The authors want to acknowledge the staff of the flow cytometry facility and animal facility of CSCR. A. C. is funded by an ICMR-SRF fellowship, K. V. K. is funded by a DST-INSPIRE fellowship, and P. B. is funded by a CSIR-JRF fellowship. This work was funded by the Department of Biotechnology, Government of India (grant no. BT/PR26901/MED/31/377/2017 and BT/PR31616/MED/31/408/2019)

<ol>
	<li>Staal, F. J. T., Aiuti, A., Cavazzana, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autologous+stem-cell-based+gene+therapy+for+inherited+disorders:+State+of+the+art+and+perspectives.">Autologous stem-cell-based gene therapy for inherited disorders: State of the art and perspectives.</a> Frontiers in Pediatrics. 7, 443 (2019).</li><li>Naldini, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+hematopoiesis:+Current+stage+of+clinical+translation+and+future+perspectives.">Genetic engineering of hematopoiesis: Current stage of clinical translation and future perspectives.</a> EMBO Molecular Medicine. 11 (3), 9958 (2019).</li><li>Srivastava, A., Shaji, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cure+for+thalassemia+major+-+From+allogeneic+hematopoietic+stem+cell+transplantation+to+gene+therapy.">Cure for thalassemia major - From allogeneic hematopoietic stem cell transplantation to gene therapy.</a> Haematologica. 102 (2), 214-223 (2017).</li><li>Venkatesan, V., Srinivasan, S., Babu, P., Thangavel, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+developmental+gamma-globin+gene+expression:+An+approach+for+healing+hemoglobinopathies.">Manipulation of developmental gamma-globin gene expression: An approach for healing hemoglobinopathies.</a> Molecular and Cellular Biology. 41 (1), 00253 (2020).</li><li>Mazurier, F., Gan, O. I., McKenzie, J. L., Doedens, M., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentivector-mediated+clonal+tracking+reveals+intrinsic+heterogeneity+in+the+human+hematopoietic+stem+cell+compartment+and+culture-induced+stem+cell+impairment.">Lentivector-mediated clonal tracking reveals intrinsic heterogeneity in the human hematopoietic stem cell compartment and culture-induced stem cell impairment.</a> Blood. 103 (2), 545-552 (2004).</li><li>Piras, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+escape+innate+sensing+but+trigger+p53+in+human+hematopoietic+stem+and+progenitor+cells.">Lentiviral vectors escape innate sensing but trigger p53 in human hematopoietic stem and progenitor cells.</a> EMBO Molecular Medicine. 9 (9), 1198-1211 (2017).</li><li>Christopher, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preferential+expansion+of+human+CD34+CD133+CD90++hematopoietic+stem+cells+enhances+gene-modified+cell+frequency+for+gene+therapy.">Preferential expansion of human CD34+CD133+CD90+ hematopoietic stem cells enhances gene-modified cell frequency for gene therapy.</a> Human Gene Therapy. 33 (3-4), 188-201 (2021).</li><li>Karuppusamy, K. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CCR5+gene+edited+CD34++CD90++hematopoietic+stem+cell+population+serves+as+an+optimal+graft+source+for+HIV+gene+therapy.">The CCR5 gene edited CD34+ CD90+ hematopoietic stem cell population serves as an optimal graft source for HIV gene therapy.</a> Frontiers in Immunology. 13, 792684 (2022).</li><li>Hopman, R. K., DiPersio, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+stem+cell+mobilization.">Advances in stem cell mobilization.</a> Blood reviews. 28 (1), 31-40 (2014).</li><li>Hoffman, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Counting+Cells.">Counting Cells.</a> Cell Biology: A laboratory handbook. 1, 21-24 (2006).</li><li>Antoniani, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+fetal+hemoglobin+synthesis+by+CRISPR/Cas9-mediated+editing+of+the+human+b-globin+locus.">Induction of fetal hemoglobin synthesis by CRISPR/Cas9-mediated editing of the human b-globin locus.</a> Blood. 131 (17), 1960-1973 (2018).</li><li>Azhagiri, M. K. K., Babu, P., Venkatesan, V., Thangavel, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology-directed+gene-editing+approaches+for+hematopoietic+stem+and+progenitor+cell+gene+therapy.">Homology-directed gene-editing approaches for hematopoietic stem and progenitor cell gene therapy.</a> Stem Cell Research &amp; Therapy. 12, 500 (2021).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. (45), e2565 (2010).</li><li>Bagchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+generation+of+immortalized+erythroid+progenitor+cell+lines+from+peripheral+blood+mononuclear+cells.">Direct generation of immortalized erythroid progenitor cell lines from peripheral blood mononuclear cells.</a> Cells. 10 (3), 1-18 (2021).</li><li>Ravi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+novel+HPFH-like+mutations+by+CRISPR+base+editing+that+elevates+the+expression+of+fetal+hemoglobin.">Identification of novel HPFH-like mutations by CRISPR base editing that elevates the expression of fetal hemoglobin.</a> eLife. 11, 65421 (2020).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> CRISPR Journal. 5 (1), 123-130 (2022).</li><li>Shultz, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+lymphoid+and+myeloid+cell+development+in+NOD/LtSz-scid+IL2R&#947;null+mice+engrafted+with+mobilized+human+hemopoietic+stem+cells.">Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R&#947;null mice engrafted with mobilized human hemopoietic stem cells.</a> The Journal of Immunology. 174 (10), 6477-6489 (2005).</li><li>McIntosh, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonirradiated+NOD,B6.SCID+Il2r&#947;-/-+Kit(W41/W41)+(NBSGW)+mice+support+multilineage+engraftment+of+human+hematopoietic+cells.">Nonirradiated NOD,B6.SCID Il2r&#947;-/- Kit(W41/W41) (NBSGW) mice support multilineage engraftment of human hematopoietic cells.</a> Stem Cell Reports. 4 (2), 171-180 (2015).</li><li>Leonard, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-dose+busulfan+reduces+human+CD34++cell+doses+required+for+engraftment+in+c-kit+mutant+immunodeficient+mice.">Low-dose busulfan reduces human CD34+ cell doses required for engraftment in c-kit mutant immunodeficient mice.</a> Molecular Therapy - Methods &amp; Clinical Development. 15, 430-437 (2019).</li><li>Tateno, A., Sakai, K., Koya, N., Aoki, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+total+asphyxia+on+the+development+of+synaptic+junctions+in+the+brains+of+mice.">Effects of total asphyxia on the development of synaptic junctions in the brains of mice.</a> Acta Paediatrica Japonica; Overseas Edition. 34 (1), 1-5 (1992).</li><li>Audig&#233;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+leukocyte+reconstitution+in+NSG+mice+transplanted+with+human+cord+blood+hematopoietic+stem+and+progenitor+cells.">Long-term leukocyte reconstitution in NSG mice transplanted with human cord blood hematopoietic stem and progenitor cells.</a> BMC Immunology. 18 (1), 1-15 (2017).</li><li>Nimmerjahn, F., Ravetch, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fc-receptors+as+regulators+of+immunity.">Fc-receptors as regulators of immunity.</a> Advances in immunology. 96, 179-204 (2007).</li><li>Boitano, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aryl+hydrocarbon+receptor+antagonists+promote+the+expansion+of+human+hematopoietic+stem+cells.">Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells.</a> Science. 329 (5997), 1345-1348 (2010).</li><li>Ngom, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UM171+enhances+lentiviral+gene+transfer+and+recovery+of+primitive+human+hematopoietic+cells.">UM171 enhances lentiviral gene transfer and recovery of primitive human hematopoietic cells.</a> Molecular Therapy - Methods &amp; Clinical Development. 10, 156-164 (2018).</li><li>Park, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+proliferation+of+human+umbilical+cord+blood-derived+CD34++hematopoietic+stem+cells+by+a+combination+of+hyper-interleukin-6+and+small+molecules.">Enhancement of proliferation of human umbilical cord blood-derived CD34+ hematopoietic stem cells by a combination of hyper-interleukin-6 and small molecules.</a> Biochemistry and Biophysics Reports. 29, 101214 (2022).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentivirus-based+gene+therapy+of+hematopoietic+stem+cells+in+Wiskott-Aldrich+syndrome.">Lentivirus-based gene therapy of hematopoietic stem cells in Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Rai, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cell+culture+conditions+promote+ex-vivo+manipulation+and+expansion+of+primitive+hematopoietic+stem+cells+for+therapeutic+gene+editing.">Optimized cell culture conditions promote ex-vivo manipulation and expansion of primitive hematopoietic stem cells for therapeutic gene editing.</a> bioRxiv. , (2022).</li><li>Wilkinson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-AAV6+gene+correction+of+beta-globin+in+autologous+HSCs+improves+sickle+cell+disease+erythropoiesis+in+mice.">Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice.</a> Nature Communications. 12 (1), 1-9 (2021).</li></ol>

The authors declare that no competing financial interests exist.

The successful outcome of HSPC gene therapy relies predominantly on the quality and quantity of engraftable HSCs in the graft. However, the functional properties of HSCs are highly affected during the preparatory phase of gene therapy products, including by in vitro culture and toxicity associated with the gene manipulation procedure. To overcome these limitations, we have identified ideal HSPCs culture conditions that retain the stemness of CD34+CD133+CD90+ HSCs in ex&#160;vivo culture. Many research groups have used SR1 or UM171 or other molecules as stand-alone molecules to expand umbilical cord blood (UCB) HSPCs in vitro23,24. A previous study used a combination of both SR1 and UM17125. The small molecules and cytokines of the culture medium were specifically optimized for mobilized adult HSPCs and their application in autologous gene therapy. The screening experiment showed that combining three small molecules Resveratrol, UM729, and SR1, is important for generating a high number of CD34+CD90+ cells and inhibiting the proliferation of differentiated and committed progenitor cells. The UM729 in the RUS cocktail can be replaced with UM171. However, the commercial procurement of UM171 is less feasible. The cytokine concentrations are adopted from the protocol that was employed in clinical studies26 to reduce the variabilities during the scale-up process. The cytokine cocktail contains IL6 instead of IL3 to minimize progenitor proliferation and HSC exhaustion in vitro27. Preparing fresh aliquots of the culture media (basal media + RUS + cytokine cocktails) is recommended to reduce experimental variation and obtain high reproducibility. The protocol is applicable for both NHEJ- and HDR-mediated gene editing. In particular, HSPC culture of 48-72 h before electroporation and 24 h post electroporation is crucial for HDR gene editing. The optimized culture conditions should benefit HDR gene editing by preserving the stem cells. It was also observed that the culture conditions assist lentiviral transduction in long-term HSCs. This suggests that, if viral particles like AAV6 or IDLV are used as an HDR donor, the HDR editing efficiency is expected to improve, as the optimized culture conditions promote donor delivery into HSCs.
To assess gene editing outcomes, including NHEJ and HDR, NGS analysis, probe or ddPCR analysis, or Sanger sequencing7,8,28 is suggested, followed by deconvolution using online tools (ICE/ICE Knock-In)16, owing to its robust quantitative nature. Alternatively, a T7 endonuclease assay can be performed on edited DNA samples, and the fragmented DNA bands can be quantified using ImageJ. However, the T7 endonuclease assay approach is less precise than deconvolution analysis and targets next-generation sequencing.
The transplantation protocol is also optimized by conditioning the NBSGW mice with busulfan, enabling low cell doses to assess HSPC engraftment and repopulation. Overall, this procedure must reduce the doses of HSPCs required for gene manipulation and increase the accessibility of HSPC gene therapy in developing countries.
In the present study, the protocols for PBMNC isolation, CD34+ HSPC purification, gene editing and validation, and assessment of the engrafted gene-edited HSPCs in mouse bone marrow were demonstrated. It has also been proven&#160;that the optimized HSPC culture enriches CD34+CD133+CD90+ HSPCs and increases the chimerism of gene-edited cells in vivo.

The inaccessibility to human leukocyte antigen (HLA)-matched donors in allogenic transplantation settings and the rapid development of highly versatile and safe genetic engineering tools make autologous hematopoietic stem cell transplantation (HSCT) a curative treatment strategy for the hereditary blood disorders1,2. Autologous hematopoietic stem and progenitor cell (HSPC) gene therapy involves the collection of patients&#39; HSPCs, genetic manipulation, correction of disease-causing mutations, and transplantation of gene-corrected HSPCs into the patient3,4. However, the successful outcome of the gene therapy relies on the quality of the transplantable gene-modified graft. The gene manipulation steps and ex vivo culture of HSPCs affect the quality of the graft by decreasing the frequency of long-term hematopoietic stem cells (LT-HSCs), necessitating the infusion of large doses of gene-manipulated HSPCs2,5,6.
Several small molecules, including SR1 and UM171, are currently being employed to expand cord blood HSPCs robustly7,8. For adult HSPCs, due to the higher cell yield obtained on mobilization, robust expansion is not required. However, retaining the stemness of isolated HSPCs in ex vivo culture is crucial for its gene therapy applications. Therefore, an approach focusing on the culture enrichment of hematopoietic stem cells (HSCs) is developed using a combination of small molecules: Resveratrol, UM729, and SR1 (RUS)7. The optimized HSPC culture conditions promote the enrichment of HSCs, resulting in increased frequency of gene-modified HSCs in vivo, and reduce the need for gene manipulating large doses of HSPCs, facilitating cost-effective gene therapy approaches8.
Here, a comprehensive protocol for HSPCs culture is described, along with the infusion and analysis of gene-edited cells in vivo.

<table><tbody><tr><td>4D-Nucleofector&amp;reg; X Unit</td><td>LONZA BIOSCIENCE</td><td>AAF-1003X</td><td></td></tr><tr><td>4D-Nucleofector&amp;trade; X Kit ( 16-well Nucleocuvette&amp;trade; Strips)</td><td>LONZA BIOSCIENCE</td><td>V4XP-3032</td><td></td></tr><tr><td>Antibiotic-Antimycotic (100X)</td><td>THERMO SCIENTIFIC</td><td>15240096</td><td></td></tr><tr><td>Anti-human CD45 APC</td><td>BD BIOSCIENCE&amp;nbsp;</td><td>555485&amp;nbsp;</td><td></td></tr><tr><td>Anti-human CD13 PE</td><td>BD BIOSCIENCE</td><td>555394</td><td></td></tr><tr><td>Anti-human CD19 PerCP</td><td>BD BIOSCIENCE</td><td>340421</td><td></td></tr><tr><td>Anti-human CD3 PE-Cy7</td><td>BD BIOSCIENCE</td><td>557749</td><td></td></tr><tr><td>Anti-human CD90 APC</td><td>BD BIOSCIENCE</td><td>561971</td><td></td></tr><tr><td>Anti-human CD133/1&amp;nbsp;</td><td>Miltenyibiotec</td><td>130-113-673</td><td></td></tr><tr><td>Anti-human CD34 PE</td><td>BD BIOSCIENCE</td><td>348057</td><td></td></tr><tr><td>Anti-mouse CD45.1 PerCP-Cy5</td><td>BD BIOSCIENCE</td><td>560580</td><td></td></tr><tr><td>Blood Irradator-2000</td><td>&amp;nbsp;BRIT (Department of Biotechnology, India)</td><td>BI 2000&amp;nbsp;</td><td></td></tr><tr><td>Cell culture dish (delta surface-treated 6-well plates)</td><td>NUNC (THERMO SCIENTIFIC)</td><td>140675</td><td></td></tr><tr><td>CrysoStor CS10</td><td>BioLife solutions</td><td>#07952</td><td></td></tr><tr><td>Busulfan</td><td>CELON LABS (60mg/10mL)</td><td>-&amp;nbsp;</td><td></td></tr><tr><td>Guide-it Recombinant Cas9</td><td>TAKARA BIO</td><td>632640</td><td></td></tr><tr><td>Cas9-eGFP</td><td>SIGMA</td><td>C120040&amp;nbsp;</td><td></td></tr><tr><td>&amp;nbsp;Centrifuge tube-15ml</td><td>CORNING</td><td>430790</td><td></td></tr><tr><td>&amp;nbsp;Centrifuge tube-50ml</td><td>NUNC (THERMO SCIENTIFIC)</td><td>339652</td><td></td></tr><tr><td>DMSO</td><td>MPBIO</td><td>219605590</td><td></td></tr><tr><td>DNAase</td><td>STEMCELL TECHNOLOGIES</td><td>6469</td><td></td></tr><tr><td>Dulbecco&amp;prime;s Phosphate Buffered Saline- 1X</td><td>HYCLONE</td><td>SH30028.02</td><td></td></tr><tr><td>EasySep&amp;trade; Human CD34 Positive Selection Kit II</td><td>STEMCELL TECHNOLOGIES</td><td>17856</td><td></td></tr><tr><td>EasySep magnet</td><td>STEMCELL TECHNOLOGIES</td><td>18000</td><td></td></tr><tr><td>Electrophoresis unit</td><td>ORANGE INDIA</td><td>HDS0036</td><td></td></tr><tr><td>FBS</td><td>THERMO SCIENTIFIC</td><td>10270106</td><td></td></tr><tr><td>Flow cytometer &amp;ndash; ARIA III</td><td>BD BIOSCIENCE</td><td>-&amp;nbsp;</td><td></td></tr><tr><td>FlowJo&amp;nbsp;</td><td>BD BIOSCIENCE</td><td>&amp;nbsp;-</td><td></td></tr><tr><td>Flt3-L</td><td>PEPROTECH</td><td>300-19-1000</td><td></td></tr><tr><td>Gel imaging system</td><td>CELL BIOSCIENCES</td><td>11630453</td><td></td></tr><tr><td>HighPrep DTR reagent</td><td>MAGBIOGENOMICS</td><td>DT-70005</td><td></td></tr><tr><td>Human BD Fc Block</td><td>BD BIOSCIENCE</td><td>553141</td><td></td></tr><tr><td>IL6</td><td>PEPROTECH</td><td>200-06-50</td><td></td></tr><tr><td>IMDM media</td><td>THERMO SCIENTIFIC</td><td>12440053</td><td></td></tr><tr><td>Infrared lamp</td><td>MURPHY</td><td>-</td><td></td></tr><tr><td>Insulin syringe 6mm 31G</td><td>BD BIOSCIENCE</td><td>324903</td><td></td></tr><tr><td>Ketamine</td><td>KETMIN 50</td><td>-</td><td></td></tr><tr><td>Loading dye 6X</td><td>TAKARA BIO</td><td>9156</td><td></td></tr><tr><td>Lymphoprep</td><td>STEMCELL TECHNOLOGIES</td><td>7851</td><td></td></tr><tr><td>Mice Restrainer</td><td>AVANTOR</td><td>TV-150</td><td></td></tr><tr><td>Nano drop spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>ND-2000C</td><td></td></tr><tr><td>Neubauer cell counting chamber</td><td>ROHEM INSTRUMENTS</td><td>CC-3073</td><td></td></tr><tr><td>NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG)</td><td>The Jackson Laboratory</td><td>RRID:IMSR_JAX:005557</td><td></td></tr><tr><td>NOD,B6.SCID Il2r&amp;gamma;&amp;minus;/&amp;minus;KitW41/W41 (NBSGW)</td><td>The Jackson Laboratory</td><td>RRID:IMSR_JAX:026622</td><td></td></tr><tr><td>Nunc delta 6-well plate</td><td>THERMO SCIENTIFIC</td><td>140675</td><td></td></tr><tr><td>Polystyrene round-bottom tube</td><td>BD</td><td>352008</td><td></td></tr><tr><td>P3 primary cell Nucleofection solution</td><td>LONZA BIOSCIENCE</td><td>PBP3-02250</td><td></td></tr><tr><td>Pasteur pipette</td><td>FISHER SCIENTIFIC</td><td>13-678-20A</td><td></td></tr><tr><td>PCR clean-up kit</td><td>TAKARA BIO</td><td>740609.25</td><td></td></tr><tr><td>Mouse Pie Cage</td><td>FISCHER SCIENTIFIC</td><td>50-195-5140</td><td></td></tr><tr><td>polystyrene round-bottom tube (12 x 75 mm)</td><td>STEMCELL TECHNOLOGIES</td><td>38007</td><td></td></tr><tr><td>Primer3</td><td>Whitehead Institute for Biomedical Research</td><td>&lt;a href=&quot;https://primer3.ut.ee/&quot;&gt;https://primer3.ut.ee/&lt;/a&gt;</td><td></td></tr><tr><td>QuickExtract&amp;trade; DNA Extraction Solution</td><td>Lucigen</td><td>QE09050</td><td></td></tr><tr><td>Reserveratrol</td><td>STEMCELL TECHNOLOGIES</td><td>72862</td><td></td></tr><tr><td>SCF</td><td>PEPROTECH</td><td>300-07-1000</td><td></td></tr><tr><td>SFEM-II</td><td>STEMCELL TECHNOLOGIES</td><td>9655</td><td></td></tr><tr><td>sgRNA</td><td>SYNTHEGO</td><td>-&amp;nbsp;</td><td></td></tr><tr><td>SPINWIN</td><td>TARSON</td><td>1020</td><td></td></tr><tr><td>StemReginin 1</td><td>STEMCELL TECHNOLOGIES</td><td>72342</td><td></td></tr><tr><td>ICE analysis tool</td><td>SYNTHEGO</td><td>&lt;a href=&quot;https://ice.synthego.com/&quot;&gt;https://ice.synthego.com/&lt;/a&gt;</td><td></td></tr><tr><td>Tris-EDTA buffer solution (TE) 1X</td><td>SYNTHEGO</td><td>Supplied with gRNA&amp;nbsp;</td><td></td></tr><tr><td>Thermocycler</td><td>APPLIED BIOSYSTEMS</td><td>4375305</td><td></td></tr><tr><td>TPO</td><td>PEPROTECH</td><td>300-18-1000</td><td></td></tr><tr><td>Trypan blue</td><td>HIMEDIA LABS</td><td>TCL046</td><td></td></tr><tr><td>UM171</td><td>STEMCELL TECHNOLOGIES</td><td>72914</td><td></td></tr><tr><td>UM729</td><td>STEMCELL TECHNOLOGIES</td><td>72332</td><td></td></tr><tr><td>Xylazine</td><td>XYLAXIN - INDIAN IMMUNOLOGICALS LIMITED</td><td>-</td><td></td></tr></tbody></table>

crispr/cas9 gene editing of hematopoietic stem and progenitor cells for gene therapy applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present study identifies ideal HSPC culture conditions that facilitate the retention of CD34+CD133+CD90+ HSCs in ex vivo culture. To demonstrate the culture enrichment of HSCs along with the enhanced generation of gene-modified HSCs, the optimized procedures for PBMNC isolation, CD34+ cell purification, culture, gene editing, transplantation, characterization of engraftment, and gene-modified cells in vivo are provided (Figure 1). Post purification, flow cytometry evaluation was performed to check the HSPC markers, and HSPCs were cultured for 72 h. After 72 h of culture, the HSPCs were nucleofected with Cas9 RNP and cultured for an additional 2 days. The optimized culture conditions containing the RUS cocktail showed increased viability and higher frequency of CD34+CD133+CD90+ HSCs and increased gene-editing frequency (Figure 2). To further demonstrate that the optimized culture conditions increase the frequency of gene-modified cells in vivo, day 3 HSPCs targeting the CCR5 locus were gene-edited and infused into sub-lethally irradiated NSG mice. The engraftment of human cells in mouse bone marrow (BM) was analyzed 16 weeks post infusion (Figure 3A). Flow cytometry analysis of human CD45+ (hCD45)&#160;cells in NSG mice showed increased engraftment in the culture conditions (Figure 3B,C). Analysis of the gene-editing frequency in the mouse BM cells showed increased engraftment of gene-edited HSPCs in RUS-supplemented culture conditions (Figure 3D).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64064/64064fig01.jpg" /> 
Figure 1: Summary of the present study. Graphical summary of the procedure involved in isolating PBMNCs, the magnetic enrichment of CD34+ cells from PBMNCs, culturing, the characterization of human hematopoietic stem and progenitor cells (HSPCs), gene editing, and transplantation is represented. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64064/64064fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64064/64064fig02.jpg" /> 
Figure 2: The RUS cocktail enriches the frequency of HSCs. The mPB-HSPCs were cultured in the stem cell culture media containing cytokines with vehicle (DMSO) and RUS cocktail for 3 days and gene-edited with 25 pM of Cas9-RNP. The gene-edited cells were analyzed by FACS for the markers for HSPCs 48 h post nucleofection. (A) Flow plots represents the live cells (7AAD-) and CD34+ CD90+ population. (B) The percentage and frequency of indel patterns analyzed 72 h post editing in the DMSO and RUS-treated group. (C) The absolute number of CD34+ CD90+ cells analyzed 48 h post editing (n = 2) (donor = 1). (D) The absolute number of total nucleated cells (TNC) analyzed 48 h post-editing (n = 2) (donor = 1). Error bars represent mean &#177; SEM, *p &#8804; 0.05 (unpaired t-test). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64064/64064fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64064/64064fig03.jpg" /> 
Figure 3: Optimized culture conditions increase the frequency of gene-modified cells in vivo. (A) Schematic representation of the experiment. (B) Representative FACS plot showing the hCD45+ cells in the mouse BM. The inset refers to human cells (left) and mouse cells (right). HSPCs were cultured for 3 days, gene-edited with sgRNA on day 3, and transplanted immediately post electroporation. (C) The engraftment of human cells in mouse BM at 16 weeks post infusion (n = 4). (D) The human gene-modified cell (hCD45+ gene-edited cells) chimerism in mouse BM at 16 weeks post-infusion (n = 4) (donor = 1). Each dot represents an individual mouse, and the data points are from an individual experiment. Error bars represent mean &#177; SEM, *p&#8804; 0.05 (unpaired t-test). The figure is adapted with permission from Christopher et al.7. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64064/64064fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Cell count</td>
			<td>Purification buffer (mL)</td>
		</tr>
		<tr>
			<td>&#60; 1 x 107 cells</td>
			<td>0.1</td>
		</tr>
		<tr>
			<td>1 x 107 - 1 x 108 cells</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>1 - 5 x 108 cells</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 1: The volume of purification buffer to prepare the cellular suspension for CD34+ cell purification.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>CCR5 Forward</td>
			<td>CAGAGCCAAGCTCTCCATC</td>
		</tr>
		<tr>
			<td>CCR5 Reverse</td>
			<td>AGAGACGCAAACACAGCCA</td>
		</tr>
		<tr>
			<td>CCR5 sequencing Forward primer</td>
			<td>AATGTAGACATCTATGTAGG</td>
		</tr>
	</tbody>
</table>
Table 2: Primer sequence for amplifying the CCR5 locus.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components</td>
			<td>50 &#181;L reaction</td>
		</tr>
		<tr>
			<td>Buffer (5x)</td>
			<td>10 &#181;L</td>
		</tr>
		<tr>
			<td>Forward primer (10 &#181;M)</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse primer (10 &#181;M)</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>4 &#181;L</td>
		</tr>
		<tr>
			<td>Polymerase</td>
			<td>1 &#181;L</td>
		</tr>
		<tr>
			<td>Genomic DNA</td>
			<td>200 ng</td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>upto 50 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 3: The reaction mixture for amplifying the CCR5 locus using PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Duration</td>
			<td>Temperature</td>
			<td>No of Cycles</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>1 min</td>
			<td>95 &#176;C</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>10 s</td>
			<td>98 &#176;C</td>
			<td rowspan="3">35</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>15 s</td>
			<td>56 &#176;C</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>30 s</td>
			<td>68 &#176;C</td>
		</tr>
		<tr>
			<td>Final extension</td>
			<td>1 min</td>
			<td>72 &#176;C</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>&#8734;</td>
			<td>15 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4: Thermocycler conditions for amplifying the CCR5 locus.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components</td>
			<td>10 &#181;L reaction</td>
		</tr>
		<tr>
			<td>Buffer (5x)</td>
			<td>2 &#181;L</td>
		</tr>
		<tr>
			<td>primer (2 &#181;M)</td>
			<td>1.6 &#181;L</td>
		</tr>
		<tr>
			<td>RR&#160; mix</td>
			<td>0.75 &#181;L</td>
		</tr>
		<tr>
			<td>PCR cleanup product</td>
			<td>80 ng</td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>upto 10 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 5: The reaction mixture for Sanger sequencing PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Duration</td>
			<td>Temperature</td>
			<td>No of cycles</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>15 s</td>
			<td>96 &#176;C</td>
			<td rowspan="3">27</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>20 s</td>
			<td>55 &#176;C</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>4 min</td>
			<td>60 &#176;C</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>&#8734;</td>
			<td>15 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 6: Thermocycler conditions for Sanger sequencing PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Buffer</td>
			<td>Composition</td>
		</tr>
		<tr>
			<td>10x RBC lysis buffer &#8211; 100 mL (pH &#8211; 7.3)</td>
			<td>8.26 g of NH4Cl, 1.19 g of NaHCO3, 200 &#181;L of EDTA (0.5 M, pH8)</td>
		</tr>
		<tr>
			<td>50x TAE buffer (pH &#8211; 8.3)</td>
			<td>Dissolve 50 mM EDTA sodium salt, 2 M Tris, 1 M glacial acetic acid in 1 L of water</td>
		</tr>
	</tbody>
</table>
Table 7: Buffer Compositions
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibodies</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>Anti-human CD45 APC</td>
			<td>3 &#181;L</td>
		</tr>
		<tr>
			<td>Anti-mouse CD45.1 PerCP-Cy5</td>
			<td>4.5 &#181;L</td>
		</tr>
		<tr>
			<td>Anti-mouse CD34 PE</td>
			<td>3 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 8: Antibodies used for assessing human cell engraftment.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibodies</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>Anti-human CD45 APC</td>
			<td>3 &#181;L</td>
		</tr>
		<tr>
			<td>Anti-mouse CD19 PerCP</td>
			<td>15 &#181;L</td>
		</tr>
		<tr>
			<td>Anti-mouse CD13 PE</td>
			<td>15 &#181;L</td>
		</tr>
		<tr>
			<td>Anti-mouse CD3 PE-Cy7</td>
			<td>2 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 9: Antibodies used for assessing the proportion of multilineage cells derived from engrafted HSPCs.

Watch this Scientific Journal Video about CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications at JoVE.com

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene ...

crisprcas9-gene-editing-hematopoietic-stem-progenitor-cells-for-gene

Nanyang Technological University

Research

JoVE Journal

Biology

3.4K Views.  Christian Medical College campus. Ex vivo kweek kan het herbevolkingspotentieel van hematopoëtische stam- en voorlopercellen belemmeren. Ons protocol behoudt de stamheid tijdens de kweek en verbetert zo de frequentie van gen-gemodificeerde cellen in vivo. Hematopoietische stamcelgentherapie wordt momenteel gebruikt voor monogene ziekten en infectieziekten zoals HIV.Het HSPC-gentherapieprotocol is sterk afhankelijk van ex vivo cultuur. Ons protocol moet compatibel zijn met elke procedure die ex vivo cultuur gebruikt. D...

Video: CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Cancer Research

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genetics

Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are significant limitations to its widespread use in the treatment of cancer. These limitations include the development of unique toxicities such as cytokine release syndrome (CRS) and neurotoxicity (NT) and limited expansion, effector functions, and anti-tumor activity in solid tumors. One strategy to enhance CAR-T efficacy and/or control toxicities of CAR-T cells is to edit the genome of the CAR-T cells themselves during CAR-T cell manufacturing. Here, we describe the use of CRISPR/Cas9 gene editing in CAR-T cells via transduction with a lentiviral construct containing a guide RNA to granulocyte macrophage colony-stimulating factor (GM-CSF) and Cas9. As an example, we describe CRISPR/Cas9 mediated knockout of GM-CSF. We have shown that these GM-CSFk/o CAR-T cells effectively produce less GM-CSF while maintaining critical T cell function and result in enhanced anti-tumor activity in vivo compared to wild type CAR-T cells.

Here, we present a protocol to genetically edit CAR-T cells via a CRISPR/Cas9 system.

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional properties such as proliferation and differentiation, thereby promoting the development of hematologic malignancies. Efficient and precise genetic manipulation of HSPCs is required to model, characterize, and better understand the functional consequences of recurrent somatic mutations. Mutations can have a deleterious effect on a gene and result in loss-of-function (LOF) or, in stark contrast, may enhance function or even lead to novel characteristics of a particular gene, termed gain-of-function (GOF). In contrast to LOF mutations, GOF mutations almost exclusively occur in a heterozygous fashion. Current genome-editing protocols do not allow for the selective targeting of individual alleles, hampering the ability to model heterozygous GOF mutations. Here, we provide a detailed protocol on how to engineer heterozygous GOF hotspot mutations in human HSPCs by combining CRISPR/Cas9-mediated homology-directed repair and recombinant AAV6 technology for efficient DNA donor template transfer. Importantly, this strategy makes use of a dual fluorescent reporter system to allow for the tracking and purification of successfully heterozygously edited HSPCs. This strategy can be employed to precisely investigate how GOF mutations affect HSPC function and their progression toward hematological malignancies.

Novel strategies to faithfully model somatic mutations in hematopoietic stem and progenitor cells (HSPCs) are necessary to better study hematopoietic stem cell biology and hematological malignancies. Here, a protocol to model heterozygous gain-of-function mutations in HSPCs by combining the use of CRISPR/Cas9 and dual rAAV donor transduction is described.

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional ...

Evaluation of Abnormal Growth-related Genes of Hematopoietic Stem and Progenitor Cells by Combining CRISPR/Cas9 Technology with Cell Counting

Hematopoietic stem cells possess the ability for long-term self-renewal and the potential to differentiate into various types of mature blood cells. However, the accumulation of cancerous mutations in hematopoietic stem and progenitor cells (HSPCs) can block normal differentiation, induce aberrant proliferation, and ultimately lead to leukemogenesis. To identify and/or evaluate the cancerous mutations, we integrated CRISPR/Cas9 technology with the Cell Counting Kit-8 (CCK-8) assay to investigate a model gene Trp53, that is essential for abnormal proliferative ability of HSPCs. Specifically, bone marrow cells enriched for HSPCs from Cas9 mice were harvested and then subjected to viral transfection with single-guide RNAs (sgRNAs) targeting one or several candidate genes to introduce genetic alterations in HSPCs. Then, a CCK-8 assay was performed to investigate the proliferative capacity of transfected HSPCs. The sgRNA targeting efficiency was confirmed by a Tracking of Indels by Decomposition assay. These identified genes may play crucial roles in leukemogenesis and could serve as potential therapeutic targets.

Here, we present a protocol that integrates CRISPR/Cas9 technology with the Cell Counting Kit-8 (CCK-8) assay to identify candidate genes that are crucial for the abnormal proliferative capacity of hematopoietic stem and progenitor cells.

Hematopoietic stem cells possess the ability for long-term self-renewal and the potential to differentiate into various types of mature blood cells. ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Immunology and Infection

Production of Human CRISPR-Engineered CAR-T Cells

Adoptive cell therapies using chimeric antigen receptor T cells (CAR-T cells) have demonstrated remarkable clinical efficacy in patients with hematological malignancies and are currently being investigated for various solid tumors. CAR-T cells are generated by removing T cells from a patient's blood and engineering them to express a synthetic immune receptor that redirects the T-cells to recognize and eliminate target tumor cells. Gene editing of CAR-T cells has the potential to improve safety of current CAR-T cell therapies and further increase the efficacy of CAR-T cells. Here, we describe methods for the activation, expansion, and characterization of human CRISPR-engineered CD19 directed CAR-T cells. This comprises transduction of the CAR lentiviral vector and use of single guide RNA (sgRNA) and Cas9 endonuclease to target genes of interest in T cells. The methods described in this protocol can be universally applied to other CAR constructs and target genes beyond the ones used for this study. Furthermore, this protocol discusses strategies for gRNA design, lead gRNA selection and target gene knockout validation to reproducibly achieve high-efficiency, multiplex CRISPR-Cas9 engineering of clinical grade human T cells.

Here, we present a protocol for gene editing in primary human T cells using CRISPR Cas Technology to modify CAR-T cells.

Adoptive cell therapies using chimeric antigen receptor T cells (CAR-T cells) have demonstrated remarkable clinical efficacy in patients with ...

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

Samenvatting

Meer video's verkennen