chronic+venous+disease+and+in+patients+undergoing+bypass+surgery:+an+exploratory+study.">Flow cytometric characterization of the saphenous veins endothelial cells in patients with chronic venous disease and in patients undergoing bypass surgery: an exploratory study.</a> Heart and Vessels. 35 (1), 1-13 (2020).</li><li>Aird, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+heterogeneity+of+the+endothelium:+II.+Representative+vascular+beds.">Phenotypic heterogeneity of the endothelium: II. Representative vascular beds.</a> Circulation Research. 100 (2), 174-190 (2007).</li><li>Jambusaria, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+heterogeneity+across+distinct+vascular+beds+during+homeostasis+and+inflammation.">Endothelial heterogeneity across distinct vascular beds during homeostasis and inflammation.</a> eLife. 9, e51413 (2020).</li><li>Carneiro, A. P., Fonseca-Alaniz, M. H., Dallan, L. A. O., Miyakawa, A. A., Krieger, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#946;-arrestin+is+critical+for+early+shear+stress-induced+Akt/eNOS+activation+in+human+vascular+endothelial+cells.">&#946;-arrestin is critical for early shear stress-induced Akt/eNOS activation in human vascular endothelial cells.</a> Biochemical and Biophysical Research Communications. 483 (1), 75-81 (2017).</li><li>Davis, M. E., Cai, H., Drummond, G. R., Harrison, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+regulates+endothelial+nitric+oxide+synthase+expression+through+c-Src+by+divergent+signaling+pathways.">Stress regulates endothelial nitric oxide synthase expression through c-Src by divergent signaling pathways.</a> Circulation Research. 89 (11), 1073-1080 (2001).</li><li>Dekker, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+fluid+shear+stress+induces+a+distinct+set+of+endothelial+cell+genes,+most+specifically+lung+Kruppel-like+factor+(KLF2).">Prolonged fluid shear stress induces a distinct set of endothelial cell genes, most specifically lung Kruppel-like factor (KLF2).</a> Blood. 100 (5), 1689-1698 (2002).</li><li>Hamik, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kruppel-like+factor+4+regulates+endothelial+inflammation.">Kruppel-like factor 4 regulates endothelial inflammation.</a> The Journal of Biological Chemistry. 282 (18), 13769-13779 (2007).</li><li>Beamish, J. A., He, P., Kottke-Marchant, K., Marchant, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+contractile+smooth+muscle+cell+phenotype:+implications+for+vascular+tissue+engineering.">Molecular regulation of contractile smooth muscle cell phenotype: implications for vascular tissue engineering.</a> Tissue Engineering. Part B, Reviews. 16 (5), 467-491 (2010).</li></ol>

The authors have no conflicts of interest to disclose.

The saphenous vein segment should have be least 2 cm to successfully isolate hSVECs. Small segments are difficult to handle and tie the ends of the vessel to maintain the collagenase solution to isolate the cells. The reduced luminal surface area does not yield sufficient cells to expand the culture. To minimize the risk of contamination with non-ECs, the manipulation of the saphenous vein segment needs to be very gentle during the entire procedure. It is important to be careful when introducing the pipette tips into the luminal surfaces to remove blood and during the introduction of the collagenase solution. The exposure to enzyme solution should be very well controlled (no longer than 1 h) to reduce the contamination of the culture with non-ECs. The use of a specific EC medium supplemented with the growth factors cocktail is crucial for the hSVEC culture growth. The additional heparin during the first days of culture is important to reduce residual red blood cells from the vein segment and to inhibit smooth muscle cell proliferation15. When passing the cells for experiments or for maintaining the culture, make sure to plate the cells with a confluence higher than 40%. The ECs need minimum contact to ensure good proliferation and survival. The hSVECs can easily be cultured on a non-coated (e.g., gelatin or fibronectin) surface. However, the coating during the first days after EC extraction will increase EC adhesion and yield. The hSVECs have a constant proliferation rate and maintain the endothelial phenotype up to eight passages, without expressing mesenchymal cell markers (such as SM22 and calponin). In our experience, the proliferation rate may vary depending on the tissue donor but not with a cell passage. It is recommended to cryopreserve hSVECs in FBS with 5% DMSO to increase the viability after thawing the cells.
To conduct a shear stress experiment, there are critical steps to be considered. To avoid air bubbles forming inside the system, the perfusion set and connectors must be equilibrated overnight at 37 &#176;C and 5% CO2. The bubbles can block the flow through the system or damage the endothelial monolayer interfering with the cell phenotype. When seeding the cells into the flow chamber slide, it is recommended to have it confluent to use after 4 h or on the next day. Additionally, it is mandatory to change the medium of the slide every day at static conditions if the experiment runs for several days. The volume of the flow chamber slide is ~160 &#181;L, and it is not sufficient to maintain the cells for long periods of culture. The system has the advantage of readily observing the cells by microscopy (brightfield/phase-contrast or staining for fluorescence microscopy). The limitation is the low yield of proteins (20-25 &#181;g/slide) and RNA (1 &#181;g/slide). To overcome this, the system allows the connection of several slides in a series using the same fluidic unit (see the manufacturer&#39;s instructions). Then, it is possible to use the volume of the lysis buffer for one slide to extract the protein or RNA from several slides.
The stretch system is easy to handle and allows the application of different intensities and types of stretching. It is important to lubricate all loading stations before each experiment to reduce friction between the culture plate membrane and the station and to guarantee proper distribution of the cyclic strain. Assure that the plates are completely sealed to the baseplate to produce the vacuum necessary to reach the desired stretch. The equiaxial stimulus does not produce a uniform strain inside the well. The cells at the edge of the well need to be discarded, as indicated by the manufacturer. The membrane area of interest is determined based on the loading station diameter and the percentage of elongation. It is possible to perform the immunostaining in the entire membrane or cut it into smaller pieces to reduce the quantity of antibodies used in the assay. In this case, the membranes must be handled very carefully, avoiding damage to the cells. Researchers should also take care not to turn the membrane upside down and lose the cells while doing the staining. It is always possible to confirm the correct face of the membrane with the cells under optic microscopy.
The major limitation of in vitro studies like these is that they do not fully recapitulate the in vivo environment. For this reason, it is important to always perform analysis to ensure that hSVECs maintain the EC phenotype (expressing EC markers) and reproduces expected results under mechanical stress (F-actin orientation and regulation/production of mechanical response proteins).
In summary, we provide a detailed procedure to isolate hSVECs and expose them to controlled levels of shear stress and stretch. When an SV graft is suddenly exposed to arterial conditions after CABG, endothelial damage occurs and contributes to graft failure. These protocols may be instrumental in advancing our understanding of how mechanical forces influence hSVEC dysfunction associated with vein graft disease.

Endothelial cell (EC) dysfunction is a key player in saphenous vein graft failure1,2,3,4. The sustained increase of shear stress and cyclic stretch induces the proinflammatory phenotype of human saphenous vein endothelial cells (hSVECs)3,4,5,6. The underlying molecular pathways are still not fully understood, and standardized protocols for in vitro studies may leverage the efforts for novel insights in the area. Here, we describe a simple protocol to isolate, characterize, and expand hSVECs and how to expose them to variable levels of shear stress and cyclic stretch, mimicking the venous and arterial hemodynamic conditions.
hSVECs are isolated by collagenase incubation and can be used up to passage 8. This protocol requires less manipulation of the vessel compared with the other available protocols7, which reduces contamination with smooth muscle cells and fibroblasts. On the other hand, it requires a larger vessel segment of at least 2 cm to have efficient EC extraction. In the literature, it has been reported that ECs from large vessels can also be obtained by mechanical removal7,8. Although effective, the physical approach has the disadvantages of low EC yield and higher fibroblast contamination. To increase the purity, extra steps are needed using magnetic beads or cell sorting, increasing the cost of the protocol due to the acquisition of beads and antibodies7,8. The enzymatic method has faster and better outcomes regarding EC purity and viability7,8.
The most frequently used ECs to study endothelial dysfunction are human umbilical vein endothelial cells (HUVECs). It is known that the EC phenotype changes in different vascular beds, and it is essential to develop methods that represent the vessel under investigation9,10. In this respect, the establishment of a protocol to isolate a hSVEC and culture it under mechanical stress is a valuable tool to understand the contribution of hSVEC dysfunction in vein graft disease.

<table><tbody><tr><td>0.25% Trypsin-0.02% EDTA solution</td><td>Gibco</td><td>25200072</td><td></td></tr><tr><td>15 &amp;micro; slide I 0.4 Luer&amp;nbsp;</td><td>Ibidi</td><td>80176</td><td></td></tr><tr><td>4&#039;,6-Diamidino-2-Phenylindole, Dilactate (DAPI)</td><td>Thermo Fisher Scientific</td><td>D3571</td><td></td></tr><tr><td>6-wells equibiaxial loading station of 25 mm&amp;nbsp;</td><td>Flexcell International Corporation</td><td>LS-3000B25.VJW</td><td></td></tr><tr><td>8-well chamber slide with removable well</td><td>Thermo Fisher Scientific</td><td>154453</td><td></td></tr><tr><td>Acetic Acid (Glacial)</td><td>Millipore</td><td>100063</td><td></td></tr><tr><td>Acrylic sheet 1 cm thick</td><td>Plexiglass</td><td></td><td></td></tr><tr><td>Anti-CD31 antibody</td><td>Abcam</td><td>ab24590</td><td></td></tr><tr><td>Anti-CD31, FITC antibody</td><td>Thermo Fisher Scientific</td><td>MHCD3101</td><td></td></tr><tr><td>Anti-VE-cadherin antibody</td><td>Cell Signaling</td><td>2500</td><td></td></tr><tr><td>Bioflex plates collagen I</td><td>Flexcell International Corporation</td><td>BF3001C</td><td></td></tr><tr><td>Bovine serum albumin solution</td><td>Sigma-Aldrich</td><td>A8412</td><td></td></tr><tr><td>Cotton suture EP 3.5 15 x 45 cm</td><td>Brasuture</td><td>AP524</td><td></td></tr><tr><td>Cyclophilin forward primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>Cyclophilin reverse primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>Dimethyl sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D4540</td><td></td></tr><tr><td>EBM-2 basal medium</td><td>Lonza</td><td>CC3156</td><td></td></tr><tr><td>EGM-2 SingleQuots supplements</td><td>Lonza</td><td>CC4176</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Thermo Fisher Scientific</td><td>2657-029</td><td></td></tr><tr><td>Flexcell FX-5000 tension system</td><td>Flexcell International Corporation</td><td>FX-5000T</td><td></td></tr><tr><td>Fluoromount aqueous mounting medium</td><td>Sigma-Aldrich</td><td>F4680</td><td></td></tr><tr><td>Gelatin from porcine skin</td><td>Sigma-Aldrich</td><td>G2500</td><td></td></tr><tr><td>Glycerol</td><td>Sigma-Aldrich</td><td>G5516</td><td></td></tr><tr><td>Goat anti-Mouse IgG Alexa Fluor 488</td><td>Thermo Fisher Scientific</td><td>A11001</td><td></td></tr><tr><td>Goat anti-Rabbit IgG Alexa Fluor 488</td><td>Thermo Fisher Scientific</td><td>A11008</td><td></td></tr><tr><td>Heparin sodium from porcine intestinal mucosa 5000 IU/mL</td><td>Blau Farmac&amp;ecirc;utica</td><td>SKU 68027</td><td></td></tr><tr><td>Ibidi pump system (Pump + Fluidic Unit)</td><td>Ibidi</td><td>10902</td><td></td></tr><tr><td>KLF2 forward primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>KLF2 reverse primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>KLF4 forward primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>KLF4 reverse primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>NOA 280 nitric oxide analyzer</td><td>Sievers Instruments</td><td>NOA-280i-1</td><td></td></tr><tr><td>NOS3 forward primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>NOS3 reverse primer</td><td>Thermo Fisher Scientific</td><td>Custom designed</td><td></td></tr><tr><td>Paraformaldehyde (PFA)</td><td>Sigma-Aldrich</td><td>158127</td><td></td></tr><tr><td>Perfusion set 15 cm, ID 1.6 mm, red, 10 mL reservoirs</td><td>Ibidi</td><td>10962</td><td></td></tr><tr><td>Phalloidin - Alexa Fluor 488</td><td>Thermo Fisher Scientific</td><td>A12379</td><td></td></tr><tr><td>Phalloidin - Alexa Fluor 568</td><td>Thermo Fisher Scientific</td><td>A12380</td><td></td></tr><tr><td>Phosphate buffered saline (PBS), pH 7.4</td><td>Thermo Fisher Scientific</td><td>10010031</td><td></td></tr><tr><td>Potassium Iodide</td><td>Sigma-Aldrich</td><td>221945</td><td></td></tr><tr><td>QuanTitec SYBR green PCR kit</td><td>Qiagen</td><td>204143</td><td></td></tr><tr><td>QuantStudio 12K flex platform&amp;nbsp;</td><td>Applied Biosystems</td><td>4471087</td><td></td></tr><tr><td>RNeasy micro kit&amp;nbsp;</td><td>Quiagen</td><td>74004</td><td></td></tr><tr><td>Slide glass (24 mm x 60 mm)</td><td>Knittel Glass</td><td>VD12460Y1D.01</td><td></td></tr><tr><td>Sodium nitrite</td><td>Sigma-Aldrich</td><td>31443</td><td></td></tr><tr><td>SuperScript IV first-strand synthesis system</td><td>Thermo Fisher Scientific</td><td>18091200</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich</td><td>T8787</td><td></td></tr><tr><td>Trypan blue stain 0.4%</td><td>Gibco</td><td>15250-061</td><td></td></tr><tr><td>Type II collagenase from Clostridium histolyticum</td><td>Sigma-Aldrich</td><td>C6885</td><td></td></tr></tbody></table>

human saphenous vein endothelial cell isolation and exposure to controlled levels of shear stress and stretch

Coronary artery bypass graft (CABG) surgery is a procedure to revascularize ischemic myocardium. Saphenous vein remains used as a CABG conduit despite the reduced long-term patency compared to arterial conduits. The abrupt increase of hemodynamic stress associated with the graft arterialization results in vascular damage, especially the endothelium, that may influence the low patency of the saphenous vein graft (SVG). Here, we describe the isolation, characterization, and expansion of human saphenous vein endothelial cells (hSVECs). Cells isolated by collagenase digestion display the typical cobblestone morphology and express endothelial cell markers CD31 and VE-cadherin. To assess the mechanical stress influence, protocols were used in this study to investigate the two main physical stimuli, shear stress and stretch, on arterialized SVGs. hSVECs are cultured in a parallel plate flow chamber to produce shear stress, showing alignment in the direction of the flow and increased expression of KLF2, KLF4, and NOS3. hSVECs can also be cultured in a silicon membrane that allows controlled cellular stretch mimicking venous (low) and arterial (high) stretch. Endothelial cells' F-actin pattern and nitric oxide (NO) secretion are modulated accordingly by the arterial stretch. In summary, we present a detailed method to isolate hSVECs to study the influence of hemodynamic mechanical stress on an endothelial phenotype.

Typically, adhered ECs can be observed 3-4 days after extraction. hSVECs initially form clusters of cells and display a typical &#34;cobblestone&#34; morphology (Figure 1B). They express the EC markers CD31 (Figure 1C,D) and VE-cadherin (Figure 1D). hSVECs can be easily propagated on a non-coated treated cell culture dish, and they retain the endothelial phenotype in culture up to eight passages.
hSVECs, when cultured under shear stress, align in the direction of the flow (Figure 2A). The shear stress of 20 dyn/cm2 for 72 h induces the expression of typical mechanosensitive genes, KLF2, KLF4, and NOS3, indicating the effectiveness of the shear stimulus in hSVECs (Figure 2B)12,13,14.
The cyclic stretch outcome is dependent on the intensity applied to the hSVECs. Cells under low stretch show a cortical F-actin pattern similar to static cells (Figure 3A), without change in the NO release up to 72 h (Figure 3B). Arterial levels of stretch remodel the actin cytoskeleton after 24 h (Figure 3A) and decrease NO release after 72 h (Figure 3B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65122/65122fig01.jpg" /> 
Figure 1: Endothelial cells from human saphenous veins (hSVECs) exhibit typical endothelial morphology and specific EC marker expression. (A) Saphenous vein segment fulfilled with type II collagenase solution for the extraction of ECs. (B) Representative time-course of hSVEC growth after extraction. After 3-4 days, it is possible to visualize clusters of cells that proliferate until they reach confluency. Scale bar = 100 &#181;m. (C) FACS analysis of cultured hSVECs at passage 1. The green line indicates that 99.7% of the cell population is positive for the endothelial-specific marker CD31. The black line is the negative control. (D) Immunostaining for CD31 (green), (E) VE-cadherin (green), and nuclei DAPI (blue) in hSVECs at passage 1. Scale bar = 50 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65122/65122fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65122/65122fig02.jpg" /> 
Figure 2: hSVECs align in the direction of flow and express mechanosensitive genes when exposed to unidirectional shear stress. Confluent cell monolayer of hSVECs cultivated under static or unidirectional laminar shear stress conditions. (A) Phase-contrast images (top) and phalloidin staining (bottom) of hSVECs exposed to a shear stress of 20 dyn/cm2 for 72 h. Green: actin filaments; blue: cell nuclei. Scale bar = 100 &#181;m (phase-contrast) and 20 &#181;m (fluorescence). (B) Gene expression of KLF2, KLF4, and NOS3 determined by qRT-PCR. Values represent mean &#177; SEM. ** p &#60; 0.01 versus the static group. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65122/65122fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65122/65122fig03.jpg" /> 
Figure 3: The hSVEC phenotype under cyclic stretch is dependent on the intensity applied. (A) Confluent cell monolayer of hSVECs cultivated under static, low (venous), or high (arterial) stretch in a flexible bottom plate for 24 h. Phase-contrast images (top) and phalloidin staining (bottom) showing the actin fibers (red) and nuclei with DAPI (blue). Scale bar = 100 &#181;m (phase-contrast) and 50 &#181;m (fluorescence). (B) NO measurement was estimated based on NO2 accumulation in the cell culture media for 72 h. Values represent mean &#177; SEM. *** p &#60; 0.001 versus the static group. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/65122/65122fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Protein</td>
			<td colspan="2">Forward 5&#8217;-3&#8217;</td>
			<td colspan="2">Reverse 5&#8217;-3&#8217;</td>
		</tr>
		<tr>
			<td>KLF2</td>
			<td>Kr&#252;ppel-like Factor 2</td>
			<td colspan="2">CCACTCACACCTGCAGCTA</td>
			<td colspan="2">GTGGTAGGGCTTCTCACCTG</td>
		</tr>
		<tr>
			<td>KLF4</td>
			<td>Kruppel-like Factor 4</td>
			<td colspan="2">CACCTGGCGAGTCTGACATG</td>
			<td colspan="2">CAGCGGTTATTCGGGGCAC</td>
		</tr>
		<tr>
			<td>NOS3</td>
			<td>Nitric Oxide Synthase, Endothelial</td>
			<td colspan="2">GCACAGTTACCAGCTAGCCA</td>
			<td colspan="2">GCCGGGGACAGGAAATAGTT</td>
		</tr>
		<tr>
			<td rowspan="2">PPIA</td>
			<td>Cyclophilin A,</td>
			<td colspan="2" rowspan="2">CATTTGGTGCAAGGGTCACA</td>
			<td colspan="2" rowspan="2">TCTGCTGTCTTTGGGACCTTGTC</td>
		</tr>
		<tr>
			<td>Peptidylprolyl isomerase A</td>
		</tr>
	</tbody>
</table>
Table 1: qRT-PCR primers for shear stress and reference genes.

Watch this Scientific Journal Video about Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch at JoVE.com

Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch

We describe a protocol to isolate and culture human saphenous vein endothelial cells (hSVECs). We also provide detailed methods to produce shear stress and stretch to study mechanical stress in hSVECs.

Coronary artery bypass graft (CABG) surgery is a procedure to revascularize ischemic myocardium. Saphenous vein remains used as a CABG conduit despite the ...

human-saphenous-vein-endothelial-cell-isolation-exposure-to

Nanyang Technological University

Research

JoVE Journal

Medicine

928 Views.  Universidade de Sao Paulo. De vena saphena wordt plotseling blootgesteld aan arteriële aandoeningen na een coronaire bypass-operatie. Het begrijpen van de aanpassingsreactie op mechanische stress kan helpen bij het ontwerpen van therapeutische hulpmiddelen om adertransplantaatfalen te voorkomen. Dit endotheelcelisolatieprotocol is heel eenvoudig en vereist alleen incubatie met collagenase.Met minimale vaatmanipulatie resulteert dit in verminderde besmetting met gladde spiercellen en fibroblasten. Het protocol v...

Video: Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch

On-Chip Endothelial Inflammatory Phenotyping

Atherogenesis is potentiated by metabolic abnormalities that contribute to a heightened state of systemic inflammation resulting in endothelial dysfunction. However, early functional changes in endothelium that signify an individual's level of risk are not directly assessed clinically to help guide therapeutic strategy. Moreover, the regulation of inflammation by local hemodynamics contributes to the non-random spatial distribution of atherosclerosis, but the mechanisms are difficult to delineate in vivo. We describe a lab-on-a-chip based approach to quantitatively assay metabolic perturbation of inflammatory events in human endothelial cells (EC) and monocytes under precise flow conditions. Standard methods of soft lithography are used to microfabricate vascular mimetic microfluidic chambers (VMMC), which are bound directly to cultured EC monolayers.1 These devices have the advantage of using small volumes of reagents while providing a platform for directly imaging the inflammatory events at the membrane of EC exposed to a well-defined shear field. We have successfully applied these devices to investigate cytokine-,2 lipid-3, 4 and RAGE-induced5 inflammation in human aortic EC (HAEC). Here we document the use of the VMMC to assay monocytic cell (THP-1) rolling and arrest on HAEC monolayers that are conditioned under differential shear characteristics and activated by the inflammatory cytokine TNF-&alpha;. Studies such as these are providing mechanistic insight into atherosusceptibility under metabolic risk factors.

Microfluidic flow chambers etched by photolithography and fabricated from PDMS are applied to probe functional outcomes associated with EC dysfunction and inflammation. In a representative experiment, the ability of differential shear stress to modulate monocytic cell adhesion to cytokine activated EC monolayers is demonstrated.

Atherogenesis is potentiated by metabolic abnormalities that contribute to a heightened state of systemic inflammation resulting in endothelial ...

Bioengineering

Isolation of Human Umbilical Vein Endothelial Cells and Their Use in the Study of Neutrophil Transmigration Under Flow Conditions

Neutrophils are the most abundant type of white blood cell. They form an essential part of the innate immune system1. During acute inflammation, neutrophils are the first inflammatory cells to migrate to the site of injury. Recruitment of neutrophils to an injury site is a stepwise process that includes first, dilation of blood vessels to increase blood flow; second, microvascular structural changes and escape of plasma proteins from the bloodstream; third, rolling, adhesion and transmigration of the neutrophil across the endothelium; and fourth accumulation of neutrophils at the site of injury2,3. A wide array of in vivo and in vitro methods has evolved to enable the study of these processes4. This method focuses on neutrophil transmigration across human endothelial cells.
One popular method for examining the molecular processes involved in neutrophil transmigration utilizes human neutrophils interacting with primary human umbilical vein endothelial cells (HUVEC)5. Neutrophil isolation has been described visually elsewhere6; thus this article will show the method for isolation of HUVEC. Once isolated and grown to confluence, endothelial cells are activated resulting in the upregulation of adhesion and activation molecules. For example, activation of endothelial cells with cytokines like TNF-&alpha; results in increased E-selectin and IL-8 expression7. E-selectin mediates capture and rolling of neutrophils and IL-8 mediates activation and firm adhesion of neutrophils. After adhesion neutrophils transmigrate. Transmigration can occur paracellularly (through endothelial cell junctions) or transcellularly (through the endothelial cell itself). In most cases, these interactions occur under flow conditions found in the vasculature7,8.
The parallel plate flow chamber is a widely used system that mimics the hydrodynamic shear stresses found in vivo and enables the study of neutrophil recruitment under flow condition in vitro9,10. Several companies produce parallel plate flow chambers and each have advantages and disadvantages. If fluorescent imaging is needed, glass or an optically similar polymer needs to be used. Endothelial cells do not grow well on glass.
Here we present an easy and rapid method for phase-contrast, DIC and fluorescent imaging of neutrophil transmigration using a low volume ibidi channel slide made of a polymer that supports the rapid adhesion and growth of human endothelial cells and has optical qualities that are comparable to glass. In this method, endothelial cells were grown and stimulated in an ibidi &mu;slide. Neutrophils were introduced under flow conditions and transmigration was assessed. Fluorescent imaging of the junctions enabled real-time determination of the extent of paracellular versus transcellular transmigration.

This article first describes a procedure for isolating human endothelial cells from umbilical veins and then shows how to use these cells to examine neutrophil transmigration under flow conditions. By using a low-volume flow chamber made from a polymer with the optical characteristics of glass, live-cell fluorescent imaging of rare cell populations is also possible.

Neutrophils are the most abundant type of white blood cell. They form an essential part of the innate immune system1. During acute inflammation, ...

Immunology and Infection

A Novel Stretching Platform for Applications in Cell and Tissue Mechanobiology

Tools that allow the application of mechanical forces to cells and tissues or that can quantify the mechanical properties of biological tissues have contributed dramatically to the understanding of basic mechanobiology. These techniques have been extensively used to demonstrate how the onset and progression of various diseases are heavily influenced by mechanical cues. This article presents a multi-functional biaxial stretching (BAXS) platform that can either mechanically stimulate single cells or quantify the mechanical stiffness of tissues. The BAXS platform consists of four voice coil motors that can be controlled independently. Single cells can be cultured on a flexible substrate that can be attached to the motors allowing one to expose the cells to complex, dynamic, and spatially varying strain fields. Conversely, by incorporating a force load cell, one can also quantify the mechanical properties of primary tissues as they are exposed to deformation cycles. In both cases, a proper set of clamps must be designed and mounted to the BAXS platform motors in order to firmly hold the flexible substrate or the tissue of interest. The BAXS platform can be mounted on an inverted microscope to perform simultaneous transmitted light and/or fluorescence imaging to examine the structural or biochemical response of the sample during stretching experiments. This article provides experimental details of the design and usage of the BAXS platform and presents results for single cell and whole tissue studies. The BAXS platform was used to measure the deformation of nuclei in single mouse myoblast cells in response to substrate strain and to measure the stiffness of isolated mouse aortas. The BAXS platform is a versatile tool that can be combined with various optical microscopies in order to provide novel mechanobiological insights at the sub-cellular, cellular and whole tissue levels.

We present in this article a novel stretching platform that can be used to investigate single cell responses to complex anisotropic biaxial mechanical deformation and quantify the mechanical properties of biological tissues.

Tools that allow the application of mechanical forces to cells and tissues or that can quantify the mechanical properties of biological tissues have ...

Visualization and Quantification of TGF&#946;/BMP/SMAD Signaling under Different Fluid Shear Stress Conditions using Proximity-Ligation-Assay

Transforming Growth Factor &#946; (TGF&#946;)/Bone Morphogenetic Protein (BMP) signaling is tightly regulated and balanced during the development and homeostasis of the vasculature system Therefore, deregulation in this signaling pathway results in severe vascular pathologies, such as pulmonary artery hypertension, hereditary hemorrhagic telangiectasia, and atherosclerosis. Endothelial cells (ECs), as the innermost layer of blood vessels, are constantly exposed to fluid shear stress (SS). Abnormal patterns of fluid SS have been shown to enhance TGF&#946;/BMP signaling, which, together with other stimuli, induce atherogenesis. In relation to this, atheroprone, low laminar SS was found to enhance TGF&#946;/BMP signaling while atheroprotective, high laminar SS, diminishes this signaling. To efficiently analyze the activation of these pathways, we designed a workflow to investigate the formation of transcription factor complexes under low laminar SS and high laminar SS conditions using a commercially available pneumatic pump system and proximity ligation assay (PLA).
Active TGF&#946;/BMP-signaling requires the formation of trimeric SMAD complexes consisting of two regulatory SMADs (R-SMAD); SMAD2/3 and SMAD1/5/8 for TGF&#946; and BMP signaling, respectively) with a common mediator SMAD (co-SMAD; SMAD4). Using PLA targeting different subunits of the trimeric SMAD-complex, i.e., either R-SMAD/co-SMAD or R-SMAD/R-SMAD, the formation of active SMAD transcription factor complexes can be measured quantitatively and spatially using fluorescence microscopy.
The usage of flow slides with 6 small parallel channels, that can be connected in series, allows for the investigation of the transcription factor complex formation and inclusion of necessary controls. 
The workflow explained here can be easily adapted for studies targeting the proximity of SMADs to other transcription factors or to transcription factor complexes other than SMADs, in different fluid SS conditions. The workflow presented here shows a quick and effective way to study the fluid SS induced TGF&#946;/BMP signaling in ECs, both quantitatively and spatially.

Here, we establish a protocol to simultaneously visualize and analyze multiple SMAD complexes using proximity ligation assay (PLA) in endothelial cells exposed to pathological and physiological fluid shear stress conditions.

Transforming Growth Factor &#946; (TGF&#946;)/Bone Morphogenetic Protein (BMP) signaling is tightly regulated and balanced during the development and ...

Biochemistry

Procedure for Human Saphenous Veins Ex Vivo Perfusion and External Reinforcement

The mainstay of contemporary therapies for extensive occlusive arterial disease is venous bypass graft. However, its durability is threatened by intimal hyperplasia (IH) that eventually leads to vessel occlusion and graft failure. Mechanical forces, particularly low shear stress and high wall tension, are thought to initiate and to sustain these cellular and molecular changes, but their exact contribution remains to be unraveled. To selectively evaluate the role of pressure and shear stress on the biology of IH, an ex&#160;vivo perfusion system (EVPS) was created to perfuse segments of human saphenous veins under arterial regimen (high shear stress and high pressure). Further technical innovations allowed the simultaneous perfusion of two segments from the same vein, one reinforced with an external mesh. Veins were harvested using a no-touch technique and immediately transferred to the laboratory for assembly in the EVPS. One segment of the freshly isolated vein was not perfused (control, day 0). The two others segments were perfused for up to 7 days, one being completely sheltered with a 4 mm (diameter) external mesh. The pressure, flow velocity, and pulse rate were continuously monitored and adjusted to mimic the hemodynamic conditions prevailing in the femoral artery. Upon completion of the perfusion, veins were dismounted and used for histological and molecular analysis. Under ex&#160;vivo conditions, high pressure perfusion (arterial, mean = 100 mm Hg) is sufficient to generate IH and remodeling of human veins. These alterations are reduced in the presence of an external polyester mesh.

Procedure for Human Saphenous Veins Ex Vivo Perfusion and External Reinforcement

The mechanisms leading to the development of intimal hyperplasia (IH) and vein graft failure are still poorly understood. This study describes an ex&#160;vivo system to perfuse human veins under controlled flow and pressure. Furthermore the efficiency of external mesh reinforcement to limit the development of IH was evaluated.

The mainstay of contemporary therapies for extensive occlusive arterial disease is venous bypass graft. However, its durability is threatened by intimal ...

Gene Expression Analysis of Endothelial Cells Exposed to Shear Stress Using Multiple Parallel-plate Flow Chambers

We describe a workflow for the analysis of gene expression from endothelial cells subject to a steady laminar flow using multiple monitored parallel-plate flow chambers. Endothelial cells form the inner cellular lining of blood vessels and are chronically exposed to the frictional force of blood flow called shear stress. Under physiological conditions, endothelial cells function in the presence of various shear stress conditions. Thus, the application of shear stress conditions in in vitro models can provide greater insight into endothelial responses in vivo. The parallel-plate flow chamber previously published by Lane et al.9 is adapted to study endothelial gene regulation in the presence and absence of steady (non-pulsatile) laminar flow. Key adaptations in the set-up for laminar flow as presented here include a large, dedicated environment to house concurrent flow circuits, the monitoring of flow rates in real-time, and the inclusion of an exogenous reference RNA for the normalization of quantitative real-time PCR data. To assess multiple treatments/conditions with the application of shear stress, multiple flow circuits and pumps are used simultaneously within the same heated and humidified incubator. The flow rate of each flow circuit is measured continuously in real-time to standardize shear stress conditions throughout the experiments. Because these experiments have multiple conditions, we also use an exogenous reference RNA that is spiked-in at the time of RNA extraction for the normalization of RNA extraction and first-strand cDNA synthesis efficiencies. These steps minimize the variability between samples. This strategy is employed in our pipeline for the gene expression analysis with shear stress experiments using the parallel-plate flow chamber, but parts of this strategy, such as the exogenous reference RNA spike-in, can easily and cost-effectively be used for other applications.

Here, a workflow for the culture and gene expression analysis of endothelial cells under fluid shear stress is presented. Included is a physical arrangement for simultaneously housing and monitoring multiple flow chambers in a controlled environment and the use of an exogenous reference RNA for quantitative PCR.

We describe a workflow for the analysis of gene expression from endothelial cells subject to a steady laminar flow using multiple monitored parallel-plate ...

Segmenting Growth of Endothelial Cells in 6-Well Plates on an Orbital Shaker for Mechanobiological Studies

Shear stress imposed on the arterial wall by the flow of blood affects endothelial cell morphology and function. Low magnitude, oscillatory and multidirectional shear stresses have all been postulated to stimulate a pro-atherosclerotic phenotype in endothelial cells, whereas high magnitude and unidirectional or uniaxial shear are thought to promote endothelial homeostasis. These hypotheses require further investigation, but traditional in vitro techniques have limitations, and are particularly poor at imposing multidirectional shear stresses on cells. 
One method that is gaining increasing use is to culture endothelial cells in standard multi-well plates on the platform of an orbital shaker; in this simple, low-cost, high-throughput and chronic method, the swirling medium produces different patterns and magnitudes of shear, including multidirectional shear, in different parts of the well. However, it has a significant limitation: cells in one region, exposed to one type of flow, may release mediators into the medium that affect cells in other parts of the well, exposed to different flows, hence distorting the apparent relation between flow and phenotype. 
Here we present an easy and affordable modification of the method that allows cells to be exposed only to specific shear stress characteristics. Cell seeding is restricted to a defined region of the well by coating the region of interest with fibronectin, followed by passivation using passivating solution. Subsequently, the plates can be swirled on the shaker, resulting in exposure of cells to well-defined shear profiles such as low magnitude multidirectional shear or high magnitude uniaxial shear, depending on their location. As before, the use of standard cell-culture plasticware allows straightforward further analysis of the cells. The modification has already allowed the demonstration of soluble mediators, released from endothelium under defined shear stress characteristics, that affect cells located elsewhere in the well.

This protocol describes a coating method to restrict endothelial cell growth to a specific region of a 6-well plate for shear stress application using the orbital shaker model.

Shear stress imposed on the arterial wall by the flow of blood affects endothelial cell morphology and function. Low magnitude, oscillatory and ...

Electrophysiological Recordings of Single-cell Ion Currents Under Well-defined Shear Stress

Fluid shear stress is well known to play a major role in endothelial function. In most vascular beds, elevated shear stress from acute increases in blood flow triggers a signaling cascade resulting in vasodilation thereby alleviating mechanical stress on the vascular wall. The pattern of shear stress is also well known to be a critical factor in the development of atherosclerosis with laminar shear stress being atheroprotective and disturbed shear stress being pro-atherogenic. While we have a detailed understanding of the various intermediate cell signaling pathways, the receptors that first translate the mechanical stimulus into chemical mediators are not completely understood. Mechanosensitive ion channels are critical to the response to shear and regulate shear-induced cell signaling thereby controlling the production of vasoactive mediators. These channels are among the earliest activated signaling components to shear and have been linked to shear-induced vasodilation through promoting nitric oxide production (e.g., inwardly rectifying K+ [Kir] and transient receptor potential [TRP] channels) and endothelium hyperpolarizing factor (e.g., Kir and calcium-activated K+ [KCa] channels) and shear-induced vasoconstriction through an undetermined mechanism that involves piezo channels. Understanding the biophysical mechanism by which these channels are activated by shear forces (i.e., directly or through a primary mechano-receptor) could provide potential new targets to resolve the pathophysiology associated with endothelial dysfunction and atherogenesis. It is still a major challenge to record flow-induced activation of ion channels in real time using electrophysiology. The standard methods to expose cells to well-defined shear stress, such as the cone and plate rheometer and closed parallel plate flow chamber do not allow real time study of ion channel activation. The goal of this protocol is to describe a modified parallel plate flow chamber that allows real time electrophysiological recording of mechanosensitive ion channels under well-defined shear stress.

The goal of this protocol is to describe a modified parallel plate flow chamber for use in investigating real time activation of mechanosensitive ion channels by shear stress.

Fluid shear stress is well known to play a major role in endothelial function. In most vascular beds, elevated shear stress from acute increases in blood ...

Pneumococcus Infection of Primary Human Endothelial Cells in Constant Flow

Interaction of Streptococcus pneumoniae with the surface of endothelial cells is mediated in blood flow via mechanosensitive proteins such as the Von Willebrand Factor (VWF). This glycoprotein changes its molecular conformation in response to shear stress, thereby exposing binding sites for a broad spectrum of host-ligand interactions. In general, culturing of primary endothelial cells under a defined shear flow is known to promote the specific cellular differentiation and the formation of a stable and tightly linked endothelial layer resembling the physiology of the inner lining of a blood vessel. Thus, the functional analysis of interactions between bacterial pathogens and the host vasculature involving mechanosensitive proteins requires the establishment of pump systems that can simulate the physiological flow forces known to affect the surface of vascular cells.
The microfluidic device used in this study enables a continuous and pulseless recirculation of fluids with a defined flow rate. The computer-controlled air-pressure pump system applies a defined shear stress on endothelial cell surfaces by generating a continuous, unidirectional, and controlled medium flow. Morphological changes of the cells and bacterial attachment can be microscopically monitored and quantified in the flow by using special channel slides that are designed for microscopic visualization. In contrast to static cell culture infection, which in general requires a sample fixation prior to immune labeling and microscopic analyses, the microfluidic slides enable both the fluorescence-based detection of proteins, bacteria, and cellular components after sample fixation; serial immunofluorescence staining; and direct fluorescence-based detection in real time. In combination with fluorescent bacteria and specific fluorescence-labeled antibodies, this infection procedure provides an efficient multiple component visualization system for a huge spectrum of scientific applications related to vascular processes.

This study describes the microscopic monitoring of pneumococcus adherence to von Willebrand factor strings produced on the surface of differentiated human primary endothelial cells under shear stress in defined flow conditions. This protocol can be extended to detailed visualization of specific cell structures and quantification of bacteria by applying differential immunostaining procedures.

Interaction of Streptococcus pneumoniae with the surface of endothelial cells is mediated in blood flow via mechanosensitive proteins such as the Von ...

Studying Tissue Rigidity and Shear Stress Effects on Endothelial Cells

In Vitro Model Integrating Substrate Stiffness and Flow to Study Endothelial Cell Responses

We present an innovative in vitro model aimed at investigating the combined effects of tissue rigidity and shear stress on endothelial cell (EC) function, which are crucial for understanding vascular health and the onset of diseases such as atherosclerosis. Traditionally, studies have explored the impacts of shear stress and substrate stiffness on ECs, independently. However, this integrated system combines these factors to provide a more precise simulation of the mechanical environment of the vasculature. The objective is to examine EC mechanotransduction across various tissue stiffness levels and flow conditions using human ECs. We detail the protocol for synthesizing gelatin methacrylate (GelMA) hydrogels with tunable stiffness and seeding them with ECs to achieve confluency. Additionally, we describe the design and assembly of a cost-effective flow chamber, supplemented by computational fluid dynamics simulations, to generate physiological flow conditions characterized by laminar flow and appropriate shear stress levels. The protocol also incorporates fluorescence labeling for confocal microscopy, enabling the assessment of EC responses to both tissue compliance and flow conditions. By subjecting cultured ECs to multiple integrated mechanical stimuli, this model enables comprehensive investigations into how factors such as hypertension and aging may affect EC function and EC-mediated vascular diseases. The insights gained from these investigations will be instrumental in elucidating the mechanisms underlying vascular diseases and in developing effective treatment strategies.

We synthesized and characterized a tunable gelatin-based substrate for culturing vascular endothelial cells (ECs) under relevant vascular flow conditions. This biomimetic surface replicates both physiological and pathological conditions, enabling the study of mechanical forces on EC behavior and advancing our understanding of vascular health and disease mechanisms.

We present an innovative in vitro model aimed at investigating the combined effects of tissue rigidity and shear stress on endothelial cell (EC) function, ...

Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch

Samenvatting

Meer video's verkennen