This work was supported by the Science and Technology Commission of Shanghai Municipality, China (No. 19ZR1477500 and No.18441900400). We gratefully acknowledge financial support from the University of Shanghai for Science and Technology (No.2017KJFZ049).

NOTE: See the Table of Materials for details related to all materials, reagents, and equipment used in this protocol.
1. Fabrication of CF-PCR microfluidic chip
<ol>
	<li>Heat the silicon wafer at 200 &#176;C for 25 min to remove the moisture.</li>
	<li>Dispense 1 mL of SU-8-2075 photoresist per inch of the wafer. Spin it on the silicon wafer using a spin coater at 500 rpm for 5-10 s with an acceleration of 100 rpm/s, and then at 2,000 rpm for 30 s with an acceleration of 500 rpm/s.</li>
	<li>Soft bake the silicon wafer at 65 &#176;C for 3 min, then at 95 &#176;C for 15 min.</li>
	<li>Set 150 - 215 mJ/cm&#178; as the exposure energy for the photolithography machine, and engrave the designed pattern onto the photoresist with a photolithography mask. Place the silicon wafer and the mask ready for exposure.</li>
	<li>Post exposure, bake the silicon wafer at 65 &#176;C for 2 min, and then at 95 &#176;C for 7 min.</li>
	<li>Immerse the silicon wafer in developer solution to remove excess photoresist and take it out when the microchannels can be seen (Figure 1). Use isopropanol to rinse off the residual developer solution.</li>
	<li>Mix the polydimethylsiloxane (PDMS) prepolymer and curing agent at a ratio of 10:1. Pour the mixed PDMS solution into the replica mold and solidify it at 80 &#176;C for 60 min.</li>
	<li>Bond the PDMS microfluidic chip on a slide after activation using a plasma cleaner, and solidify them at 80 &#176;C for 30 min as soon as possible (Figure 2). 
	NOTE: The outer dimensions of the chip are 80.0 mm &#215; 30.0 mm &#215; 0.4 mm. There are 40 serpentine channels (100 &#181;m &#215; 1.46 mm &#215; 100 &#181;m, width &#215; length &#215; depth) in the microfluidic chip.</li>
</ol>
2. Preparation of the PCR solution
<ol>
	<li>Thaw the reagents completely before configuration. Use a vortex mixer and centrifuge to ensure the reagents are well mixed.</li>
	<li>Prepare a centrifuge tube, adding the following components in this order: 33.75 &#181;L of water, 1.0 &#181;L of DNA template, 0.5 &#181;L of primer, 5.0 &#181;L of buffer, 4.0 &#181;L of dNTP mixture, 1.5 &#181;L of Tween 20, 3.5 &#181;L of PVP, and finally 0.25 &#181;L of DNA polymerase. 
	NOTE: Here, the DNA template used is E. coli. The primers for E. coli and the components of the PCR solution are listed in Table 1 and Table 2, respectively.</li>
	<li>Mix the solution by vortexing.</li>
</ol>
3. Construction of the CF-PCR system
<ol>
	<li>Prepare two positive temperature coefficient (PTC) ceramic heaters, two solid-state relays, two PID temperature controllers, two temperature sensors, and a power cord. 
	NOTE: The size of the PTC ceramic heaters depends on the size of the microfluidic chip; the length should be greater than the length of the chip-the length-width-height of the PTC ceramic heaters used here is 10 cm x 2 cm x 0.4 cm.</li>
	<li>Connect the heater to the solid-state relay.</li>
	<li>Connect the solid-state relay to the PID temperature controller.</li>
	<li>Attach the temperature sensor probe to the bottom of the two heaters and connect the terminal to the PID temperature controller.</li>
	<li>Connect two solid-state relays in series and connect the power cord.</li>
	<li>3D print a slot for the two heaters and keep the heaters on the same plane (see Supplemental File 1 for STL files required for 3D printing). 
	NOTE: Leave a 12 mm air gap between the two heaters.</li>
	<li>Place the microfluidic chip on the two heaters.</li>
	<li>Prepare a syringe pump and a syringe, fix the syringe on the syringe pump, connect a silicone tubing (0.8 mm inner diameter [ID]) with a syringe, and connect a steel needle (0.7 mm ID) to the top of the silicone tubing (Figure 3).</li>
	<li>Insert the steel needle into the inlet of the microfluidic chip.</li>
	<li>Place a pipette tip at the outlet of the chip to collect the PCR products.</li>
</ol>
4. Construction of the CE system
<ol>
	<li>Use a high-voltage power supply to generate a pulsed-field electric field; note the positive and negative electrodes.</li>
	<li>Use a mercury lamp as the light source and filter the excitation wavelength from the mercury lamp through a filter.</li>
	<li>Place the capillary on the microscope stage.</li>
	<li>Collect the fluorescence emission with the objective, and then detect it using an R928 photomultiplier tube (PMT). Observe the microscope and the capillary. Turn on the light under dark room conditions; excitation light is collected by the objective.</li>
	<li>Use the self-developed LABVIEW software to control the power supply and complete the data acquisition (described in steps 6.3-6.6). See&#160;https://github.com/starliyan/labview/blob/main/CZE20170723.vi. 
	&#8203;NOTE: All experiments were performed in a dark room, and the schematic of the CE system is shown in Figure 4.</li>
</ol>
5. Run the PCR solution
<ol>
	<li>Preset the temperature of the heaters of the CF-PCR system at 65 &#176;C and 95 &#176;C.</li>
	<li>Place the microfluidic chip on the two heating blocks.</li>
	<li>Insert the tip of the silicone tube into a centrifuge tube containing 50 &#181;L of the PCR solution (from step 2.3). Pull the syringe plunger to slowly withdraw the solution. Fix the syringe on a syringe pump. Insert the steel needle into the inlet of the microfluidic chip.</li>
	<li>Set the flow rate of the pump to 10 &#181;L/min and press the start button to push the solution in the microchannel at the inlet of the microchip.</li>
	<li>Collect the PCR products at the outlet of the microfluidic chip. 
	&#8203;NOTE: Rinse the channel with ultrapure water before and after the PCR to remove impurities.</li>
</ol>
6. Detection of the PCR products by this CE system built in-house
<ol>
	<li>Prepare a capillary with an 8 cm total length and a 6 cm effective length.</li>
	<li>Prepare the separation buffer by mixing 100 &#181;L of 1% hydroxyethylcellulose (HEC, w/v), 2 &#181;L of 100x SYBR Green I, and 98 &#181;L of ultrapure water to obtain 0.5% HEC (w/v) containing 1x SYBR Green I.</li>
	<li>Fill the capillary with the prepared separation buffer using a vacuum pump.</li>
	<li>Input the injection voltage (800 V) and the injection time (2.0 s) on the software interface, click the start button, and wait for the PCR products to be electrodynamically introduced into the capillary at 100 V/cm (2.0 s). 
	NOTE: In this step, the PCR products are placed on the negative electrode and the buffer is placed on the positive electrode.</li>
	<li>Input the DC voltage (800 V) on the software interface, click the start button, and run the electrophoresis at 100 V/cm of electric field strength. 
	NOTE: In this step, both the positive and negative electrodes are placed with buffer.</li>
	<li>Click the stop button after all DNA fragments are separated in the capillary.</li>
	<li>Flush the capillary with sterilized water for 1 min after each run.</li>
</ol>

<ol>
	<li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-in-one+microfluidic+device+for+on-site+diagnosis+of+pathogens+based+on+an+integrated+continuous+flow+PCR+and+electrophoresis+biochip.">All-in-one microfluidic device for on-site diagnosis of pathogens based on an integrated continuous flow PCR and electrophoresis biochip.</a> Lab on a Chip. 19 (16), 2663-2668 (2019).</li><li>Crews, N., Wittwer, C., Gale, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous-flow+thermal+gradient+PCR.">Continuous-flow thermal gradient PCR.</a> Biomedical Microdevices. 10 (2), 187-195 (2008).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+fabrication+of+portable+continuous+flow+PCR+microfluidic+chip+for+DNA+replication.">Design and fabrication of portable continuous flow PCR microfluidic chip for DNA replication.</a> Biomedical Microdevices. 22 (1), 5 (2019).</li><li>Kim, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+and+characterization+of+a+PDMS-glass+hybrid+continuous-flow+PCR+chip.">Fabrication and characterization of a PDMS-glass hybrid continuous-flow PCR chip.</a> Biochemical Engineering Journal. 29 (1-2), 91-97 (2006).</li><li>Shen, K., Chen, X., Guo, M., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microchip-based+PCR+device+using+flexible+printed+circuit+technology.">A microchip-based PCR device using flexible printed circuit technology.</a> Sensors and Actuators B: Chemical. 105 (2), 251-258 (2005).</li><li>Harstad, R. K., Johnson, A. C., Weisenberger, M. M., Bowser, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capillary+Electrophoresis.">Capillary Electrophoresis.</a> Analytical Chemistry. 88 (1), 299-319 (2016).</li><li>Redman, E. A., Mellors, J. S., Starkey, J. A., Ramsey, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+intact+antibody+drug+conjugate+variants+using+microfluidic+capillary+electrophoresis-mass+spectrometry.">Characterization of intact antibody drug conjugate variants using microfluidic capillary electrophoresis-mass spectrometry.</a> Analytical Chemistry. 88 (4), 2220-2226 (2016).</li><li>Britz-Mckibbin, P., Kranack, A. R., Paprica, A., Chen, D. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+assay+for+epinephrine+in+dental+anesthetic+solutions+by+capillary+electrophoresis.">Quantitative assay for epinephrine in dental anesthetic solutions by capillary electrophoresis.</a> Analyst. 123 (7), 1461-1463 (1998).</li><li>Maeda, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+using+TaqMan+and+SYBR+Green+for+Actinobacillus+actinomycetemcomitans,+Porphyromonas+gingivalis,+Prevotella+intermedia,+tetQgene+and+total+bacteria.">Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQgene and total bacteria.</a> FEMS Immunology and Medical Microbiology. 39 (1), 81-86 (2003).</li><li>Hajba, L., Guttman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+column+coatings+for+capillary+electrophoresis+of+proteins.">Recent advances in column coatings for capillary electrophoresis of proteins.</a> TrAC Trends in Analytical Chemistry. 90, 38-44 (2017).</li><li>Kleparnik, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+combination+of+capillary+electrophoresis+with+mass+spectrometry:+methodology+and+theory.">Recent advances in combination of capillary electrophoresis with mass spectrometry: methodology and theory.</a> Electrophoresis. 36 (1), 159-178 (2015).</li></ol>

The authors have no conflicts of interest to declare.

Both PCR and CE are two popular biotechnologies in the analysis of nucleic acids. This paper describes the amplification of E. coli and the detection of the PCR products using the CF-PCR and CE systems, both built in-house. The target gene of E. coli was successfully amplified within 10 min because of the high heat transfer rates. The DNA fragments smaller than 1,500 bp were separated within 8 min (Figure 5). The great advantage of these two techniques is that it can greatly save time compared to the traditional PCR and slab gel electrophoresis methods. Researchers should bear in mind that the CF-PCR microfluidic chip needs to be cleaned after use, and the CE system should be built in a clean and black house to avoid the contamination of samples. The CF-PCR system based on the microfluidic chip and the CE system introduced in this work are easy to fabricate and may offer a simple method for the analysis of nucleic acids in the lab. However, a limitation of CF-PCR is that it can only amplify and detect only one sample at a time, which may limit its wide application; to counter this, users can develop the integrated CF-PCR and CE array microfluidic chip to solve this problem. The platform reported in this work has great potential application in the field of clinical diagnosis of infectious diseases and nucleic acid research.

Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments, thereby amplifying trace amounts of DNA hundreds of millions of times. It has been widely used in clinical diagnosis, medical research, food safety, forensic identification, and other fields. The PCR process mainly consists of three steps: denaturation at 90-95 &#176;C, annealing at 50-60 &#176;C, and extension at 72-77 &#176;C. Thermal cycling is an important part of the PCR process; however, the traditional PCR thermal cycler is not only bulky but also inefficient, requiring approximately 40 min to complete 25 cycles. To overcome these limitations, a continuous-flow PCR (CF-PCR) system was built in-house, based on a microfluidic chip. CF-PCR can greatly save time by driving the PCR solution into microchannels placed on heaters at different temperatures1,2,3,4,5.
As capillary electrophoresis (CE) has many advantages, such as high resolution, high speed, and excellent reproducibility6,7,8,9,10,11, it has become a popular tool in the lab for the analysis of nucleic acids and proteins. However, most labs, especially labs in the developing world, cannot afford this technology because of the high price of the CE instrument. Herein, we have outlined protocols for how to fabricate the CF-PCR microfluidic chip and how to build a versatile CE system in the lab. We also demonstrate the process of amplification of E. coli by this CF-PCR system and the detection of the PCR products by the CE system. By following the procedures described in this protocol, users should be able to fabricate microfluidic chips, prepare PCR solutions, build a CF-PCR system for nucleic acid amplification, and set up a simple CE system, even with limited resources, to separate DNA fragments.

<table><tbody><tr><td>100 bp DNA ladder</td><td>Takara Bio Inc.</td><td>3422A</td><td></td></tr><tr><td>10x Fast Buffer I</td><td>Takara Bio Inc.</td><td>RR070A</td><td></td></tr><tr><td>10x TBE</td><td>Beijing Solarbio Science &amp;amp; Technology Co., Ltd.</td><td>T1051</td><td></td></tr><tr><td>developer solution</td><td>Alfa Aesar, USA</td><td>L15459</td><td></td></tr><tr><td>dNTP mixture (2.5 &amp;mu;M)</td><td>Takara Bio Inc.</td><td>RR070A</td><td></td></tr><tr><td>EC-F</td><td>Sangon Biotech, Shanghai, China</td><td></td><td></td></tr><tr><td>EC-R</td><td>Sangon Biotech, Shanghai, China</td><td></td><td></td></tr><tr><td>HEC,1300K</td><td>Sigma-Aldrich, USA</td><td>9004-62-0</td><td></td></tr><tr><td>isopropanol</td><td>Aladdin, Shanghai, China</td><td>67-63-0</td><td></td></tr><tr><td>microscope</td><td>Olympus, Japan</td><td>BX51</td><td></td></tr><tr><td>photolithography&amp;nbsp;</td><td>SUSS MicroTec, Germany</td><td>MJB4</td><td></td></tr><tr><td>photomultiplier tube&amp;nbsp;</td><td>Hamamatsu Photonics, Japan</td><td>R928</td><td></td></tr><tr><td>photoresist</td><td>MicroChem, USA</td><td>SU-8 2075</td><td></td></tr><tr><td>PID temperature controllers&amp;nbsp;</td><td>Shanghai, China</td><td>XH-W2023</td><td></td></tr><tr><td>plasma cleaner&amp;nbsp;</td><td>Harrick Plasma</td><td>PDC-32G-2</td><td></td></tr><tr><td>polyvinyl pyrrolidone (PVP)</td><td>Aladdin, Shanghai, China</td><td>P110608</td><td></td></tr><tr><td>pump</td><td>Harvard Apparatus</td><td>PHD2000</td><td></td></tr><tr><td>silicone tubing&amp;nbsp;</td><td>BIO-RAD,USA</td><td>7318210</td><td></td></tr><tr><td>solid-state relays</td><td>KZLTD, China</td><td>KS1-25LA</td><td></td></tr><tr><td>SpeedSTAR HS DNA Polymerase&amp;nbsp;</td><td>Takara Bio Inc.</td><td>RR070A</td><td></td></tr><tr><td>steel needle</td><td>zhongxinqiheng,Suzhou,China</td><td></td><td></td></tr><tr><td>SYBR GREEN &lt;img alt=&quot;Equation 1&quot; src=&quot;/files/ftp_upload/63523/63523eq01.jpg&quot; style=&quot;margin: auto;&quot;/&gt;</td><td>Solarbio, Beijing, China</td><td>SY1020</td><td></td></tr><tr><td>temperature sensors</td><td>EasyShining Technology, Chengdu, China</td><td>TCM-M207</td><td></td></tr><tr><td>Template (&lt;em&gt;E. coli&lt;/em&gt;)</td><td>Takara Bio Inc.</td><td>AK601</td><td></td></tr><tr><td>Tween 20</td><td>Aladdin, Shanghai, China</td><td>T104863</td><td></td></tr><tr><td>voltage power supply&amp;nbsp;</td><td>Medina, NY, USA</td><td>TREK MODEL 610E</td><td></td></tr></tbody></table>

amplification of escherichia coli in a continuous-flow-pcr microfluidic chip and its detection with a capillary electrophoresis system

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Figure 5&#160;represents the electropherogram of the PCR products and the DNA markers. Trace (Figure 5A) is the CE result of the CF-PCR amplified product, trace (Figure 5B) is the CE result of the product amplified by thermal cycling, and trace (Figure 5C) is the CE result of the 100 bp DNA ladder. We first amplified the target gene of E. coli in the CF-PCR system; the PCR solution took ~10 min, 30 s from the inlet to the outlet of the chip. The size of the target amplicon of E. coli was 544 bp. The amplified PCR products were analyzed in the CE system, and CE of a 100 bp DNA ladder was also performed under the same experimental conditions. The size of the PCR product can be evaluated according to the electropherogram of the DNA ladder. Each experiment was performed three times for reproducibility. The data in Figure 5 show that the peaks corresponding to the PCR products of E. coli were observed after separation, and the migration times of the PCR products in the microfluidic chip were consistent with the one in a thermal cycler.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63523/63523fig01.jpg" /> 
Figure 1: The cleaned silicon wafer. Scale bar = 1 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/63523fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63523/63523fig02.jpg" /> 
Figure 2: The CF-PCR microfluidic chip made using PDMS. The microchannels were filled with red ink for visualization. Scale bar = 1 cm. Abbreviations: CF-PCR = continuous-flow-PCR; PDMS = polydimethysiloxane. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/63523fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63523/63523fig03.jpg" /> 
Figure 3: The CF-PCR system. (1) Microfluidic chip, (2) PTC ceramic heater, (3) syringe, (4) pump, (5) silicone tubing, (6) slot, (7) steel needle, (8) pipette tip, (9) PID temperature controller, (10) temperature sensor, (11) solid-state relay. Abbreviation: CF-PCR = continuous-flow-PCR. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/63523fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63523/63523fig04.jpg" /> 
Figure 4: The construction of the CE system. Abbreviations: CE = capillary electrophoresis; PMT = photomultiplier tube; A1, A2 = filters; B = field lens; C = dichroic mirror. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/63523fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63523/63523fig05.jpg" /> 
Figure 5: The electropherogram of Escherichia coli.&#160;Amplification by (A) CF-PCR microfluidic chip, (B) traditional PCR thermal cycler, and (C) DNA markers. Abbreviation: CF-PCR = continuous-flow-PCR. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/63523fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target</td>
			<td colspan="3">Sequence 5&#8242;&#8230;&#8230;3&#8242;</td>
			<td>Amplicon (bp)</td>
		</tr>
		<tr>
			<td>EC-F</td>
			<td colspan="3">GGAAGAAGCTTGCTTCTTTGCTGAC</td>
			<td>544</td>
		</tr>
		<tr>
			<td>EC-R</td>
			<td colspan="3">AGCCCGGGGATTTCACATCTGACTTA</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: Primers employed for Escherichia coli. Abbreviations: EC = Escherichia coli; F = forward; R = reverse.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>10x Fast Buffer I</td>
			<td>5.0 &#956;L</td>
		</tr>
		<tr>
			<td>dNTP mixture (2.5 &#956;M)</td>
			<td>4.0 &#956;L</td>
		</tr>
		<tr>
			<td>SpeedSTAR HS DNA Polymerase&#160;</td>
			<td>0.25 &#956;L</td>
		</tr>
		<tr>
			<td>polyvinyl pyrrolidone (PVP)</td>
			<td>3.5 &#956;L</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>1.5 &#956;L</td>
		</tr>
		<tr>
			<td>template</td>
			<td>1.0 &#956;L</td>
		</tr>
		<tr>
			<td>EC-F</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>EC-R</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>ultrapure water</td>
			<td>33.75 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 2: The components of the PCR solution. Abbreviations: EC = Escherichia coli; F = forward; R = reverse.
Supplemental File 1: STL file for 3D printing. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63523/CZE20170723.vi" target="_blank">Please click here to download this File.</a>

Watch this Scientific Journal Video about Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System at JoVE.com

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

amplification-escherichia-coli-continuous-flow-pcr-microfluidic-chip

Nanyang Technological University

Research

JoVE Journal

Bioengineering

2.0K Views.  University of Shanghai for Science and Technology. Dit protocol beschrijft hoe je een continuous-flow-polymeraseketensysteem bouwt op basis van de microfluïdische chip, en hoe je een capillair elektroforesesysteem bouwt in het lab. Het biedt een eenvoudige manier voor de analyse van nucleïnezuren in het laboratorium. Polymerasekettingreactie is een traditionele methode die wordt gebruikt voor de amplificatie van het doelgen.Traditionele PCR is echter zeer tijdrovend vanwege de variatie-efficiëntie bij lage temperaturen. Dit werk ste...

Video: Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated HF183 marker. The EntHF183 duplex dPCR (referred as EntHF183 dPCR hereon) assay uses the same primer and probe sequences as its published individual quantitative PCR (qPCR) counterparts. Likewise, the same water filtration and DNA extraction procedures as performed prior to qPCR are followed prior to running dPCR. However, the duplex dPCR assay has several advantages over the qPCR assays. Most important, the dPCR assay eliminates the need for running a standard curve and hence, the associated bias and variability, by direct quantification of its targets. In addition, while duplexing (i.e. simultaneous quantification) Enterococcus and HF183 in qPCR often leads to severe underestimation of the less abundant target in a sample, dPCR provides consistent quantification of both targets, whether quantified individually or simultaneously in the same reaction. The dPCR assay is also able to tolerate PCR inhibitor concentrations that are one to two orders of magnitude higher than those tolerated by qPCR. These advantages make the EntHF183 dPCR assay particularly attractive because it simultaneously provides accurate and repeatable information on both general and human-associated fecal contamination in environmental waters without the need to run two separate qPCR assays. Despite its advantages over qPCR, the upper quantification limit of the dPCR assay with currently available instrumentation is approximately four orders of magnitude lower than that achievable by qPCR. Consequently, dilution is needed for measurement of high concentrations of target organisms such as those typically observed following sewage spills.

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Environment

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that accompany system miniaturisation. Advantages include the ability to efficiently process nano- to femoto- liter volumes of sample, facile integration of functional components, an intrinsic predisposition towards large-scale multiplexing, enhanced analytical throughput, improved control and reduced instrumental footprints.1
In recent years much interest has focussed on the development of droplet-based (or segmented flow) microfluidic systems and their potential as platforms in high-throughput experimentation.2-4 Here water-in-oil emulsions are made to spontaneously form in microfluidic channels as a result of capillary instabilities between the two immiscible phases. Importantly, microdroplets of precisely defined volumes and compositions can be generated at frequencies of several kHz. Furthermore, by encapsulating reagents of interest within isolated compartments separated by a continuous immiscible phase, both sample cross-talk and dispersion (diffusion- and Taylor-based) can be eliminated, which leads to minimal cross-contamination and the ability to time analytical processes with great accuracy. Additionally, since there is no contact between the contents of the droplets and the channel walls (which are wetted by the continuous phase) absorption and loss of reagents on the channel walls is prevented.
Once droplets of this kind have been generated and processed, it is necessary to extract the required analytical information. In this respect the detection method of choice should be rapid, provide high-sensitivity and low limits of detection, be applicable to a range of molecular species, be non-destructive and be able to be integrated with microfluidic devices in a facile manner. To address this need we have developed a suite of experimental tools and protocols that enable the extraction of large amounts of photophysical information from small-volume environments, and are applicable to the analysis of a wide range of physical, chemical and biological parameters. Herein two examples of these methods are presented and applied to the detection of single cells and the mapping of mixing processes inside picoliter-volume droplets. We report the entire experimental process including microfluidic chip fabrication, the optical setup and the process of droplet generation and detection.

Droplet-based microfluidic platforms are promising candidates for high throughput experimentation since they are able to generate picoliter, self-compartmentalized vessels inexpensively at kHz rates. Through integration with fast, sensitive and high resolution fluorescence spectroscopic methods, the large amounts of information generated within these systems can be efficiently extracted, harnessed and utilized.

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

Continuous Measurement of Biological Noise in Escherichia Coli Using Time-lapse Microscopy

The protocol developed here offers a tool to enable computer tracking of Escherichia coli division and fluorescent levels over several hours. The process starts by screening for colonies that survive on minimal media, assuming that only Escherichia coli harboring the correct plasmid will be able to thrive in the specific conditions. Since the process of building large genetic circuits, requiring the assembly of many DNA parts, is challenging, circuit components are often distributed between multiple plasmids at different copy numbers requiring the use of several antibiotics. Mutations in the plasmid can destroy transcription of the antibiotic resistance genes and interject with resources management in the cell leading to necrosis. The selected colony is set on a glass-bottom Petri dish and a few focus planes are selected for microscopy tracking in both bright field and fluorescent domains. The protocol maintains the image focus for more than 12 hours under initial conditions that cannot be regulated, creating a few difficulties. For example, dead cells start to accumulate in the lenses' field of focus after a few hours of imaging, which causes toxins to buildup and the signal to blur and decay. Depletion of nutrients introduces new metabolic processes and hinder the desired response of the circuit. The experiment's temperature lowers the effectivity of inducers and antibiotics, which can further damage the reliability of the signal. The minimal media gel shrinks and dries, and as a result the optical focus changes over time. We developed this method to overcome these challenges in Escherichia coli, similar to previous works developing analogous methods for other micro-organisms. In addition, this method offers an algorithm to quantify the total stochastic noise in unaltered and altered cells, finding that the results are consistent with flow analyzer predictions as shown by a similar coefficient of variation (CV).

Continuous Measurement of Biological Noise in Escherichia Coli Using Time-lapse Microscopy

This work presents a microscopy method that allows live imaging of a single cell of Escherichia coli for analysis and quantification of the stochastic behavior of synthetic gene circuits.

The protocol developed here offers a tool to enable computer tracking of Escherichia coli division and fluorescent levels over several hours. The process ...

The Fabrication and Operation of a Continuous Flow, Micro-Electroporation System with Permeabilization Detection

Current therapeutic innovations, such as CAR-T cell therapy, are heavily reliant on viral-mediated gene delivery. Although efficient, this technique is accompanied by high manufacturing costs, which has brought about an interest in using alternative methods for gene delivery. Electroporation is an electro-physical, non-viral approach for the intracellular delivery of genes and other exogenous materials. Upon the application of an electric field, the cell membrane temporarily allows molecular delivery into the cell. Typically, electroporation is performed on the macroscale to process large numbers of cells. However, this approach requires extensive empirical protocol development, which is costly when working with primary and difficult-to-transfect cell types. Lengthy protocol development, coupled with the requirement of large voltages to achieve sufficient electric-field strengths to permeabilize the cells, has led to the development of micro-scale electroporation devices. These micro-electroporation devices are manufactured using common microfabrication techniques and allow for greater experimental control with the potential to maintain high throughput capabilities. This work builds off a microfluidic-electroporation technology capable of detecting the level of cell membrane permeabilization at a single-cell level under continuous flow. However, this technology was limited to 4 cells processed per second, and thus a new approach for increasing the system throughput is proposed and presented here. This new technique, denoted as cell-population-based feedback control, considers the cell permeabilization response to a variety of electroporation pulsing conditions and determines the best-suited electroporation pulse conditions for the cell type under test. A higher-throughput mode is then used, where this 'optimal' pulse is applied to the cell suspension in transit. The steps for fabricating the device, setting up and running the microfluidic experiments, and analyzing the results are presented in detail. Finally, this micro-electroporation technology is demonstrated by delivering a DNA plasmid encoding for green fluorescent protein (GFP) into HEK293 cells.

This protocol describes the microfabrication techniques required to build a lab-on-a-chip, microfluidic electroporation device. The experimental setup performs controlled, single-cell-level transfections in a continuous flow and can be extended to higher throughputs with population-based control. An analysis is provided showcasing the ability to electrically monitor the degree of cell membrane permeabilization in real-time.

Current therapeutic innovations, such as CAR-T cell therapy, are heavily reliant on viral-mediated gene delivery. Although efficient, this technique is ...

Human Respiratory Bacterial Infection Diagnosis Using Isothermal Amplification

Rapid Detection of Bacterial Pathogens Causing Lower Respiratory Tract Infections via Microfluidic-Chip-Based Loop-Mediated Isothermal Amplification

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will provide practical guidelines for managing and treating RTIs. This study describes a method for rapidly detecting bacterial pathogens that cause respiratory tract infections via multi-channel loop-mediated isothermal amplification (LAMP). LAMP is a sensitive and specific diagnostic tool that rapidly detects bacterial nucleic acids with high accuracy and reliability. The proposed method offers a significant advantage over traditional bacterial culturing methods, which are time-consuming and often require greater sensitivity for detecting low levels of bacterial nucleic acids. This article presents representative results of K. pneumoniae infection and its multiple co-infections using LAMP to detect samples (sputum, bronchial lavage fluid, and alveolar lavage fluid) from the lower respiratory tract. In summary, the multi-channel LAMP method provides a rapid and efficient means of identifying single and multiple bacterial pathogens in clinical samples, which can help prevent the spread of bacterial pathogens and aid in the appropriate treatment of RTIs.

Author Spotlight: Advancing Rapid Detection of Respiratory Pathogens Using Microfluidic Chip 

Various bacterial pathogens can cause respiratory tract infections and lead to serious health issues if not detected accurately and treated promptly. Rapid and accurate detection of these pathogens via&#160;loop-mediated isothermal amplification provides effective management and control of respiratory tract infections in clinical settings.

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will ...

Immunology and Infection

Microfluidic Capillary Electrophoresis for Fragment Sizing of PCR Products: A Microchip-Based Electrophoretic Separation Technique to Separate DNA Fragments Based on Size

Source: Wang, H., Zhu et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/v/59963">A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene</a>. J. Vis. Exp. (2019).
This video describes the microfluidic capillary electrophoresis technique to separate PCR amplicons based on their size. This technique helps in fragment sizing using fluorescent dyes and standard molecular size markers.

Source: Wang, H., Zhu et al. A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X ...

JoVE Encyclopedia of Experiments

Biological Techniques

Electrophoresis Techniques

Capillary Electrophoresis: A Technique to Analyze Fluorescently Labeled Polymerase Chain Reaction Amplicons

Following confirmation of PCR amplicons, use new PCR strips or plates, to dilute PCR products 1 to 10 in purified water. Vortex and centrifuge briefly. While working in a fume cupboard, prepare a master mix in a centrifuge tube consisting of formamide and reference size standard solution.
According to the number of PCR products to be analyzed, use reagent volumes, as detailed in the manuscript. Allow a 10% surplus volume.
Vortex briefly and distribute 9.5 microliters into individual wells on a PCR plate, appropriate for the available capillary electrophoresis system. Then, add 0.5 microliters of diluted PCR product. Seal and centrifuge briefly.
Then, load the plate containing the samples into a PCR thermal cycler, and denature the samples at 95 degrees Celsius for 3 minutes, before cooling to 4 degrees Celsius indefinitely. Centrifuge at 1,000 x g for 1 minute. Carefully remove the seal, and load the plate onto a calibrated capillary electrophoresis system according to the manufacturer&#39;s instructions.
Run fragment analysis capillary electrophoresis using reagents as appropriate for the apparatus of choice, and adjust the run conditions according to the description in the manuscript.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video