This work was funded by grants from Association Fran&#231;aise contre les myopathies (AFM-T&#233;l&#233;thon) and from Auvergne-Rh&#244;ne Alpes R&#233;gion (AURA).

<ol>
	<li>Claussnitzer, M., Susztak, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gaining+insight+into+metabolic+diseases+from+human+genetic+discoveries.">Gaining insight into metabolic diseases from human genetic discoveries.</a> Trends in Genetics. 37 (12), 1081-1094 (2021).</li><li>Fuster-Garc&#237;a, C., Garc&#237;a-Boh&#243;rquez, B., Rodr&#237;guez-Mu&#241;oz, A., Mill&#225;n, J. M., Garc&#237;a-Garc&#237;a, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+CRISPR+tools+for+variant+interpretation+and+disease+modeling+in+inherited+retinal+dystrophies.">Application of CRISPR tools for variant interpretation and disease modeling in inherited retinal dystrophies.</a> Genes. 11 (5), 473 (2020).</li><li>Modell, A. E., Lim, D., Nguyen, T. M., Sreekanth, V., Choudhary, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+therapeutics:+current+challenges+and+future+applications.">CRISPR-based therapeutics: current challenges and future applications.</a> Trends in Pharmacological Sciences. 43 (2), 151-161 (2022).</li><li>Olson, E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+the+correction+of+muscular+dystrophy+by+gene+editing.">Toward the correction of muscular dystrophy by gene editing.</a> Proceedings of the National Academy of Sciences of the United States of America. 118 (22), (2021).</li><li>Wu, X., Kriz, A. J., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+specificity+of+the+CRISPR-Cas9+system.">Target specificity of the CRISPR-Cas9 system.</a> Quantitative Biology. 2 (2), 59-70 (2014).</li><li>Merienne, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+self-inactivating+KamiCas9+system+for+the+editing+of+CNS+disease+genes.">The self-inactivating KamiCas9 system for the editing of CNS disease genes.</a> Cell Reports. 20 (12), 2980-2991 (2017).</li><li>Marty, I., Faur&#233;, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excitation-contraction+coupling+alterations+in+myopathies.">Excitation-contraction coupling alterations in myopathies.</a> Journal of Neuromuscular Diseases. 3 (4), 443-453 (2016).</li><li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPOR:+intuitive+guide+selection+for+CRISPR/Cas9+genome+editing+experiments+and+screens.">CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Research. 46, 242-245 (2018).</li><li>Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+quick,+cost-free+method+of+purification+of+DNA+fragments+from+agarose+gel.">A quick, cost-free method of purification of DNA fragments from agarose gel.</a> Journal of Cancer. 3, 93-95 (2012).</li><li>Flucher, B. E., Conti, A., Takeshima, H., Sorrentino, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+3+and+type+1+ryanodine+receptors+are+localized+in+triads+of+the+same+mammalian+skeletal+muscle+fibers.">Type 3 and type 1 ryanodine receptors are localized in triads of the same mammalian skeletal muscle fibers.</a> The Journal of Cell Biology. 146 (3), 621-630 (1999).</li><li>Hess, H. H., Lees, M. B., Derr, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+linear+Lowry--Folin+assay+for+both+water-soluble+and+sodium+dodecyl+sulfate-solubilized+proteins.">A linear Lowry--Folin assay for both water-soluble and sodium dodecyl sulfate-solubilized proteins.</a> Analytical Biochemistry. 85 (1), 295-300 (1978).</li><li>Garibaldi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dusty+core+disease'+(DuCD):+expanding+morphological+spectrum+of+RYR1+recessive+myopathies.">Dusty core disease' (DuCD): expanding morphological spectrum of RYR1 recessive myopathies.</a> Acta Neuropathologica Communications. 7 (1), 3 (2019).</li><li>Marty, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+evidence+for+a+complex+involving+Dihydropyridine+receptor+and+Ryanodine+receptor+in+triad+junctions+of+skeletal+muscle.">Biochemical evidence for a complex involving Dihydropyridine receptor and Ryanodine receptor in triad junctions of skeletal muscle.</a> Proceedings of the National Academy of Sciences of the United States of America. 91 (6), 2270-2274 (1994).</li><li>Oddoux, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Triadin+deletion+induces+impaired+skeletal+muscle+function.">Triadin deletion induces impaired skeletal muscle function.</a> Journal of Biological Chemistry. 284 (50), 34918-34929 (2009).</li><li>Mamchaoui, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+pathological+human+myoblasts:+towards+a+universal+tool+for+the+study+of+neuromuscular+disorders.">Immortalized pathological human myoblasts: towards a universal tool for the study of neuromuscular disorders.</a> Skeletal Muscle. 1, 34 (2011).</li><li>Cacheux, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+characterization+of+a+central+core+disease+RyR1+mutation+(p.Y4864H)+associated+with+quantitative+defect+in+RyR1+protein.">Functional characterization of a central core disease RyR1 mutation (p.Y4864H) associated with quantitative defect in RyR1 protein.</a> Journal of Neuromuscular Diseases. 2 (4), 421-432 (2015).</li><li>Luis, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+old+and+the+new:+Prospects+for+non-integrating+lentiviral+vector+technology.">The old and the new: Prospects for non-integrating lentiviral vector technology.</a> Viruses. 12 (10), 1103 (2020).</li><li>Leenay, R. T., Beisel, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering,+communicating,+and+engineering+the+CRISPR+PAM.">Deciphering, communicating, and engineering the CRISPR PAM.</a> Journal of Molecular Biology. 429 (2), 177-191 (2017).</li><li>Salmon, P., Trono, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titration+of+lentiviral+vectors.">Production and titration of lentiviral vectors.</a> Current Protocols in Neurosciences. , (2006).</li></ol>

The authors have no conflicts of interest to disclose.

A major step on the way to the characterization of genes of unknown function involved in pathologies is the development of relevant cellular models to study the function of these genes. The use of gene editing using CRISPR/Cas9 is an exponentially growing field of research, and the development of knock-out models as presented here is among its most widely used applications. In this context, we propose here a versatile protocol to develop a human cell line knock-out in any gene of interest, allowing the characterization of this gene in a relevant human cell model. The protocol presented here can be used in immortalized myoblasts as well as in iPSC, and thus could virtually result in the production of any human cell model KO in the gene of interest.
The limitation is that this protocol should be applied to immortalized cells, as many weeks of culturing as well as a cellular cloning are required along with numerous successive amplifications. Alternatively cells, which can be amplified and maintained for few weeks or months should be used. Using this procedure, human immortalized muscle cell line KO for the gene of interest (here the RYR1 gene) has been produced in about 3-4 months (excluding the functional characterization of the cells).
This strategy is suited for difficult to transfect cells, such as muscle cells, as it relies on the use of lentivirus to introduce all the tools into the target cells, and it is thus more powerful than other methods such as transfection or electroporation. Its major drawback is integration in the host genome, and a possible alternative to avoid damaging integration of lentivirus into the host genome is the use on non-integrative lentivirus17, but the efficiency of these non-integrative lentiviral particles should be at least equivalent to the regular lentivirus.
The integration site could probably influence the expression level of Cas9, but this most probably is not responsible for the small amount of Cas9 in Cl-KOR 2. The small amount of Cas9 is most probably related to the transduction of this specific clone with the LV-Killer, which could have been lower than in the other clone, or alternatively the number of LV-Cas9 could have been higher.
It is not recommended to express Cas9 alone without gRNA for a long time (such as for the development of a Cas9 clone), as this has been described to increase the off-targets, and it may also increase the mortality of the cells.
We have chosen to use the SpCas9 as nuclease, because it is widely used, it has a short PAM, and therefore offers several options for the choice of guide RNAs. In addition, its size is compatible with the production of lentiviral vectors. Other nucleases can be used if a specific PAM has to be targeted (such as SaCas9 or Cpf1)18.
The different lentiviruses can be produced in a regular BSL2 culture room19 or purchased from a virus production facility or a company. The requirement to implement this protocol is expertise in molecular biology and molecular cloning, and in culturing of the chosen cell model.
The lentiviruses encoding the different guides also encode the fluorescent protein, mCherry. This fluorescent protein can be useful, allowing automated sorting of the cells and cloning by FACS instead of single cell cloning, and in this case, the expression of mCherry should not be suppressed with the LV-killer. If mCherry is to be maintained, then the second guide against mCherry should not be cloned into the p-killer (step 2.7). For the RYR1 gene, as the functional characterization makes use of fluorescent probes, and the future use of this cell line could also require immunolabeling with fluorescent antibodies, we have chosen to suppress mCherry expression. In the LV-killer, the gRNA targeting Cas9 has been placed under a strong promotor H1 instead of the weak promotor 7SK initially present in the original plasmid, to ensure a similar efficiency of the nuclease on all the selected gRNAs, and to increase the Cas9 cleavage once the LV-killer is added to the cells.
The longest and most strenuous step is single cell cloning. In our procedure, the muscle cells displayed a reduced growth after lentiviral transduction with Cas9 and recovered after a few weeks. If the single cell cloning is performed too early after the viral transductions, probably because of massive cell death, only a few wells of a 96-well plate will contain growing cells. Thus, it is better to amplify the cells before cloning, and wait for at least 2-3 splitting. It is also possible to clone the cells at 10 cells/well if they don&#39;t grow well as single cells. In addition, the myoblasts should always be cultured at a confluency below 50% in order to maintain a good differentiation ability.

With the progress of gene sequencing and the identification of mutations in genes of unknown functions in a specific tissue, the development of relevant cellular models to understand the function of a new target gene and confirm its involvement in the related pathophysiological mechanisms constitutes an essential tool. In addition, these models are of major importance for future therapeutic developments1,2, and constitute an interesting alternative to the development of knock-out animal models in straight line with the international recommendations for reduction in the use of animals in experimentation. Gene editing using CRISPR/Cas9 is among the most powerful tools currently available, which has allowed the development of many knock-out/knock-in models, and targeted gene validation using CRISPR/Cas9 is among the most widely used application of CRISPR/Cas93. The success of gene editing relies on the ability to introduce the CRISPR tools (the guide RNAs and the nuclease Cas9) in the target cell model, which can be a challenge in many difficult-to-transfect cells, such as muscle cells4. This challenge can be overcome with the use of virus, usually lentivirus, which has the great advantage to transduce efficiently many cell types and deliver its transgene. But its major drawback is the integration of the transgene in the host cell genome, leading to potential alteration of genes localized at the integration site and to the permanent expression of the transgene, which in the case of the nuclease Cas9 would result in damaging consequences5. A smart solution has been proposed by Merienne and colleagues6, which consists of introduction into the cells of a guide-RNA targeting the Cas9 gene itself, leading to Cas9 inactivation. An adaptation of this strategy is presented here as a user friendly and versatile protocol allowing to knock-out virtually any gene in difficult-to-transfect cells.
The goal of the protocol presented here is to induce the inactivation of a gene of interest in immortalized muscle cells. It can be used to knock-out any gene of interest, in different types of immortalized cells. The protocol described here contains steps to design the guide RNAs and their cloning into lentiviral plasmids, to produce the CRISPR tools in lentiviral vectors, to transduce the cells with the different lentiviruses, and to clone the cells to produce a homogenous edited cell line.
Using this protocol, immortalized human skeletal muscle cells have been developed with deletion of the type 1 ryanodine receptor (RyR1), an essential calcium channel involved in intracellular calcium release and muscle contraction7. The knock-out (KO) of the gene has been confirmed at the protein level using Western blot, and at the functional level using calcium imaging.

<table><tbody><tr><td>Anti-CACNA1S antibody</td><td>Sigma-Aldrich</td><td>HPA048892</td><td>Primary antibody</td></tr><tr><td>Blp I</td><td>NE BioLabs</td><td>R0585S</td><td>Restriction enzyme</td></tr><tr><td>CalPhos Mammalian Transfection Kit</td><td>Takara</td><td>631312&amp;nbsp;</td><td>Transfection kit</td></tr><tr><td>Easy blot anti Mouse IgG</td><td>GeneTex</td><td>GTX221667-01</td><td>HRP secondary antibody</td></tr><tr><td>Easy blot anti Rabbit IgG</td><td>GeneTex</td><td>GTX221666</td><td>HRP secondary antibody</td></tr><tr><td>Fluo-4 direct</td><td>Molecular Probes</td><td>F10472</td><td>Calcium imaging</td></tr><tr><td>GAPDH(14C10) Rabbit mAb&amp;nbsp;</td><td>Cell Signaling Technology</td><td>#2118</td><td>Primary antibody</td></tr><tr><td>HindIII</td><td>Fermentas</td><td>ER0501</td><td>Restriction enzyme</td></tr><tr><td>InFusion HD Precision Plus</td><td>Takara</td><td>638920</td><td>Ligation kit</td></tr><tr><td>MasterMix Phusion High Fidelity with GC</td><td>ThermoFisher Scientific</td><td>F532L</td><td>Mix for PCR reaction with High fidelity Taq polymerase and dNTPs</td></tr><tr><td>Myosin Heavy Chain antibody</td><td>DHSB</td><td>MF20</td><td>Primary antibody</td></tr><tr><td>NucleoBond Xtra Maxi EF</td><td>Macherey-Nagel</td><td>REF&amp;nbsp;740424</td><td>Maxipreparation kit for purification of plasmids</td></tr><tr><td>NucleoSpin Gel and PCR Clean-up</td><td>Macherey-Nagel</td><td>740609</td><td>DNA purification</td></tr><tr><td>NucleoSpin Tissue</td><td>Macherey-Nagel</td><td>740952</td><td>Kit for DNA extraction from cell</td></tr><tr><td>One Shot Stbl3 Chemically Competent&amp;nbsp;E. coli</td><td>ThermoFisher Scientific</td><td>C737303</td><td>Chemically competent cells</td></tr><tr><td>Plasmid #87904</td><td>Addgene</td><td>87904</td><td>Lentiviral plasmid encoding the SpCas9 (for LV-Cas9)</td></tr><tr><td>Plasmid #87919</td><td>Addgene</td><td>87919</td><td>Lentiviral backbone for insertion of cassette with guides (for LV-guide-target)</td></tr><tr><td>Plasmid #12260</td><td>Addgene</td><td>12260</td><td>Lentiviral plasmid encoding lentiviral packaging GAG POL</td></tr><tr><td>Plasmid #8454</td><td>Addgene</td><td>8454</td><td>Lentiviral plasmid encoding envelope protein for producing lentiviral and MuLV retroviral particles</td></tr><tr><td>V5 Tag Monoclonal Antibody</td><td>Invitrogene</td><td>R96025&amp;nbsp;</td><td>Primary antibody</td></tr><tr><td>XL10-Gold Ultracompetent Cells</td><td>Agilent</td><td>200317</td><td>Chemically competent cells</td></tr><tr><td>Xma I</td><td>NE BioLabs</td><td>R0180S</td><td>Restriction enzyme</td></tr></tbody></table>

development of knock-out muscle cell lines using lentivirus-mediated crispr/cas9 gene editing

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, specifically to study the function of new genes/proteins associated with a disease, identified during the genetic diagnosis. For the development of such cell lines, two major issues have to be untangled: insertion of the CRISPR tools (the Cas9 and the guide RNA) with high efficiency into the chosen cells, and restriction of the Cas9 activity to the specific deletion of the chosen gene. The protocol described here is dedicated to the insertion of the CRISPR tools in difficult to transfect cells, such as muscle cells. This protocol is based on the use of lentiviruses, produced with plasmids publicly available, for which all the cloning steps are described to target a gene of interest. The control of Cas9 activity has been performed using an adaptation of a previously described system called KamiCas9, in which the transduction of the cells with a lentivirus encoding a guide RNA targeting the Cas9 allows the progressive abolition of Cas9 expression. This protocol has been applied to the development of a RYR1-knock out human muscle cell line, which has been further characterized at the protein and functional level, to confirm the knockout of this important calcium channel involved in muscle intracellular calcium release and in excitation-contraction coupling. The procedure described here can easily be applied to other genes in muscle cells or in other difficult to transfect cells and produce valuable tools to study these genes in human cells.

This protocol was applied to immortalized myoblasts from a healthy subject15 (so-called HM cells, for human myoblasts), in which the RyR1 has been previously characterized16, in order to knock out the RYR1 gene encoding the RyR1 protein. The design of the guides RNA was made to delete the sequence encompassing part of exon 101 and intron 101 of the gene. Deletion of part of exon 101 is foreseen to result in disruption of the reading frame. In addition, exon 101 encodes the pore of the protein and is thus required to produce a functional calcium channel. Many patients affected with a severe RyR1-related myopathy have a mutation in this region of the gene7. The best guides predicted with Crispor software were selected in order to have as few off-targets as possible, while keeping the best efficiency. We chose to use two guides at the same time in the same viral vector, to make sure that a major part of the cells will be knock-out, and to ease the detection of the deletion in edited clones using PCR. The two selected guides (see Table 2 and Figure 1) are localized, respectively, in the end of exon 101 and in the beginning of intron 101, resulting in a deletion of 326 bp and a subsequent frameshift. This ensures that the edited cells will be RYR1-KO.
The gRNA targeting the SpCas9 was the one already designed by Merienne and colleagues6 and present in the plasmid #87919 under the weak promoter 7SK. As its efficiency to target the SpCas9 sequence has been already demonstrated in their study6, it has been used to create the plasmid p_Killer, but under the control of the strong promoter H1. The second guide in the p_Killer plasmid is designed to target the mCherry sequence under the promoter U6. This will allow the deletion of mCherry, which could be disturbing in some subsequent experiments with the newly created cell line.
Plasmids p_guides and p_killer were created and all the required lentiviruses were produced in the dedicated BSL2 culture room. After myoblasts transduction, the cells were cultured for 2 weeks until growth recovery and analyzed using PCR to confirm the presence of edited cells. For cellular cloning, two 96-well plates were seeded with treated cells at 1 cell per well. Cell growth was observed in 32% of cultured wells. Genomic DNA was then extracted from the clones and PCR analysis was done until two corrected clones were identified (so-called Cl-KOR-1 and Cl-KOR-2), see Figure 3. The deletion of the targeted portion of RYR1 was confirmed by Sanger sequencing. Additional control cells have been used, such as the initial HM cells, or HM cells treated with the very same procedure but non-edited as confirmed by PCR and sequencing (Cl-CTRL). Selected clones were then amplified and further characterized at the protein level and functional level.
To validate the complete extinction of RyR1 and of Cas9 at the protein level, Western blot analysis was performed. The results are presented on Figure 4. The Cas9 protein, absent in the HM cells, was detected 5 days after the transduction of the cells with LV-Cas9 (HM+LV-Cas9), and as expected, its expression was abolished in the Cl-CTRL and in the edited Cl-KOR-1 and Cl-KOR-2, although a small amount of Cas9 was still detected in Cl-KOR-2 (Figure 3A). As the gRNA targeting Cas9 is still expressed, the amount of remaining Cas9 is expected to progressively disappear. The expression of other important proteins was also assessed using Western blot: RyR1, to confirm the full deletion of the protein, the alpha1 subunit of DHPR, which is the functional partner of RyR1 involved in excitation-contraction coupling, and the myosin heavy chain as a marker of differentiation, because RyR1 and DHPR are expressed only in differentiated myotubes (Figure 3B). DHPR and MYHC are not supposed to be modified. Although the Western blot confirmed the complete deletion of RyR1 in the two RyR1-KO clones (Cl-KOR-1 and Cl-KOR-2), additional modifications-resulting from Cas9 or from the cloning procedure-may have occurred in the Cl-KOR-2, which presented in addition an absence of DHPR and a reduction in myosin heavy chain (MHC). As both proteins are expressed only in differentiated myotubes, their absence most probably reflects alteration in differentiation, which could possibly stem from the long single cell cloning procedure associated with a local overgrowth of the cells leading to the lost in their myogenic potential. Thus, only Cl-KOR-1 has been further characterized at the functional level. This demonstrates that selection of numerous edited clones is important to be able to work with the best one(s).
The functional characterization was performed using calcium imaging. The mean fluorescence variation as a function of time is represented on Figure 5, on at least 180 myotubes of each genotype, using either a direct RyR1 stimulation by 4-CMC or stimulation of the calcium release complex (DHPR associated with RyR1) by KCl membrane depolarization.
These experiments showed that the non-modified Cl-CTRL had a behavior comparable to the initial cell population (HM cells) and responded to direct RyR1 stimulation by its activator 4-CmC and by stimulation of the calcium release complex by membrane depolarization. In contrast, the edited Cl-KOR-1 was unable to respond to either stimulation (4-CmC and KCl depolarization), as expected for a RyR1-KO.
Altogether, the Western blot and the functional characterization confirmed that the Cl-KOR-1 cell line is a RyR1-KO muscle cell line. This protocol can be applied to any other gene expressed in skeletal muscle, or other cell type (such as induced Pluripotent Stem Cells - iPSC). The complete protocol is illustrated in Figure 6.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64114/64114fig01.jpg" /> 
Figure 1: Localization and design of the guides RNA. (A) Schematic localization of the guides designed for the creation of the RYR1-KO cell line. Guide 1 targets the end of exon 101 in the RYR1 gene, Guide 2 targets the intron 101, creating a deletion of 326 bp and a frameshift. Guide Killer targets the initiation codon in the sequence of the SpCas9, Guide mCherry targets the end of the mCherry sequence. (B) Localization of the guides in the genomic sequences for the previously described Guide 1, Guide 2, Guide killer, and Guide mCherry. The sequence of each guide (20 bp in length) is presented in color and the PAM for each guide is bolded and underlined. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64114/64114fig02.jpg" /> 
Figure 2: Cloning procedure for production of the cassette. Schematic presentation of the different PCR performed to produce the cassettes with the guides, to be inserted into the lentivirus backbone plasmid. PCR A, PCR B, PCR C, and PCR D are realized with program 1 illustrated on the right top, and PCR final with the PCR program 2, illustrated on the right bottom. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64114/64114fig03.jpg" /> 
Figure 3: Selection of the clones using PCR. (A) Schematic presentation of the PCR amplification of a 1,200 bp region encompassing the guides, with forward and reverse primers represented by the gray arrows. DNA cleavage at both guides is expected to result in reduction of 326 bp in the size of the PCR fragment, as depicted by the dotted green vertical lines below the scissors. (B) PCR products produced from HM cells, Cl-CTRL, Cl-KOR-1, and Cl-KOR-2 were loaded on a 1% agarose gel. The DNA of HM and Cl-CTRL appears non modified (full length), whereas the DNA of Cl-KOR-1 and Cl-KOR-2 is shorter than the control, as expected (cleaved). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64114/64114fig04.jpg" /> 
Figure 4: Characterization of the cells at protein level. (A) Western blot analysis for the presence of Cas 9 protein using the V5-tag in HM cells, HM cells transduced with LV-Cas9, Cl-CTRL, Cl-KOR-1, and Cl-KOR-2. Cas9 is clearly detected in the HM cells transduced with LV-Cas9, whereas its expression has been abolished completely (in Cl-CTRL and Cl-KOR-1) or almost completely (in Cl-KOR-2) by LV-Killer. (B) Expression of RyR1, Myosin heavy chain (MYHC), alpha1 subunit of DHPR and GAPDH as a loading control in Cl-CTRL, Cl-KOR-1, and Cl-KOR-2. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/64114/64114fig05.jpg" /> 
Figure 5: Functional characterization of the cells. Fluo-4 calcium imaging performed on myotubes produced from HM cells, Cl-CTRL, and Cl-KOR-1. The curves&#160;represent the fluorescence variation in HM myotubes (black curves), Cl-CTRL myotubes (gray curves), or Cl-KOR-1 (green curves). All values are presented as mean &#177; standard error of mean (SEM) of n myotubes. In each condition, n = 180 to 256 myotubes have been analyzed, from at least three different experiments (exact number indicated for each curve). 4 CmC (500 &#181;M) was used to directly stimulate RyR1 in the presence of 2 mM external calcium. KCl depolarization (140 mM) was induced in the presence of 2 mM external calcium. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/64114/64114fig06.jpg" /> 
Figure 6: Schematic presentation of the whole protocol. The different steps of the protocol are presented, from the in silico design to the in vitro molecular cloning and the final cell selection. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64114/64114fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="3">Sequence 5&#39;-3&#39;</td>
			<td>Purpose/Use</td>
		</tr>
		<tr>
			<td>Primer_Guide1F</td>
			<td colspan="3">Guide1 + gttttagagctagaaatagc</td>
			<td rowspan="4">Plasmid cloning</td>
		</tr>
		<tr>
			<td>Primer_Guide1R</td>
			<td colspan="3">Guide 1-RC +AGATCTGTGGTCTCATACAG</td>
		</tr>
		<tr>
			<td>Primer_Guide 2F</td>
			<td colspan="3">Guide 2 + gttttagagctagaaatagc</td>
		</tr>
		<tr>
			<td>Primer_Guide 2R</td>
			<td colspan="3">Guide 2-RC + GTTTCGTCCTTTCCACAAG</td>
		</tr>
		<tr>
			<td>Primer_XmaI F</td>
			<td colspan="3">TAGTGGATCCCCCGGGAAAATTCAAAATTTT</td>
			<td rowspan="2">Plasmids cloning and colonies control</td>
		</tr>
		<tr>
			<td>Primer_BlpI R</td>
			<td colspan="3">CGCTTCCATTGCTCAGCTGGCCGCTGCCCC</td>
		</tr>
		<tr>
			<td>Primer_KillerF</td>
			<td colspan="3">AATGGAGTACTTCTTGTCCAgttttagagctagaaatagc</td>
			<td rowspan="4">Cloning plasmid p_Killer</td>
		</tr>
		<tr>
			<td>Primer_KillerR</td>
			<td colspan="3">TGGACAAGAAGTACTCCATTAGATCTGTGGTCTCATACAG</td>
		</tr>
		<tr>
			<td>Primer_mCherryF</td>
			<td colspan="3">GAACAGTACGAACGCGCCGAgttttagagctagaaatagc</td>
		</tr>
		<tr>
			<td>Primer_mCherryR</td>
			<td colspan="3">TCGGCGCGTTCGTACTGTTCGTTTCGTCCTTTCCACAAG</td>
		</tr>
		<tr>
			<td>Primer_RYR1exonF</td>
			<td colspan="3">GCTCGTATTCGTCACCCGCGgttttagagctagaaatagc</td>
			<td rowspan="4">Cloning plasmid p_guides_RyR1</td>
		</tr>
		<tr>
			<td>Primer_RYR1exonR</td>
			<td colspan="3">CGCGGGTGACGAATACGAGCAGATCTGTGGTCTCATACAG</td>
		</tr>
		<tr>
			<td>Primer_RYR1intronF</td>
			<td colspan="3">TAAGTCAGTTCATAGGCGCTgttttagagctagaaatagc</td>
		</tr>
		<tr>
			<td>Primer_RYR1intronR</td>
			<td colspan="3">AGCGCCTATGAACTGACTTAGTTTCGTCCTTTCCACAAG</td>
		</tr>
		<tr>
			<td>Primer_BeforeRYR1cut</td>
			<td colspan="3">AGTCGTTACCATGTCTTCAGCCCT</td>
			<td rowspan="2">Clone selection for RYR1 KO</td>
		</tr>
		<tr>
			<td>Primer_AfterRYR1cut</td>
			<td colspan="3">CTGCCGATTCCACAGATGAAGCAC</td>
		</tr>
	</tbody>
</table>
Table 1: List of primers. Primers used for plasmid cloning and colony control, as well as the ones for the clone selection.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="2">Guide sequence</td>
			<td>PAM</td>
			<td colspan="2">Reverse Complement without PAM</td>
		</tr>
		<tr>
			<td>Guide 1: RYR1exon</td>
			<td colspan="2">GCTCGTATTCGTCACCCGCG&#160;</td>
			<td>GGG</td>
			<td colspan="2">CGCGGGTGACGAATACGAGC</td>
		</tr>
		<tr>
			<td>Guide 2: RYR1intron</td>
			<td colspan="2">TAAGTCAGTTCATAGGCGCT&#160;</td>
			<td>CGG</td>
			<td colspan="2">AGCGCCTATGAACTGACTTA</td>
		</tr>
		<tr>
			<td>Guide Killer Cas9</td>
			<td colspan="2">TGGACAAGAAGTACTCCATT</td>
			<td>GGG</td>
			<td colspan="2">AATGGAGTACTTCTTGTCCA</td>
		</tr>
		<tr>
			<td>Guide mCherry killer</td>
			<td colspan="2">GAACAGTACGAACGCGCCGA&#160;</td>
			<td>GGG</td>
			<td colspan="2">TCGGCGCGTTCGTACTGTTC</td>
		</tr>
	</tbody>
</table>
Table 2: Guides used to create the plasmid p_guides and the p_Killer. The sequences used for the development of the RyR1-KO clones are presented in this table.

Watch this Scientific Journal Video about Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing at JoVE.com

Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing

The protocol describes how to generate knock-out myoblasts using CRISPR/Cas9, starting from the design of guide-RNAs to the cellular cloning and characterization of the knock-out clones.

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, ...

development-knock-out-muscle-cell-lines-using-lentivirus-mediated

Nanyang Technological University

Research

JoVE Journal

Genetics

4.1K Views.  University Grenoble Alpes, INSERM, U1216, CHU Grenoble Alpes, Grenoble Institut Neurosciences. Dit protocol maakt de ontwikkeling van spiercel knock-out in elk gen mogelijk, om de functie van dit gen in de spier verder te bestuderen. Het voordeel is dat het goedkoop en sneller is dan de ontwikkeling van knock-out dieren om een gen te bestuderen. Deze techniek kan bijvoorbeeld worden gebruikt om de betrokkenheid van een nieuw geïdentificeerd gen bij een myopathie te bestuderen.Als de hier beschreven techniek wordt toegepast op iPS-cellen, kan dit leiden tot de ontwikkeling van k...

Video: Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

A New Toolkit for Evaluating Gene Functions using Conditional Cas9 Stabilization

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory tool to introduce accurate and targeted modifications in the genome. Its enormous popularity and rapid spread are attributed to its easy use and accuracy compared to its predecessors. Yet, the constitutive activation of the system has limited applications. In this paper, we describe a new method that allows temporal control of CRISPR/Cas9 activity based on conditional stabilization of the Cas9 protein. Fusing an engineered mutant of the rapamycin-binding protein FKBP12 to Cas9 (DD-Cas9) enables the rapid degradation of Cas9 that in turn can be stabilized by the presence of an FKBP12 synthetic ligand (Shield-1). Unlike other inducible methods, this system can be adapted easily to generate bi-cistronic systems to co-express DD-Cas9 with another gene of interest, without conditional regulation of the second gene. This method enables the generation of traceable systems as well as the parallel, independent manipulation of alleles targeted by Cas9 nuclease. The platform of this method can be used for the systematic identification and characterization of essential genes and the interrogation of the functional interactions of genes in in vitro and in vivo settings.

Here, we describe a genome-editing tool based on the temporal and conditional stabilization of clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (Cas9) under the small molecule, Shield-1. The method can be used for cultured cells and animal models.

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory ...

CRISPR/Cas9 Technology in Restoring Dystrophin Expression in iPSC-Derived Muscle Progenitors

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the exhaustion of muscle progenitor cells. Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene editing has the potential to restore the expression of the dystrophin gene. Autologous induced pluripotent stem cells (iPSCs)-derived muscle progenitor cells (MPC) can replenish the stem/progenitor cell pool, repair damage, and prevent further complications in DMD without causing an immune response. In this study, we introduce a combination of CRISPR/Cas9 and non-integrated iPSC technologies to obtain muscle progenitors with recovered dystrophin protein expression. Briefly, we use a non-integrating Sendai vector to establish an iPSC line from dermal fibroblasts of Dmdmdx mice. We then use the CRISPR/Cas9 deletion strategy to restore dystrophin expression through a non-homologous end joining of the reframed dystrophin gene. After PCR validation of exon23 depletion in three colonies from 94 picked iPSC colonies, we differentiate iPSC into MPC by doxycycline (Dox)-induced expression of MyoD, a key transcription factor playing a significant role in regulating muscle differentiation. Our results show the feasibility of using CRISPR/Cas9 deletion strategy to restore dystrophin expression in iPSC-derived MPC, which has significant potential for developing future therapies for the treatment of DMD.

Here, we present a Cas9-based exon23 deletion protocol to restore dystrophin expression in iPSC from Dmdmdx mouse-derived skin fibroblasts and directly differentiate iPSCs into myogenic progenitor cells (MPC) using the Tet-on MyoD activation system.

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the ...

Developmental Biology

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

Neuroscience

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGF&#946;. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.

Here, we present a protocol to genetically modify primary or expanded human natural killer (NK) cells using Cas9 Ribonucleoproteins (Cas9/RNPs). By using this protocol, we generated human NK cells deficient for transforming growth factor&#8211;b receptor 2 (TGFBR2) and hypoxanthine phosphoribosyltransferase 1 (HPRT1).

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging ...

Immunology and Infection

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to proteins of interest. Identification of gene functions in cell line models is important for gene discovery and exploration of cell-intrinsic mechanisms. However, genetic manipulations of immune cells such as T cells and macrophage cell lines using CRISPR/Cas9-mediated knock-in are difficult because of the low transfection efficiency of these cells, especially in a quiescent state. To modify genes in immune cells, drug-resistance selection and viral vectors are typically used to enrich for cells expressing the CRIPSR/Cas9 system, which inevitably results in undesirable intervention of the cells. In a previous study, we designed dual fluorescent reporters coupled to CRISPR/Cas9 that were transiently expressed after electroporation. This technical solution leads to rapid gene deletion in immune cells; however, gene knock-in in immune cells such as T cells and macrophages without the use of drug-resistance selection or viral vectors is even more challenging. In this article, we show that by using cell sorting to aid selection of cells transiently expressing CRISPR/Cas9 constructs targeting the Rosa26 locus in combination with a donor plasmid, gene knock-in can be achieved in both T cells and macrophages without drug-resistance enrichment. As an example, we show how to express human ACE2, a receptor of SARS-Cov-2, which is responsible for the current Covid-19 pandemic, in RAW264.7 macrophages by performing knock-in experiments. Such gene knock-in cells can be widely used for mechanistic studies.

This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to ...

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing

Samenvatting

Meer video's verkennen