Funding support (grant number BT/PR10906/MED/29/860/2014) for this study was provided by the Department of Biotechnology, Government of India.

NOTE: The JFH1 strain (WT) used here was a kind gift from Takaji Wakita, National Institute of Infectious Diseases. The human hepatoma cell line, Huh7.5, was a kind gift from Charles Rice, The Rockefeller University. A schematic of the method is shown in Figure 1.
1. Genome-wide substitution mutagenesis of JFH1 using error-prone PCR
<ol>
	<li>To perform ep-PCR, prepare the master mix for four sets of experiments with primers J-For 5&#39;-GTTTTCCCAGTCAGCACGTTGTAAAACGACGGC-3&#39; and J-Rev 5&#39;-CATGATCTGCAGAGAGACCAGTTACGGCACTCTC -3&#39; (Figure 1A), along with the reaction components described in Table 1 without the pJFH1 template (plasmid isolated from JFH1 strain).</li>
	<li>Aliquot the master mix into four tubes, add 100 ng, 50 ng, 25 ng, and 10 ng of template into the individual tubes, and adjust the total volume of the reaction to 50 &#181;L. Apply the cycling conditions described in Table 2 to amplify a 9736 base pair (bp) fragment comprising the T7 promoter and full-length HCV genome (Figure 2). 
	NOTE: The ep-PCR product must contain the T7 promoter sequence to facilitate in vitro transcription of the viral genome. Therefore, the forward primer must be located upstream of the T7 promoter of the viral cDNA clone, and the reverse primer sequence should end at the 3&#39;-end of the virus genome to facilitate transcription run-off. Optimize each component of the ep-PCR reaction within the range recommended by the manufacturer of Taq DNA polymerase to achieve high-yield amplification. In addition to varied template amounts, unbalanced dNTPs (especially low dATP and/or dGTP concentration) can also be used to increase diversity in the length of viral genomes from 6-8 kb long3.</li>
	<li>Estimate the ep-PCR product amplified by loading equal volumes of the PCR products (5 &#181;L) and comparing to known amounts of 1 kilobase (kb) DNA ladder by running a 0.8% Tris-acetate-EDTA (TAE)-based agarose gel electrophoresis11. Purify the product using a column purification kit as directed by the manufacturer.</li>
	<li>Estimate the concentration of the purified product by measuring the absorbance at 260 nm using a microvolume spectrophotometer12. Vacuum concentrate the ep-PCR product if needed to obtain a product concentration &#8805;100 ng/&#181;L. 
	&#8203;NOTE: More accurate estimation can be made by loading two-fold serial dilutions of ep-PCR product and comparing their intensities to the known amounts of 1 kb DNA ladder.</li>
</ol>
2. Viral RNA synthesis
<ol>
	<li>Set up a 40 &#181;L reaction to digest 5 &#181;g of clonal-pJFH1 with 4 U of XbaI enzyme at 37 &#176;C for 2 h, followed by column purification and measuring the absorbance at 260 nm in a microvolume spectrophotometer12. Set up a 20 &#181;L in vitro transcription reaction of the column-purified ep-PCR product or clonal-pJFH1 (WT) using a commercially available large-scale RNA production system according to the manufacturer&#39;s instructions.</li>
	<li>In a 200 &#181;L microcentrifuge tube, mix approximately 1 &#181;g of the purified ep-PCR product (mutant libraries) or XbaI digested clonal-pJFH1, 10 &#181;L of 2x buffer containing ribonucleotides, and 2 &#181;L of T7 enzyme mix. Mix all the components and briefly spin down the components. Incubate the reaction mixture at 37 &#176;C for 45 min, followed by the addition of 1 U RNase-free DNase enzyme and incubation at 37 &#176;C for 30 min (Figure 1C).</li>
	<li>Purify in vitro synthesized RNA using an RNA cleanup kit as per the manufacturer&#39;s instructions, elute in 40 &#181;L of RNase- and DNase-free water, and estimate the concentration of the purified RNA by measuring the absorbance at 260 nm using a microvolume spectrophotometer12. Make aliquots as needed (5 &#181;g or 2 &#181;g) to avoid freeze-thaw and store them at &#8722;80 &#176;C. Verify the integrity and size of the viral transcripts by using 2 &#181;g of RNA for a MOPS formaldehyde 0.8% agarose gel electrophoresis13 (Figure 3).</li>
</ol>
3. Estimation of the proportion of mutations in ep-PCR products (mutant libraries)
NOTE: In this step, the proportion of nucleotides mutated by subcloning the product obtained in step 2. was estimated to demonstrate the advantage of employing ep-PCR to create genetic heterogeneity using two full genome mutant libraries (ML50 and ML25) and clonal pJFH1-derived viral RNAs. The proportion of mutations was estimated in the HCV NS5A gene, which was also the phenotypic readout gene (drug resistance) in this study.
<ol>
	<li>Set up a 20 &#181;L cDNA synthesis reaction by adding approximately 1 &#181;g of the viral RNA synthesized in step 2., 5 &#181;M reverse primer 5&#39;-GTGTACCTAGTGTGTGCCGCTCTA-3&#39;, and 200 U reverse transcriptase as per the manufacturer&#39;s recommendations.</li>
	<li>Using the cDNA, amplify a 2571 bp fragment that comprises the complete NS5A gene. To do this, prepare a reaction mixture containing 0.5 &#181;M for 5272F and 7848R primers (final concentration; Table 3), 1.5 mM MgCl2,&#160;1x PCR buffer, and 1 U high-fidelity Taq polymerase in a total volume of 50 &#181;L and run an amplification cycle using the conditions described in Table 4.</li>
	<li>Run the product on a 0.8% TAE-based agarose gel to confirm the product size of 2571 bp and then purify the product using a column purification kit as directed by the manufacturer. Elute the column-purified product in 40 &#181;L of sterile water.</li>
	<li>To add a 3&#39; A overhang to the product, add 0.5 &#181;M dATP and 1 U of low-fidelity Taq DNA polymerase and incubate the entire PCR product at 70 &#176;C for 30 min along with 1x PCR buffer and 1.5 mM MgCl2 (final concentration). Purify the mixture using a column purification kit as directed by the manufacturer 
	NOTE: Alternatively, excise the ~9.7 kb long product from the gel from step 1.4. and perform cloning using a commercially available kit for cloning of long-PCR product according to the manufacturer&#39;s instructions or perform NGS of the ep-PCR product using an Illumina platform2.</li>
	<li>Set up a ligation reaction by adding 5 &#181;L of 2x ligation buffer, 50 ng of the T-vector DNA, approximately 3-fold molar excess of the insert DNA synthesized in step 3.4., 3 Weiss units of T4 DNA ligase, and nuclease-free water to a total volume of 10 &#181;L. Incubate this reaction at room temperature for 3 h and then add 100 &#181;L of Escherichia coli DH5&#945; with the ligated DNA; heat shock the cells at 42 &#176;C for 35 s (Figure 1B).</li>
	<li>Add 1 mL of Luria-Bertani (LB) medium (without antibiotic) and incubate with gentle shaking for 1 h at 37 &#176;C for recovery. Centrifuge the cell suspension at 13,800 x g, discard the supernatant, and resuspend in 200 &#181;L of fresh LB medium.</li>
	<li>Plate 100 &#181;L of the transformed E. coli DH5&#945;&#160;cells on an LB plate containing 50 &#181;g/mL ampicillin and incubate at 37 &#176;C for 16 h. Set up minipreps of 25-30 colonies in 5 mL of LB medium + 50 &#181;g/mL ampicillin and grow overnight at 37 &#176;C.</li>
	<li>The next day, extract the plasmids with a plasmid purification kit according to the manufacturer&#39;s instructions and perform restriction enzyme digestion in 10 &#181;L volume with 200 ng of the isolated plasmids, 2 U of EcoR1, and 1x restriction buffer for all the colonies.</li>
	<li>After incubating the digestion mixtures at 37 &#176;C for 3 h, resolve the products on 0.8% TAE-based agarose gel to confirm plasmid DNA insertion.</li>
	<li>Perform Sanger sequencing of the plasmids of 25 positive clones using M13 Forward, M13 reverse, 6208-SPF, and 6748-SPF primers (Table 3) to determine the proportion of mutations (expressed as the proportion of nucleotides mutated) in the viral RNAs derived from the libraries and clonal pJFH1 (Figure 1B and Figure 4).</li>
</ol>
4. Viral RNA transfection of the Huh7.5 cell line
NOTE: Use RNase/DNase-free tissue culture materials and work in a sterile class II biosafety cabinet. Work in the recommended containment facility as per the biosafety guidelines of the organization.
<ol>
	<li>Maintain Huh7.5 cells by incubating in a 5% CO2 incubator at 37 &#176;C in a T75 cm2 tissue culture flask containing 15 mL of complete Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 &#181;g/mL; Figure 1D).</li>
	<li>Split the cells in a 1:3 ratio when confluency reaches 90%. Wash the cells with 1x prewarmed phosphate-buffered saline (PBS; pH 7.4). Add 5 mL of 1x trypsin-EDTA solution to completely cover the cell layer, gently swirl the flask, and then incubate the flask at 37 &#176;C for 5 min. 
	NOTE: Incubation time may vary; incubate the cells until the cell layer is completely detached from the cell culture flask surface.</li>
	<li>Add 10 mL of 1x prewarmed complete DMEM, disperse the cells by repeat pipetting, and collect the cell suspension in a 15 mL or 50 mL sterile centrifuge tube. Centrifuge the cell suspension at 252 x g&#160;for 5 min at room temperature. Discard the supernatant, resuspend the cell pellet in 6 mL of complete DMEM, and incubate the cells at 37 &#176;C in a humidified incubator with 5% CO2.</li>
	<li>For continuous maintenance of na&#239;ve, transfected, or virus-infected Huh7.5 cells, repeat step 4.2. and step 4.3.</li>
	<li>1 day prior to transfection, split the cells as described in steps 4.1.-4.3., count the number of viable cells using a hemocytometer, seed the Huh7.5 cells at a density of 0.6 x 106 in 35 mm dishes in 2 mL of complete DMEM, and incubate the cells at 37 &#176;C in a humidified incubator with 5% CO2.</li>
	<li>On the following day, prepare the transcript-lipid complex. To do this, dilute 10 &#181;L of transfection reagent in 50 &#181;L of minimal essential medium, and separately dilute 5 &#181;g of viral transcripts in 50 &#181;L of minimal essential medium.</li>
	<li>Incubate both mixtures at room temperature for 10 min, and then mix them in a single sterile microcentrifuge tube and further incubate the mixture at room temperature for 30 min to form the transcript-lipid complex.</li>
	<li>After 16 h of cell incubation, remove the culture medium from the culture dish, wash the cells 2x with prewarmed 1x PBS, and add 1.5 mL of minimal essential medium. Slowly add the transcript-lipid complex to the dish and gently swirl with hands to ensure uniform distribution of the complexes.</li>
	<li>Incubate the cells in a 5% CO2 incubator at 37 &#176;C for 10 h. Then, remove the medium, wash the transfected cells 2x with 1 mL of prewarmed 1x PBS, and add 2 mL of complete DMEM.</li>
</ol>
5. Virus production
<ol>
	<li>Split the transfected Huh7.5 cells every 2 days or 3 days when they reach 90% confluency. Collect virus supernatants at every split and store them at &#8722;80 &#176;C for further analysis.</li>
	<li>At every split, monitor the spread of the virus using a focus forming assay (FFA) as described in step 6.2. Harvest the virus until the virus spread reaches &#62;80% of transfected cells (Figure 1D). 
	NOTE: Split the transfected cells at 1:1 ratio for the first few passages to rescue the maximum number of viral variants. Virus spread slows and viability decreases with increasing proportions of mutations in the full-genome MLs2.</li>
</ol>
6. Quantification of virus titers
<ol>
	<li>Quantification of viral RNA
	<ol>
		<li>Isolate viral RNA from 140 &#181;L of culture supernatants using a viral RNA isolation kit according to the manufacturer&#39;s instructions.</li>
		<li>Set up a 10 &#181;L qRT-PCR reaction using a commercial qRT-PCR kit according to the manufacturer&#39;s instructions. Use the forward primer R6-130-S17, reverse primer R6-290-R19 (final concentration 0.2 &#181;M each), and probe R9-148-S21FT (final concentration 0.3 &#181;M) for HCV RNA quantification (Table 3). Set the run conditions as 48 &#176;C for 20 min, 95 &#176;C for 10 min, and then 45 cycles of 95 &#176;C for 15 s and 60 &#176;C for 1 min. 
		NOTE: The probe should contain the fluorescent reporter dye 6-carboxyfluorescein (FAM) and the quencher dye 6-carboxy-tetramethyl-rhodamine (TAMRA) at the 5&#39; and 3&#39; ends, respectively.</li>
		<li>Run reactions in a real-time PCR machine. Setup negative controls, i.e., RNA extracted from the supernatants of mock-infected cells and nuclease-free water simultaneously to ensure the absence of cross-contamination.</li>
		<li>In parallel, generate a standard curve using a 10-fold serially diluted known copy number of HCV transcripts (1 x 108 to 0) for the quantification of viral RNA. Perform the quantification in triplicate (Figure 1D).</li>
	</ol>
	</li>
	<li>Infectious virus titer quantification using 50% tissue culture infectious dose (TCID50)
	<ol>
		<li>Approximately 16 h prior to adding the virus, plate 6.5 x 103 Huh7.5 cells/well in a 96-well plate and incubate the cells at 37 &#176;C in a 5% CO2 incubator.</li>
		<li>In a biosafety class II cabinet, perform 10-fold serial dilutions (1 mL each) covering 1 x 10&#8722;1 to 1 x 10&#8722;6 dilutions (eight dilutions) of the harvested virus (obtained when the virus spread reaches &#62;80% of cells as described in step 5.). Add 100 &#181;L/well (with eight replicates) of the diluted virus to infect the Huh7.5 cells and keep the plate in an incubator at 37 &#176;C with 5% CO2&#160;for 3 days.</li>
		<li>After 3 days, wash the infected cells 3x with 0.1 mL of PBS each time, and fix and permeabilize the cells with 0.1 mL of ice-cold methanol at &#8722;20 &#176;C for 20 min. Wash the wells with 1x PBS 3x and then 1x with PBS-T (1x PBS/0.1% [v/v] Tween-20).</li>
		<li>After removing the PBS-T, block the cells for 30 min at room temperature with 0.1 mL of 1% bovine serum albumin (BSA) containing 0.2% skimmed milk in PBST. Remove the blocking solution and treat the cells for 5 min with 0.1 mL of 3% H2O2 prepared in 1x PBS.</li>
		<li>Again, wash the cells 2x with 1x PBS and 1x with PBS-T, then add 50 &#181;L/well of anti-NS5A 9E10 mAb (1:10000, stock 1 mg/mL; a kind gift from Charles Rice, The Rockefeller University), and incubate at room temperature for 1 h. Wash the wells again 3x with 1x PBS and 1x with PBS-T.</li>
		<li>Add 50 &#181;L/well of HRP-conjugated goat anti-mouse secondary IgG (1:4000), incubate for 30 min at room temperature, and then remove the unbound antibody by washing the wells with 0.1 mL of 1x PBS.</li>
		<li>Add 30 &#181;L of DAB (diaminobenzidine tetrahydrochloride) color substrate and incubate the plate with gentle rocking for 10 min at room temperature. The substrate develops a brown precipitate on the well surface that indicates HCV NS5A antigen.Remove the DAB solution and wash the wells 2x with 1x PBS and 1x with distilled water. Add 100 &#181;L of PBS containing 0.03% sodium azide.</li>
		<li>Examine each well under an inverted light microscope using a 10x objective. Count the number of positive wells. If the well contains one or more NS5A-positive cells, then it is positive; if the well shows an absence of NS5A-positive cells, then it is negative. Use a Reed and Muench calculator to estimate the endpoint dilution that infects 50% of the wells (TCID50)14,15. A reciprocal of the dilution required to yield the TCID50 is the virus infectivity titer (foci forming units) per unit volume. 
		&#8203;NOTE: Virus infectivity titers vary for different mutant libraries.</li>
	</ol>
	</li>
</ol>
7. Drug-resistant viral variant selection
<ol>
	<li>Dissolve pibrentasvir (PIB), an NS5A inhibitor, in 100% DMSO to a concentration of 1 mM and further dilute it in complete DMEM to a concentration of 10 nM.</li>
	<li>To determine the 50% effective concentration of PIB, seed Huh7.5 cells at a density of 0.6 x 106/well in a 6-well plate and incubate the cells at 37 &#176;C in a 5% CO2 incubator. After 16 h of cell incubation, add a virus dose of either ML50 or clonal JFH1 virus to infect 50% of cells, and then, at 12 h post-infection (h p.i.), treat the cells with a two-fold dilution series of PIB ranging from 0.5-100 pM. Measure the FFA and quantify FFU as in step 6.2. after 3 days of incubation.</li>
	<li>Plot the dose-response curves using FFU-reduction assay values in statistical analysis software. From the sigmoidal curve, obtain the 50% effective concentration (EC50; Figure 5). 
	NOTE: The effective concentration range may vary depending on the class, between HCV antivirals of the same class, and depending on the mutant library.</li>
	<li>For the experiment, infect na&#239;ve Huh7.5 cells at 70% confluence with an ML50 virus (variants derived from ML50 RNA) dose to infect 50% of the cells for 12 h, and then transfer the infected cells onto 6-well plates 24 h post-infection.</li>
	<li>Add 1x EC50 PIB (47.3 pM) to the infected cells after 16 h of cell split. Do this after every cell split for six consecutive passages (18 days), followed by three drug-free passage cycles, and monitor virus spread using FFAs as described in step 6.2. Scale-up FFA reagents as per the growth area. Harvest viral supernatants at each passage and store them at &#8722;80 &#176;C until use. 
	NOTE: Viral spread to greater than 50% of cells during treatment follow-up may be defined as a breakthrough, and viral spread during the drug withdrawal period may be defined as viral relapse16.</li>
	<li>Extract viral RNA from the supernatant on day 18, as described in step 6.1.1., and then synthesize cDNA, as shown in step 3.1. Amplify the NS5A gene using 5 &#181;L of 1:5 diluted cDNA and the PCR components described in step 3.2. Then, follow steps 3.3.-3.5. to determine NS5A drug resistance mutations in 6-8 positive bacterial plasmids using the NS5A sequencing primers 6186F, 6862F, and 6460R (Table 3 and Table 4). 
	NOTE: Here in this study, we reported substitutions in NS5A of variants selected during PIB treatment at 1x EC50. This will rule out the contribution of substitutions other than NS5A in reduced susceptibility to PIB.</li>
</ol>

<ol>
	<li>Desselberger, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+genetics+of+rotavirus.">Reverse genetics of rotavirus.</a> Proceedings of the National Academy of Sciences of the United States of America. 114 (9), 2106-2108 (2017).</li><li>Singh, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mutagenesis+of+hepatitis+C+virus+reveals+ability+of+genome+to+overcome+detrimental+mutations.">Genome-wide mutagenesis of hepatitis C virus reveals ability of genome to overcome detrimental mutations.</a> Journal of Virology. 94 (3), 01327 (2020).</li><li>Agarwal, S., Baccam, P., Aggarwal, R., Veerapu, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+synthesis+and+phenotypic+analysis+of+mutant+clouds+for+hepatitis+E+virus+genotype+1.">Novel synthesis and phenotypic analysis of mutant clouds for hepatitis E virus genotype 1.</a> Journal of Virology. 92 (4), 01932 (2018).</li><li>Edmonds, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+bacterium-free+method+for+generation+of+flavivirus+infectious+DNA+by+circular+polymerase+extension+reaction+allows+accurate+recapitulation+of+viral+heterogeneity.">A novel bacterium-free method for generation of flavivirus infectious DNA by circular polymerase extension reaction allows accurate recapitulation of viral heterogeneity.</a> Journal of Virology. 87 (4), 2367-2372 (2013).</li><li>Arumugaswami, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+functional+profiling+of+hepatitis+C+virus+genome.">High-resolution functional profiling of hepatitis C virus genome.</a> PLoS Pathogens. 4 (10), 1000182 (2008).</li><li>Heaton, N. S., Sachs, D., Chen, C. -. J., Hai, R., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mutagenesis+of+influenza+virus+reveals+unique+plasticity+of+the+hemagglutinin+and+NS1+proteins.">Genome-wide mutagenesis of influenza virus reveals unique plasticity of the hemagglutinin and NS1 proteins.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (50), 20248-20253 (2013).</li><li>Eyre, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mutagenesis+of+dengue+virus+reveals+plasticity+of+the+NS1+protein+and+enables+generation+of+infectious+tagged+reporter+viruses.">Genome-wide mutagenesis of dengue virus reveals plasticity of the NS1 protein and enables generation of infectious tagged reporter viruses.</a> Journal of Virology. 91 (23), 01455 (2017).</li><li>Cobb, R. E., Chao, R., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution:+Past,+present,+and+future.">Directed evolution: Past, present, and future.</a> AIChE Journal. American Institute of Chemical Engineers. 59 (5), 1432-1440 (2013).</li><li>Sen, S., Venkata Dasu, V., Mandal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developments+in+directed+evolution+for+improving+enzyme+functions.">Developments in directed evolution for improving enzyme functions.</a> Applied Biochemistry and Biotechnology. 143 (3), 212-223 (2007).</li><li>Yuan, L., Kurek, I., English, J., Keenan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory-directed+protein+evolution.">Laboratory-directed protein evolution.</a> Microbiology and Molecular Biology Reviews. 69 (3), 373-392 (2005).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+DNA+by+agarose+gel+electrophoresis.">Analysis of DNA by agarose gel electrophoresis.</a> Cold Spring Harbor Protocols. 2019 (1), (2019).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. (45), e2565 (2010).</li><li>Rio, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Denaturation+and+electrophoresis+of+RNA+with+formaldehyde.">Denaturation and electrophoresis of RNA with formaldehyde.</a> Cold Spring Harbor Protocols. 2015 (2), 219-222 (2015).</li><li>Lindenbach, B. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+HCV+infectivity+produced+in+cell+culture+and+in+vivo.">Measuring HCV infectivity produced in cell culture and in vivo.</a> Methods in Molecular Biology. 510, 329-336 (2009).</li><li>Lei, C., Yang, J., Hu, J., Sun, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+calculation+of+TCID50+for+quantitation+of+virus+infectivity.">On the calculation of TCID50 for quantitation of virus infectivity.</a> Virologica Sinica. 36 (1), 141-144 (2021).</li><li>Soni, S., Singh, D., Aggarwal, R., Veerapu, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+fitness+of+hepatitis+C+virus+increases+resistance+to+direct-acting+antivirals.">Enhanced fitness of hepatitis C virus increases resistance to direct-acting antivirals.</a> The Journal of General Virology. 103 (2), (2022).</li><li>Khan, S., Soni, S., Veerapu, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HCV+replicon+systems:+Workhorses+of+drug+discovery+and+resistance.">HCV replicon systems: Workhorses of drug discovery and resistance.</a> Frontiers in Cellular Infection Microbiology. 10, 325 (2020).</li><li>Cadwell, R. C., Joyce, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Randomization+of+genes+by+PCR+mutagenesis.">Randomization of genes by PCR mutagenesis.</a> PCR Methods and Applications. 2 (1), 28-33 (1992).</li></ol>

The authors have nothing to disclose.

In this study, we have detailed a simple and rapid FL-MRS procedure that integrates ep-PCR18 and reverse genetics for synthesizing HCV full-genome libraries, which can then be used in a cell culture system to generate replication-competent variants for the screening of drug-resistant phenotypes. The use of low-fidelity Taq DNA polymerase is a prerequisite of ep-PCR that allows the incorporation of substitutions during PCR amplification of a full-length viral genome. We tested several low-fidelity Taq&#160;DNA polymerases and found that Platinum Taq DNA polymerase yielded a ~10 kb sized ep-PCR product with a high yield (data not shown). We recommend using a fixed number of thermal cycles and varying the input template amount to control the proportion of mutations in the full-genome libraries. Since FL-MRS utilizes erroneous full genomes as templates for full-length viral RNAs, a careful design of the primer set is critical to ensure that the RNA synthesis reaction produces virus transcripts of defined length: (i) the forward primer must be located upstream (~50 nucleotides) of the T7 promoter of the cDNA clone to facilitate T7 polymerase binding to the ep-PCR product; and (ii) the reverse primer sequence must end at the 3&#39; end of the virus genome to facilitate transcription runoff during in vitro RNA synthesis.
However, the method is relatively crude, and there is no control over incorporating the required number and type of substitutions at regions of interest in the genome. A major advantage of FL-MRS is that the synthesized full-length transcripts can be directly used to transfect cells, which renders the approach simple and efficient for generating a large pool of viral variants. In contrast, circular polymerase extension and Mu-transposon insertion mutagenesis methods require cloning of the PCR product and screening of transformants prior to selection of the desired phenotype, which severely limits the diversity of the pool of mutants. Although our method greatly increases the chance of yielding several desired phenotypes, the evaluation of individual viral variants is normally required in screening.
Integration of ep-PCR with virus reverse genetics allowed us to quickly generate HCV mutants. This method has the potential to generate hundreds of genetically modified viruses, a feat seemingly not possible with the currently available in vitro mutagenesis techniques. The method detailed here is readily adaptable to cDNA clones carrying any (+)ssRNA viruses containing genomes up to ~10 kb in length.

Forward genetic screening begins with a viral phenotype of interest and then, through sequencing its genome and comparing it to that of the original strain, attempts to identify the mutation(s) causing that phenotype. In contrast, in reverse genetic screens, random mutations are introduced in a target gene, followed by an examination of the resultant phenotype(s)1. For the reverse genetics approach, in vitro mutagenesis is the most widely used technique to create a pool of variants that are subsequently screened for phenotypes of interest. Various genetic tools have been reported for achieving genome-wide random mutagenesis of RNA viruses, including error-prone PCR (ep-PCR)2,3, circular polymerase extension4, and Mu-transposon insertion mutagenesis 5,6,7. The latter two methods yield libraries harboring limited sequence diversity and are prone to the introduction of large insertions and deletions, which are highly lethal for viruses and severely limit the recovery of infectious viral variants.
ep-PCR is a well-known powerful mutagenesis technique widely used in protein engineering to generate mutant enzymes for the selection of phenotypes with desired properties, such as enhanced thermal stability, substrate specificity, and catalytic activity8,9,10. This technique is easy to perform because it requires simple equipment, does not involve tedious manipulations, uses commercially available reagents, and is quick; moreover, it generates high-quality libraries.
Here, we developed a novel method for full-length mutant RNA synthesis (FL-MRS) to generate complete genomes of hepatitis C virus (HCV) by integrating ep-PCR, which induces random genome-wide substitution mutagenesis and reverse genetics. Even a single nucleotide insertion or deletion is highly deleterious for positive-sense RNA viruses ([+]ssRNA); hence, PCR-based substitution mutagenesis is the preferred method for the iterative generation of large, diverse libraries of full (+)ss RNA virus genomes with good viability.
FL-MRS is a straightforward approach that can be applied to any positive-sense RNA virus with a ~10 kb genome length through the meticulous design of a primer set that binds to the viral cDNA clone. pJFH1 is an infectious cDNA clone that encodes the HCV genotype 2a and can recapitulate all steps of the virus life cycle. By using the FL-MRS approach, we demonstrated the synthesis of randomly mutagenized full-genome libraries (mutant libraries [MLs]) to produce replication-competent JFH1 variants for which there was no prior knowledge of the properties associated with mutations. Upon exposure to an antiviral, some of the viral variants quickly overcame the drug pressure with the desired phenotypic change. Using the protocol described here, a plethora of viral variants can be generated, creating opportunities to study the evolution of (+)ssRNA viruses.

<table><tbody><tr><td>1 kb plus DNA ladder&amp;nbsp;</td><td>Thermo Fisher</td><td>10787018</td><td></td></tr><tr><td>1.5 ml centrifuge tube</td><td>Tarsons</td><td>500010</td><td></td></tr><tr><td>15 ml centrifuge tube</td><td>Tarsons</td><td>546021</td><td></td></tr><tr><td>35 mm cell culture dish&amp;nbsp;</td><td>Tarsons</td><td>960010</td><td></td></tr><tr><td>50 ml centrifuge tube</td><td>Tarsons</td><td>546041</td><td></td></tr><tr><td>Acetic acid</td><td>Merck</td><td>A6283</td><td></td></tr><tr><td>Agarose&amp;nbsp;</td><td>HiMedia</td><td>MB080</td><td></td></tr><tr><td>Agrose gel electrophoresis unit</td><td>BioRad</td><td>1704406</td><td></td></tr><tr><td>Biosafety Cabinet, ClassII</td><td>ESCO</td><td>AC2 4S</td><td></td></tr><tr><td>Bovine serum albumin</td><td>HiMedia</td><td>MB083</td><td></td></tr><tr><td>Centrifuge&amp;nbsp;</td><td>Eppendorf</td><td>5424-R</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>BioRad</td><td>1855201</td><td></td></tr><tr><td>Cloning plates 90 mm&amp;nbsp;</td><td>Tarson</td><td>460091</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator&amp;nbsp;</td><td>New Brunswick</td><td>Galaxy 170R</td><td></td></tr><tr><td>Colibri Microvolume Spectrometer</td><td>Titertek-Berthold</td><td>11050140</td><td></td></tr><tr><td>DAB&amp;nbsp;Substrate&amp;nbsp;Kit&amp;nbsp;</td><td>Abcam</td><td>ab94665</td><td></td></tr><tr><td>dATP Solution</td><td>NEB</td><td>N0440S</td><td></td></tr><tr><td>Deoxynucleotide (dNTP) Solution Set</td><td>NEB</td><td>N0446</td><td></td></tr><tr><td>Diethyl Pyrocarbonate (DEPC)&amp;nbsp;</td><td>SRL chemical</td><td>46791</td><td></td></tr><tr><td>Dimethyl sulphoxide (DMSO)</td><td>HiMedia</td><td>MB058</td><td></td></tr><tr><td>DMEM high glucose</td><td>Lonza</td><td>BE12-604F</td><td></td></tr><tr><td>EcoR1-HF</td><td>NEB</td><td>R3101</td><td></td></tr><tr><td>EDTA tetrasodium salt dihydrate</td><td>HiMedia</td><td>GRM4918</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Amresco</td><td>X328</td><td></td></tr><tr><td>Fetal bovine serum&amp;nbsp;</td><td>Gibco</td><td>26140079</td><td></td></tr><tr><td>Formaldehyde&amp;nbsp;</td><td>Fishser Scientific</td><td>12755</td><td></td></tr><tr><td>Gel Documentation System</td><td>ALPHA IMAGER</td><td></td><td></td></tr><tr><td>Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP</td><td>Thermo Fisher</td><td>A16066</td><td></td></tr><tr><td>Hydrogen peroxide 30%</td><td>Merck</td><td>107209</td><td></td></tr><tr><td>Inverted microscope</td><td>Nickon</td><td>&amp;nbsp;ECLIPSE Ts2</td><td></td></tr><tr><td>LB broth&amp;nbsp;</td><td>HiMedia</td><td>M1245</td><td></td></tr><tr><td>Lipofectamine 2000&amp;nbsp;</td><td>Thermo Fisher</td><td>116680270</td><td>transfection reagent</td></tr><tr><td>Mechanical Pipette Set</td><td>Eppendorf&amp;nbsp;&amp;nbsp;</td><td>3120000909</td><td></td></tr><tr><td>Methanol</td><td>Merck</td><td>106009</td><td></td></tr><tr><td>Micro Tips 0.2-10 &amp;micro;l&amp;nbsp;</td><td>Tarsons</td><td>521000</td><td></td></tr><tr><td>Micro Tips 10 - 100 &amp;micro;l&amp;nbsp;</td><td>Tarsons</td><td>521010</td><td></td></tr><tr><td>Micro Tips 200-1000 &amp;micro;l&amp;nbsp;</td><td>Tarsons</td><td>521020</td><td></td></tr><tr><td>MOPS buffer&amp;nbsp;</td><td>GeNei</td><td>3601805001730</td><td></td></tr><tr><td>Nonessential aminoacids (NEAA)</td><td>Gibco</td><td>11140050</td><td></td></tr><tr><td>One Shot TOP10 Chemically Competent&amp;nbsp;E. coli</td><td>Invitrogen</td><td>C404010</td><td>E.coli DH5&amp;alpha;</td></tr><tr><td>Opti-MEM</td><td>Gibco</td><td>1105-021</td><td>minimal essential medium</td></tr><tr><td>PCR tubes 0.2 ml</td><td>Tarsons</td><td>510051</td><td></td></tr><tr><td>Pencillin/streptomycin&amp;nbsp;</td><td>Gibco</td><td>15070063</td><td></td></tr><tr><td>pGEM-T Easy Vector System</td><td>Promega</td><td>A1360</td><td>T-vector DNA</td></tr><tr><td>Phosphate buffer saline (PBS)</td><td>HiMedia</td><td>TI1099</td><td></td></tr><tr><td>Phusion&amp;nbsp;High-Fidelity DNA Polymerase</td><td>NEB</td><td>M0530S</td><td></td></tr><tr><td>Pibrentasvir</td><td>Cayman Chemical</td><td>27546</td><td></td></tr><tr><td>Pipette controller&amp;nbsp;</td><td>Gilson&amp;nbsp;</td><td>F110120</td><td></td></tr><tr><td>Platinum Taq DNA Polymerase&amp;nbsp;</td><td>Thermo</td><td>10966034</td><td></td></tr><tr><td>Prism</td><td>GraphPad</td><td></td><td>statistical analysis software</td></tr><tr><td>QIAamp Viral RNA Mini kit&amp;nbsp;</td><td>Qiagen</td><td>52904</td><td>viral isolation kit</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27106</td><td></td></tr><tr><td>QIAquick PCR Purification Kit</td><td>QIAGEN</td><td>28104</td><td>cokum purification kit</td></tr><tr><td>RNeasy Mini Kit&amp;nbsp;</td><td>QIAGEN</td><td>74104</td><td>RNA cleanup kit</td></tr><tr><td>Serological Pipettes 25 ml</td><td>Thermo Fisher</td><td>170357N</td><td></td></tr><tr><td>Serological Pipettes 5 ml</td><td>Thermo Fisher</td><td>170355N</td><td></td></tr><tr><td>Serological Pipettes10 ml</td><td>Thermo Fisher</td><td>170356N</td><td></td></tr><tr><td>Single strand RNA Marker 0.2-10 kb</td><td>Merck</td><td>R7020</td><td></td></tr><tr><td>Skim milk&amp;nbsp;</td><td>HiMedia</td><td>M530</td><td></td></tr><tr><td>Sodium azide 0.1 M solution</td><td>Merck</td><td>8591</td><td></td></tr><tr><td>SuperScript III Reverse Transcriptase&amp;nbsp;</td><td>Invitrogen</td><td>18080044</td><td>reverse transcriptase</td></tr><tr><td>T100 Thermal Cycler</td><td>BioRad</td><td>1861096</td><td></td></tr><tr><td>T175 cell culture flask&amp;nbsp;</td><td>Tarsons</td><td>159910</td><td></td></tr><tr><td>T25 cell culture flask&amp;nbsp;</td><td>Tarsons</td><td>950040</td><td></td></tr><tr><td>T7 RiboMax Express Large Scale RNA Production System&amp;nbsp;</td><td>Promega</td><td>P1320</td><td>&amp;nbsp;Large Scale RNA Production System&amp;nbsp;</td></tr><tr><td>T75 cell culture flask&amp;nbsp;</td><td>Tarsons</td><td>950050</td><td></td></tr><tr><td>Taq DNA Polymerase</td><td>Genetix Biotech (Puregene)</td><td>PGM040</td><td></td></tr><tr><td>TaqMan RNA-to-CT 1-Step Kit</td><td>Applied Biosystems</td><td>4392653</td><td></td></tr><tr><td>TaqMan RNA-to-CT&amp;nbsp;1-Step&amp;nbsp;Kit</td><td>Thermo Fisher</td><td>4392653</td><td>commercial qRT-PCR kit&amp;nbsp;</td></tr><tr><td>TOPO-XL--2 Complete PCR Cloning Kit</td><td>Thermo Fisher</td><td>K8050-10</td><td>kit for cloning of long-PCR product&amp;nbsp;</td></tr><tr><td>Tris base</td><td>HiMedia</td><td>TC072</td><td></td></tr><tr><td>Trypsin-EDTA solution</td><td>HiMedia</td><td>TCL007</td><td></td></tr><tr><td>Tween 20</td><td>HiMedia</td><td>MB067</td><td></td></tr><tr><td>Vacuum Concentrator&amp;nbsp;</td><td>Eppendorf, Concentrator Plus</td><td>100248</td><td></td></tr><tr><td>Water bath&amp;nbsp;</td><td>GRANT</td><td>JBN-18</td><td></td></tr><tr><td>Xba1</td><td>NEB</td><td>R0145S</td><td></td></tr></tbody></table>

reverse genetics to engineer positive-sense rna virus variants

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

A plethora of full-length HCV variants can be generated and screened for drug-resistant phenotypes of interest following the procedures described in Figure 1. Full genome mutant libraries were synthesized using clonal-pJFH1 in decreasing amounts (100-10 ng), as shown in Figure 2. Average yields of ep-PCR products (mutant libraries) ranged from 3.8-12.5 ng/&#181;L. Figure 3 shows the viral transcripts synthesized from the clonal-pJFH1 and the representative mutant library (ML50 synthesized using 50 ng of clonal-pJFH1). The clonal-pJFH1 was linearized via XbaI digestion, while ML50 was used directly in the in vitro transcription reaction. The proportion of mutations in mutant libraries (mutant viral RNAs) increased with decreasing input pJFH1 in the ep-PCR reaction, as shown in Figure 4. ML50 synthesized using 50 ng of the template (clonal-pJFH1) had 4 substitutions per 10,000 bp copied, whereas ML25 synthesized using 25 ng of template harbored 9 substitutions.No substitutions within the number of nucleotides sequenced were found in clonal-pJFH1. ML50 viral variants were less susceptible (12.7-fold) to pibrentasvir, an NS5A inhibitor, compared to clonal-JFH1 virus, as shown in Figure 5. Table 5 has NS5A substitutions identified in ML50 viral variants selected against 1x EC50 of pibrentasvir treatment. Of the eight NS5A clones, four had a combination of D7V+F28C, whereas V8A+F28C and F36L occurred in one clone each. These mutations were at the N-terminus region of NS5A, which is known to harbor clinically relevant NS5A-resistance mutations17.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63685/63685fig01.jpg" /> 
Figure 1: Schematic of the FL-MRS strategy and drug-resistant phenotype selection. (A)&#160;The pJFH1 cDNA (wild-type) clone carries a full-length genotype 2a virus genome and T7 promoter. The primer J-For is upstream of the T7 promoter, and the primer J-Rev is located at the 3&#39; end of the HCV genome. (B) Clonal-pJFH1 is randomly mutagenized using error-prone PCR to engineer genetic variations and to create full genome mutant libraries. Clonal-pJFH1 is linearized by XbaI digestion. (C)&#160;Full-genome ep-PCR products and linearized clonal-pJFH1 are the templates for in vitro transcription.&#160;The proportion of mutations in the viral RNAs of MLs and clonal-JFH1 was determined by TA subcloning of NS5A and Sanger sequencing of positive TA clones. (D) Replication-competent variants generated after mutant viral RNA transfection of Huh7.5 cells were treated with pibrentasvir (an NS5A inhibitor) for the selection of NS5A-resistant phenotypes. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63685/63685fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63685/63685fig02.jpg" /> 
Figure 2: Agarose gel electrophoresis of ep-PCR products. HCV full-genome ep-PCR products synthesized using varying template amounts (100 ng, 50 ng, 25 ng, and 10 ng of pJFH1) were separated using 0.8% TAE agarose gel electrophoresis. The expected size of the ep-PCR product is 9.7 kb. The separated products were visualized by ethidium bromide staining. Lane 1 is a 1 kb DNA ladder; Lane 6 is no-template control (labeled as H2O). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63685/63685fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63685/63685fig03.jpg" /> 
Figure 3: MOPS formaldehyde agarose gel electrophoresis of viral transcripts. Linearized pJFH1 (Lane 2) and the mutant library obtained with 50 ng (ML50) of pJFH1 containing ep-PCR (Lane 3) were used as templates for the in vitro transcription reaction. The integrity of the transcripts was analyzed using a MOPS formaldehyde 0.8% agarose gel stained with ethidium bromide. Lane 1 is a 1 kb RNA ladder. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63685/63685fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63685/63685fig04.jpg" /> 
Figure 4: Proportion of substitutions in mutant libraries. NS5A genes from RNAs of clonal-pJFH1, ML50, and ML25 were amplified in high-fidelity PCRs, followed by the addition of 3&#39; A overhang, ligation of the product with T-vector, and transformation of E. coli DH5&#945; with the ligated product. Around 40,000 nucleotides/library or clonal-pJFH1 were Sanger sequenced. An average proportion of mutations per 10,000 bp copied is shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63685/63685fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63685/63685fig05.jpg" /> 
Figure 5: Estimation of EC50 of pibrentasvir against ML50 variants. Huh7.5 cells were infected with clonal-JFH1 virus or ML50 variants and treated with serial two-fold dilutions starting at 100 pM of pibrentasvir, followed by FFA after 3 days. Sigmoidal dose-response curves using FFU-reduction assay values were plotted in statistical analysis software to estimate the 50% effective concentration. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63685/63685fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components for 50 &#181;L</td>
			<td>Required stock value</td>
			<td>Final concentration/reaction</td>
		</tr>
		<tr>
			<td>10x PCR buffer&#160;</td>
			<td>5.0 &#181;L</td>
			<td>1x</td>
		</tr>
		<tr>
			<td>MgCl2 (50 mM)</td>
			<td>1.5 &#181;L</td>
			<td>1.5 mM</td>
		</tr>
		<tr>
			<td>KB Extender&#160;</td>
			<td>2.0 &#181;L</td>
			<td>-</td>
		</tr>
		<tr>
			<td>dNTPs (10 mM)&#160;</td>
			<td>1.0 &#181;L</td>
			<td>0.2 mM</td>
		</tr>
		<tr>
			<td>Forward primer (10 &#181;M)</td>
			<td>1.0 &#181;L</td>
			<td>0.2 &#181;M</td>
		</tr>
		<tr>
			<td>Reverse primer (10 &#181;M)</td>
			<td>1.0 &#181;L</td>
			<td>0.2 &#181;M</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase (10 U/&#181;L)</td>
			<td>0.5 &#181;L (1:4 diluted)</td>
			<td>1 U</td>
		</tr>
		<tr>
			<td>Template (pJFH1, 20 ng/&#181;L)</td>
			<td>0.5 to 5.0 &#181;L</td>
			<td>10 to 100 ng</td>
		</tr>
		<tr>
			<td>Water&#160;</td>
			<td>32.5 to 37.5 &#181;L</td>
			<td>Adjust for final volume of 50 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 1. Ep-PCR components for the amplification of HCV full genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>3 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">30</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>25 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>8 min</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2. Cycling conditions for the ep-PCR of HCV full genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Assay</td>
			<td>Primer</td>
			<td>Sequence (5&#8217;-3&#8217;)</td>
		</tr>
		<tr>
			<td rowspan="2">Amplification of partial NS4B-NS5A-partial NS5B</td>
			<td>5272F</td>
			<td>TGGCCCAAAGTGGAACAATTTTGG</td>
		</tr>
		<tr>
			<td>7848R</td>
			<td>GGCCATTTTCTCGCAGACCCGGAC</td>
		</tr>
		<tr>
			<td>cDNA synthesis</td>
			<td>9464R</td>
			<td>GTGTACCTAGTGTGTGCCGCTCTA</td>
		</tr>
		<tr>
			<td rowspan="3">qRT-PCR</td>
			<td>R9-148-S21FT (TaqMan probe)</td>
			<td>CTGCGGAACCGGTGAGTACAC</td>
		</tr>
		<tr>
			<td>R6-130-S17&#160;</td>
			<td>CGGGAGAGCCATAGTGG</td>
		</tr>
		<tr>
			<td>R6-290-R19&#160;</td>
			<td>AGTACCACAAGGCCTTTCG</td>
		</tr>
		<tr>
			<td rowspan="2">Sequencing primers to determine proportions of mutations in ep-PCR products</td>
			<td>6208-SPF</td>
			<td>CCCAACTACTTGGCTCTCTTAC</td>
		</tr>
		<tr>
			<td>6748-SPF</td>
			<td>GACGGTGTGCAGATCCATAG</td>
		</tr>
		<tr>
			<td rowspan="3">NS5A gene sequencing (and to determine proportions of mutations in ep-PCR products)</td>
			<td>6186F</td>
			<td>CAACGCAGAACGAGACCTCATCCC</td>
		</tr>
		<tr>
			<td>6862F</td>
			<td>GACCTTTCCTATCAATTGCTACAC</td>
		</tr>
		<tr>
			<td>6460R</td>
			<td>TGGGCACGGCCTGACTACAA</td>
		</tr>
	</tbody>
</table>
Table 3. Primers and sequences used in assays.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>4 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">5</td>
		</tr>
		<tr>
			<td>68 &#176;C</td>
			<td>30 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">5</td>
		</tr>
		<tr>
			<td>66 &#176;C</td>
			<td>30 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">5</td>
		</tr>
		<tr>
			<td>64 &#176;C</td>
			<td>30 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">5</td>
		</tr>
		<tr>
			<td>62 &#176;C</td>
			<td>30 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>30 Sec</td>
			<td rowspan="3">10</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>30 Sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4. Cycling conditions for NS5A amplification.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Substitution(s)</td>
			<td>No. of clones (n=6)</td>
		</tr>
		<tr>
			<td>D7V+F28C</td>
			<td>4</td>
		</tr>
		<tr>
			<td>V8A+F28C</td>
			<td>1</td>
		</tr>
		<tr>
			<td>F36L</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 5. Pibrentasvir-resistance substitutions of NS5A.

Watch this Scientific Journal Video about Reverse Genetics to Engineer Positive-Sense RNA Virus Variants at JoVE.com

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA ...

reverse-genetics-to-engineer-positive-sense-rna-virus-variants

Nanyang Technological University

Research

JoVE Journal

Genetics

1.2K Views.  Shiv Nadar University. Het hier beschreven protocol maakt het mogelijk om willekeurig gemutageniseerde RNA-bibliotheken van volledige lengte van enkelstrengs positieve RNA-virale genomen tot 10 kilobytes lang te genereren, en om fenotypes van belang te selecteren onder de gewenste experimentele omstandigheden. Deze techniek kan in korte tijd virale RNA-bibliotheken van volledige lengte creëren met verschillende niveaus van genetische diversiteit met behulp van een kloonvrije benadering. De techniek maakt gebruik v...

Video: Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Immunology and Infection

Using Reverse Genetics to Manipulate the NSs Gene of the Rift Valley Fever Virus MP-12 Strain to Improve Vaccine Safety and Efficacy

Rift Valley fever virus (RVFV), which causes hemorrhagic fever, neurological disorders or blindness in humans, and a high rate abortion and fetal malformation in ruminants1, has been classified as a HHS/USDA overlap select agent and a risk group 3 pathogen. It belongs to the genus Phlebovirus in the family Bunyaviridae and is one of the most virulent members of this family. Several reverse genetics systems for the RVFV MP-12 vaccine strain2,3 as well as wild-type RVFV strains 4-6, including ZH548 and ZH501, have been developed since 2006. The MP-12 strain (which is a risk group 2 pathogen and a non-select agent) is highly attenuated by several mutations in its M- and L-segments, but still carries virulent S-segment RNA3, which encodes a functional virulence factor, NSs. The rMP12-C13type (C13type) carrying 69% in-frame deletion of NSs ORF lacks all the known NSs functions, while it replicates as efficient as does MP-12 in VeroE6 cells lacking type-I IFN. NSs induces a shut-off of host transcription including interferon (IFN)-beta mRNA7,8 and promotes degradation of double-stranded RNA-dependent protein kinase (PKR) at the post-translational level.9,10 IFN-beta is transcriptionally upregulated by interferon regulatory factor 3 (IRF-3), NF-kB and activator protein-1 (AP-1), and the binding of IFN-beta to IFN-alpha/beta receptor (IFNAR) stimulates the transcription of IFN-alpha genes or other interferon stimulated genes (ISGs)11, which induces host antiviral activities, whereas host transcription suppression including IFN-beta gene by NSs prevents the gene upregulations of those ISGs in response to viral replication although IRF-3, NF-kB and activator protein-1 (AP-1) can be activated by RVFV7. . Thus, NSs is an excellent target to further attenuate MP-12, and to enhance host innate immune responses by abolishing the IFN-beta suppression function. Here, we describe a protocol for generating a recombinant MP-12 encoding mutated NSs, and provide an example of a screening method to identify NSs mutants lacking the function to suppress IFN-beta mRNA synthesis. In addition to its essential role in innate immunity, type-I IFN is important for the maturation of dendritic cells and the induction of an adaptive immune response12-14. Thus, NSs mutants inducing type-I IFN are further attenuated, but at the same time are more efficient at stimulating host immune responses than wild-type MP-12, which makes them ideal candidates for vaccination approaches.

The reverse genetics system for the Rift Valley fever virus MP-12 vaccine strain is a useful tool for creating additional MP-12 mutants with increased attenuation and immunogenicity. We describe the protocol to generate and characterize NSs mutant strains.

Rift Valley fever virus (RVFV), which causes hemorrhagic fever, neurological disorders or blindness in humans, and a high rate abortion and fetal ...

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been successfully employed for editing genomes of various organisms. Here we describe a protocol for editing the vaccinia virus (VV) genome in the cytoplasm of VV-infected CV-1 cells using the RNA-guided Cas9. RNA-guided Cas9 induces double-stranded DNA breaks facilitating homologous recombination efficiently and specifically in the targeted site of VV and a transgene can be incorporated into these sites by homologous recombination. By using a site-specific homologous vector with transgene(s), a N1L gene-deleted VV with the red fluorescence protein (RFP) gene incorporated in this region was generated with a successful recombination efficiency 10 times greater than that obtained from the conventional homologous recombination method. This protocol demonstrates successful use of RNA-guided Cas9 system to generate mutant VVs with enhanced efficiency.

Vaccinia virus (VV) has been widely used in biomedical research and the improvement of human health. This article describes a simple, highly efficient method to edit the VV genome using a CRISPR-Cas9 system.

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

Neuroscience

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Simplified Reverse Genetics Method to Recover Recombinant Rotaviruses Expressing Reporter Proteins

Rotaviruses are a large and evolving population of segmented double-stranded RNA viruses that cause severe gastroenteritis in the young of many mammalian and avian host species, including humans. With the recent advent of rotavirus reverse genetics systems, it has become possible to use directed mutagenesis to explore rotavirus biology, modify and optimize existing rotavirus vaccines, and develop rotavirus multitarget vaccine vectors. In this report, we describe a simplified reverse genetics system that allows the efficient and reliable recovery of recombinant rotaviruses. The system is based on co-transfection of T7 transcription vectors expressing full-length rotavirus (+)RNAs and a CMV vector encoding an RNA capping enzyme into BHK cells constitutively producing T7 RNA polymerase (BHK-T7). Recombinant rotaviruses are amplified by overseeding the transfected BHK-T7 cells with MA104 cells, a monkey kidney cell line that is highly permissive for virus growth. In this report, we also describe an approach for generating recombinant rotaviruses that express a separate fluorescent reporter protein through the introduction of a 2A translational stop-restart element into genome segment 7 (NSP3). This approach avoids deleting or modifying any of the viral open reading frames, thus allowing the production of recombinant rotaviruses that retain fully functional viral proteins while expressing a fluorescent protein.

Generation of recombinant rotaviruses from plasmid DNA provides an essential tool for the study of rotavirus replication and pathogenesis, and the development of rotavirus expression vectors and vaccines. Herein, we describe a simplified reverse genetics approach for generating recombinant rotaviruses, including strains expressing fluorescent reporter proteins.

Rotaviruses are a large and evolving population of segmented double-stranded RNA viruses that cause severe gastroenteritis in the young of many mammalian ...

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

Samenvatting

Meer video's verkennen