We are thankful to Junbeom Lee for providing the E. coli WM3064+pRL27 strain for conjugation and guidance in the procedure, Kathrin H&#252;ffmeier for helping with troubleshooting during mutant library generation, and Prof. Andr&#233; Rodrigues for supporting insect collection and permit acquisition. We also thank Rebekka Janke and Dagmar Klebsch for support in the collection and rearing of the insects. We acknowledge the Brazilian authorities for granting the following permits for access, collection, and export of insect specimens: SISBIO authorization Nr. 45742-1, 45742-7 and 45742-10, CNPq process n&#186; 01300.004320/2014-21 and 01300.0013848/2017-33, IBAMA Nr. 14BR016151DF and 20BR035212/DF). This research was supported by funding from the German Science Foundation (DFG) Research Grants FL1051/1-1 and KA2846/6-1.

<ol><li>Cain, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+decade+of+advances+in+transposon-insertion+sequencing%5BTitle%5D)+AND+%22Nature+Reviews+Genetics%22%5BJournal%5D)">A decade of advances in transposon-insertion sequencing.</a> Nature Reviews Genetics. 21 (9), 526-540 (2020).</li>
<li>Chao, M. C., Abel, S., Davis, B. M., Waldor, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+design+and+analysis+of+transposon+insertion+sequencing+experiments%5BTitle%5D)+AND+%22Nature+Reviews+Microbiology%22%5BJournal%5D)">The design and analysis of transposon insertion sequencing experiments.</a> Nature Reviews Microbiology. 14 (2), 119-128 (2016).</li>
<li>Barquist, L., Boinett, C. J., Cain, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Approaches+to+querying+bacterial+genomes+with+transposon-insertion+sequencing%5BTitle%5D)+AND+%22RNA+Biology%22%5BJournal%5D)">Approaches to querying bacterial genomes with transposon-insertion sequencing.</a> RNA Biology. 10 (7), 1161-1169 (2013).</li>
<li>Flórez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Antibiotic-producing+symbionts+dynamically+transition+between+plant+pathogenicity+and+insect-defensive+mutualism%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism.</a> Nature Communications. 8 (1), 15172(2017).</li>
<li>Flórez, L. V., Kaltenpoth, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Symbiont+dynamics+and+strain+diversity+in+the+defensive+mutualism+between+Lagria+beetles+and+Burkholderia%5BTitle%5D)+AND+%22Environmental+Microbiology%22%5BJournal%5D)">Symbiont dynamics and strain diversity in the defensive mutualism between Lagria beetles and Burkholderia.</a> Environmental Microbiology. 19 (9), 3674-3688 (2017).</li>
<li>Flórez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+antifungal+polyketide+associated+with+horizontally+acquired+genes+supports+symbiont-mediated+defense+in+Lagria+villosa+beetles%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">An antifungal polyketide associated with horizontally acquired genes supports symbiont-mediated defense in Lagria villosa beetles.</a> Nature Communications. 9 (1), 2478(2018).</li>
<li>Andrews, S. FastQC A quality control tool for high throughput sequence data. , Available from: 
 <a target="_blank" href="https://www.bioinformatics.babraham.ac.uk/projects/fastqc/">https://www.bioinformatics.babraham.ac.uk/projects/fastqc/</a> (2012).</li>
<li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads%5BTitle%5D)+AND+%22EMBnet.journal%22%5BJournal%5D)">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10-12 (2011).</li>
<li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Trimmomatic%3A+A+flexible+trimmer+for+Illumina+sequence+data%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Trimmomatic: A flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li>
<li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fast+gapped-read+alignment+with+Bowtie+2%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Fast gapped-read alignment with Bowtie 2.</a> Nature Methods. 9 (4), 357-359 (2012).</li>
<li>Liao, Y., Smyth, G. K., Shi, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FeatureCounts%3A+An+efficient+general+purpose+program+for+assigning+sequence+reads+to+genomic+features%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features.</a> Bioinformatics. 30 (7), 923-930 (2014).</li>
<li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2%5BTitle%5D)+AND+%22Genome+Biology%22%5BJournal%5D)">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biology. 15 (12), 550(2014).</li>
<li>Gaytán, M. O., Martínez-Santos, V. I., Soto, E., González-Pedrajo, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Type+three+secretion+system+in+attaching+and+effacing+pathogens%5BTitle%5D)+AND+%22Frontiers+in+Cellular+and+Infection+Microbiology%22%5BJournal%5D)">Type three secretion system in attaching and effacing pathogens.</a> Frontiers in Cellular and Infection Microbiology. 6, 129(2016).</li>
<li>Hachani, A., Wood, T. E., Filloux, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Type+VI+secretion+and+anti-host+effectors%5BTitle%5D)+AND+%22Current+Opinion+in+Microbiology%22%5BJournal%5D)">Type VI secretion and anti-host effectors.</a> Current Opinion in Microbiology. 29, 81-93 (2016).</li>
<li>Deep, A., Chaudhary, U., Gupta, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quorum+sensing+and+bacterial+pathogenicity%3A+From+molecules+to+disease%5BTitle%5D)+AND+%22Journal+of+Laboratory+Physicians%22%5BJournal%5D)">Quorum sensing and bacterial pathogenicity: From molecules to disease.</a> Journal of Laboratory Physicians. 3 (1), 4-11 (2011).</li>
<li>Silva, A. J., Benitez, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vibrio+cholerae+biofilms+and+cholera+pathogenesis%5BTitle%5D)+AND+%22PLOS+Neglected+Tropical+Diseases%22%5BJournal%5D)">Vibrio cholerae biofilms and cholera pathogenesis.</a> PLOS Neglected Tropical Diseases. 10 (2), 0004330(2016).</li>
<li>Navarro-Garcia, F., Ruiz-Perez, F., Cataldi, Á, Larzábal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Type+VI+secretion+system+in+pathogenic+Escherichia+coli%3A+structure%2C+role+in+virulence%2C+and+acquisition%5BTitle%5D)+AND+%22Frontiers+in+Microbiology%22%5BJournal%5D)">Type VI secretion system in pathogenic Escherichia coli: structure, role in virulence, and acquisition.</a> Frontiers in Microbiology. 10, 1965(2019).</li>
<li>Ribet, D., Cossart, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+bacterial+pathogens+colonize+their+hosts+and+invade+deeper+tissues%5BTitle%5D)+AND+%22Microbes+and+Infection%22%5BJournal%5D)">How bacterial pathogens colonize their hosts and invade deeper tissues.</a> Microbes and Infection. 17 (3), 173-183 (2015).</li>
<li>Schwarz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Burkholderia+Type+VI+secretion+systems+have+distinct+roles+in+eukaryotic+and+bacterial+cell+interactions%5BTitle%5D)+AND+%22PLoS+Pathogens%22%5BJournal%5D)">Burkholderia Type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions.</a> PLoS Pathogens. 6 (8), 1001068(2010).</li>
<li>Jones, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Kill+and+cure%3A+genomic+phylogeny+and+bioactivity+of+Burkholderia+gladioli+bacteria+capable+of+pathogenic+and+beneficial+lifestyles%5BTitle%5D)+AND+%22Microbial+Genomics%22%5BJournal%5D)">Kill and cure: genomic phylogeny and bioactivity of Burkholderia gladioli bacteria capable of pathogenic and beneficial lifestyles.</a> Microbial Genomics. 7 (1), 000515(2021).</li>
<li>Takeshita, K., Kikuchi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Riptortuspedestris+and+Burkholderia+symbiont%3A+an+ideal+model+system+for+insect-microbe+symbiotic+associations%5BTitle%5D)+AND+%22Research+in+Microbiology%22%5BJournal%5D)">Riptortuspedestris and Burkholderia symbiont: an ideal model system for insect-microbe symbiotic associations.</a> Research in Microbiology. 168 (3), 175-187 (2017).</li>
<li>Powell, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+screen+identifies+host+colonization+determinants+in+a+bacterial+gut+symbiont%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Genome-wide screen identifies host colonization determinants in a bacterial gut symbiont.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (48), 13887-13892 (2016).</li>
<li>Brooks, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+discovery+of+colonization+determinants+in+the+squid+symbiont+Vibrio+fischeri%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Global discovery of colonization determinants in the squid symbiont Vibrio fischeri.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (48), 17284-17289 (2014).</li>
<li>Somprasong, N., McMillan, I., Karkhoff-Schweizer, R. R., Mongkolsuk, S., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Methods+for+genetic+manipulation+of+Burkholderia+gladioli+pathovar+cocovenenans%5BTitle%5D)+AND+%22BMC+Research+Notes%22%5BJournal%5D)">Methods for genetic manipulation of Burkholderia gladioli pathovar cocovenenans.</a> BMC Research Notes. 3 (308), (2010).</li>
<li>Garcia, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Burkholderia+thailandensis%3A+Genetic+manipulation%5BTitle%5D)+AND+%22Current+Protocols+in+Microbiology%22%5BJournal%5D)">Burkholderia thailandensis: Genetic manipulation.</a> Current Protocols in Microbiology. 45, 1-15 (2017).</li>
<li>Headd, B., Bradford, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+conjugation+window+in+an+Escherichia+coli+K-12+strain+with+an+IncFII+plasmid%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">The conjugation window in an Escherichia coli K-12 strain with an IncFII plasmid.</a> Applied and Environmental Microbiology. 86 (17), 00948(2020).</li>
<li>Van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transposon+insertion+sequencing%3A+A+new+tool+for+systems-level+analysis+of+microorganisms%5BTitle%5D)+AND+%22Nature+Reviews+Microbiology%22%5BJournal%5D)">Transposon insertion sequencing: A new tool for systems-level analysis of microorganisms.</a> Nature Reviews Microbiology. 11 (7), 435-442 (2013).</li>
<li>Gallagher, L. A., Ramage, E., Patrapuvich, R., Weiss, E., Brittnacher, M., Manoil, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequence-defined+transposon+mutant+library+of+Burkholderia+thailandensis%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">Sequence-defined transposon mutant library of Burkholderia thailandensis.</a> mBio. 4 (6), 00604-00613 (2013).</li>
<li>Wong, Y. -C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Candidate+essential+genes+in+Burkholderia+cenocepacia+J2315+identified+by+genome-wide+TraDIS%5BTitle%5D)+AND+%22Frontiers+in+Microbiology%22%5BJournal%5D)">Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS.</a> Frontiers in Microbiology. 7, 1288(2016).</li>
<li>Moule, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+saturation+mutagenesis+of+Burkholderia+pseudomallei+K96243+predicts+essential+genes+and+novel+targets+for+antimicrobial+development%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">Genome-wide saturation mutagenesis of Burkholderia pseudomallei K96243 predicts essential genes and novel targets for antimicrobial development.</a> mBio. 5 (1), 00926(2014).</li>
<li>Ding, Q., Tan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Himar1+transposon+for+efficient+random+mutagenesis+in+Aggregatibacter+actinomycetemcomitans%5BTitle%5D)+AND+%22Frontiers+in+Microbiology%22%5BJournal%5D)">Himar1 transposon for efficient random mutagenesis in Aggregatibacter actinomycetemcomitans.</a> Frontiers in Microbiology. 8, 1842(2017).</li>
<li>Green, B., Bouchier, C., Fairhead, C., Craig, N. L., Cormack, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insertion+site+preference+of+Mu%2C+Tn5%2C+and+Tn7+transposons%5BTitle%5D)+AND+%22Mobile+DNA%22%5BJournal%5D)">Insertion site preference of Mu, Tn5, and Tn7 transposons.</a> Mobile DNA. 3, 3(2012).</li>
<li>Lodge, J. K., Weston-Hafer, K., Berg, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transposon+Tn5+target+specificity%3A+Preference+for+insertion+at+G%2FC+pairs%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Transposon Tn5 target specificity: Preference for insertion at G/C pairs.</a> Genetics. 120 (3), 645-650 (1988).</li>
<li>Ará Ujo, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+sequencing+and+transposon+mutagenesis+of+Burkholderia+seminalis+TC3.4.2R3+identify+genes+contributing+to+suppression+of+orchid+necrosis+caused+by+B.+gladioli%5BTitle%5D)+AND+%22Molecular+Plant-microbe+Interactions%3A+MPMI%22%5BJournal%5D)">Genome sequencing and transposon mutagenesis of Burkholderia seminalis TC3.4.2R3 identify genes contributing to suppression of orchid necrosis caused by B. gladioli.</a> Molecular Plant-microbe Interactions: MPMI. 29 (6), 435-446 (2016).</li>
<li>Dobritsa, A. P., Samadpour, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reclassification+of+Burkholderiainsecticola+as+Caballeroniainsecticola+comb.+nov.+and+reliability+of+conserved+signature+indels+as+molecular+synapomorphies%5BTitle%5D)+AND+%22International+Journal+of+Systematic+and+Evolutionary+Microbiology%22%5BJournal%5D)">Reclassification of Burkholderiainsecticola as Caballeroniainsecticola comb. nov. and reliability of conserved signature indels as molecular synapomorphies.</a> International Journal of Systematic and Evolutionary Microbiology. 69 (7), 2057-2063 (2019).</li>
<li>Ohbayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insect%27s+intestinal+organ+for+symbiont+sorting%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Insect's intestinal organ for symbiont sorting.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (37), 5179-5188 (2015).</li>
<li>Ross, C., Scherlach, K., Kloss, F., Hertweck, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+molecular+basis+of+conjugated+polyyne+biosynthesis+in+phytopathogenic+bacteria%5BTitle%5D)+AND+%22Angewandte+Chemie+International+Edition%22%5BJournal%5D)">The molecular basis of conjugated polyyne biosynthesis in phytopathogenic bacteria.</a> Angewandte Chemie International Edition. 53 (30), 7794-7798 (2014).</li>
<li>Atkins, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mutant+of+Burkholderia+pseudomallei%2C+auxotrophic+in+the+branched+chain+amino+acid+biosynthetic+pathway%2C+is+attenuated+and+protective+in+a+murine+model+of+melioidosis%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">A mutant of Burkholderia pseudomallei, auxotrophic in the branched chain amino acid biosynthetic pathway, is attenuated and protective in a murine model of melioidosis.</a> Infection and Immunity. 70 (9), 5290-5294 (2002).</li>
</ol>

The authors declare that they have no conflict of interest pertaining to the study.

A B. gladioli transposon mutant library was generated to identify important host colonization factors in the symbiotic interaction between L. villosa beetles and B. gladioli bacteria. The major steps in the protocol were conjugation, host-infection, DNA library preparation, and sequencing.
As many strains of Burkholderia are amenable to genetic modification by conjugation24,25, the plasmid carrying the transposon and antibiotic insertion cassette was conjugated successfully into the target B. gladioli Lv-StA strain from E. coli. Previous attempts of transformation by electroporation yielded very low to almost no B. gladioli transformants. It is advisable to optimize the transformation technique for the target organism to efficiently yield a large number of transformants.
One round of conjugation and 40 conjugation spots disrupted 3,736 genes in B. gladioli Lv-StA. In hindsight, multiple rounds of conjugation would be necessary to disrupt most of the 7,468 genes and obtain a saturated library. Notably, the incubation time during conjugation was not allowed to exceed 12-18 h, which is the end of the exponential growth phase of B. gladioli. Allowing conjugation beyond the exponential growth phase of bacterial cells reduces the chances of success of obtaining transconjugants26. Therefore, the conjugation period should be adjusted according to the growth of the bacterial species.
To successfully carry out an experiment involving the infection of mutant libraries in a host, it is important to assess the bacterial population bottleneck size during colonization and the diversity of mutants in the library before infection1,2,27. In preparation for the experiment, we estimated the minimum number of beetles that must be infected to have a high chance that each mutant in the library is sampled and allowed to colonize. The approximate in vivo bacterial generation time&#160;and the number of generations for the duration of the experiment were also calculated. The in vitro culture was then grown up to a comparable number of generations by adjusting the incubation time. For a similar infection experiment in other non-model hosts, the ability to maintain a laboratory culture and a constant source of the host organisms is desirable.
Following the growth of the mutant library in vivo and in vitro and sample collection, a modified DNA library preparation protocol for transposon insertion sequencing was carried out. The modification in the protocol involved designing custom PCR primers and adding PCR steps to select for DNA fragments containing the insertion cassette. Because the protocol was customized, additional PCR cycles in the protocol increased the risk of overamplification and obtaining hybridized adapter-adapter fragments in the end libraries. Hence, a final cleanup step (without size selection) after the two PCRs is recommended, as it helps in removing these fragments. The size distribution of the DNA libraries was still broader than expected. However, increasing the sequencing depth provided sufficient data that were filtered during bioinformatics analysis, obtaining satisfactory results.
As transposon-mediated mutagenesis generates thousands of random insertions in a single experiment, it is possible to generate a saturated library of mutants that contains all except those mutants where genes essential for bacterial growth have been disrupted. We most likely did not work with a saturated mutant library, given the estimations of essential genes in other studies on Burkholderia sp.28,29. A non-saturated library nevertheless helps in exploring various candidate genes for further studies using targeted mutagenesis. Before the experiments, it is also important to remember that some transposons have specific insertion target sites that increase the abundance of mutants at certain loci in the genome30. Mariner transposons are known to target AT sites for insertion31, and Tn5 transposons have a GC bias32,33. Including steps during bioinformatics analysis to recognize hotspots for transposon insertions will help in assessing any distribution bias.
Although prone to setbacks, a well-designed transposon insertion sequencing experiment can be a powerful tool to identify many conditionally important genes in bacteria within a single experiment. For example, a dozen genes in Burkholderia seminalis important for the suppression of orchid leaf necrosis were identified by combining transposon mutagenesis and genomics34. Beyond Burkholderia, several adhesion and motility genes and transporters have been identified as important colonization factors in Snodgrassella alvi symbionts of Apis mellifera (Honeybee)22, and in the Vibrio fischerii symbionts of Euprymna scolopes (Hawaiian bobtail squid)23 using the transposon-insertion mutagenesis approach.
As an alternative approach, transposon mutagenesis may be followed by screening for individual mutants using selective media instead of sequencing. Phenotypic screening or bioassays to identify deficiencies, such as motility, production of bioactive secondary metabolites, or specific auxotrophies, are feasible. For example, screening of a Burkholderia insecticola (reassigned to genus Caballeronia35) transposon mutant library has been key in identifying that the symbionts employ motility genes for colonizing Riptortus pedestris, their insect host36. Furthermore, using transposon mutagenesis and phenotypic screening, the biosynthetic gene cluster for the bioactive secondary metabolite caryoynencin was identified in Burkholderia caryophylli37. An auxotrophic mutant of Burkholderia pseudomallei was identified following transposon mutagenesis and screening and is a possible attenuated vaccine candidate against melioidosis, a dangerous disease in humans and animals38. Thus, transposon mutagenesis and sequencing is a valuable approach in studying the molecular traits of bacteria that are important for the interactions with their respective hosts in pathogenic or mutualistic associations.

Burkholderia gladioli can engage in a symbiotic association with Lagria villosa beetles, playing an important role in defense against microbial antagonists of the insect host4,5,6. Female beetles house several strains of B. gladioli in specialized glands accessory to the reproductive system. Upon egg-laying, females smear B. gladioli cells on the egg surface where antimicrobial compounds produced by B. gladioli inhibit infections by entomopathogenic fungi4,6. During late embryonic development or early after the larvae hatch, the bacteria colonize cuticular invaginations on the dorsal surface of the larvae. Despite this specialized localization and vertical transmission route of the symbionts, L. villosa can presumably also acquire B. gladioli horizontally from the environment4. Furthermore, at least three strains of B. gladioli have been found in association with L. villosa4,6. Among these, B. gladioli Lv-StA is the only one that is amenable to cultivation in vitro.
B. gladioli Lv-StA has a genome size of 8.56 Mb6 and contains 7,468 genes. Which of these genes are important for B. gladioli bacteria to colonize the beetle host? To answer this question, we used transposon-insertion sequencing (Tn-seq), an explorative method to identify conditionally essential microbial genes1,2,3. A mutant library of B. gladioli Lv-StA was created using a Tn5 transposon. Through conjugation from Escherichia coli donor cells to B. gladioli Lv-StA, a pRL27 plasmid carrying the Tn5 transposon and an antibiotic resistance cassette flanked by inverted repeats was transferred (Figure 1). Thereby, a set of mutants that individually carry disruptions of 3,736 symbiont genes was generated (Figure 2).
The mutant pool was infected onto beetle eggs to identify the colonization factors and, as a control, was also grown in vitro in King&#39;s B (KB) medium. After allowing sufficient time for colonization, hatched larvae were collected and pooled for DNA extraction. Fragments of DNA containing the transposon insert and the flanking genomic region of B. gladioli Lv-StA were selected using a modified DNA library preparation protocol for sequencing. Read quality processing followed by analysis with DESeq2 was carried out to identify specific genes crucial for B. gladioli Lv-StA to colonize L. villosa larvae when transmitted via the egg surface.

<table><tbody><tr><td>2,6- Diaminopimelic Acid</td><td>Alfa Aesar</td><td>B22391</td><td>For &lt;em&gt;E.coli&lt;/em&gt; WM3064+ pRL27</td></tr><tr><td>Agar - Agar</td><td>Roth</td><td>5210</td><td></td></tr><tr><td>Agarose</td><td>Biozym</td><td>840004</td><td></td></tr><tr><td>AMPure beads XP (magentic beads + polyethylene glycol + salts)</td><td>Beckman Coulter</td><td>A63880</td><td>Size selection in step 6.6</td></tr><tr><td>Bleach (NaOCl) 12%</td><td>Roth</td><td>9062</td><td></td></tr><tr><td>Bowtie2 v.2.4.2</td><td></td><td></td><td>Bioinfromatic tool for read mapping. Reference 10 in main manuscript.</td></tr><tr><td>Buffer-S</td><td>Peqlab</td><td>PEQL01-1020</td><td>For PCRs</td></tr><tr><td>Cell scraper</td><td>Sarstedt</td><td>83.1830</td><td></td></tr><tr><td>Cutadapt v.2.10</td><td></td><td></td><td>Bioinformatic tool for removing specific adapter sequences from the reads. Reference 8 in main manuscript.</td></tr><tr><td>DESeq2</td><td></td><td></td><td>RStudio package for assessing differential mutant abundance. Usually used for RNAseq analysis. Reference 12 in main manuscript.</td></tr><tr><td>DNA ladder 100 bp</td><td>Roth</td><td>T834.1</td><td></td></tr><tr><td>dNTPs</td><td>Life Technology</td><td>R0182</td><td>PCR for confirming success of conjugation</td></tr><tr><td>EDTA, Di-Sodium salt</td><td>Roth</td><td>8043</td><td></td></tr><tr><td>Epicentre MasterPure Complete DNA and RNA Purification Kit</td><td>Lucigen</td><td>MC85200</td><td></td></tr><tr><td>Ethidium bromide</td><td>Roth</td><td>2218.1</td><td></td></tr><tr><td>FastQC v.0.11.8</td><td></td><td></td><td>Bioinformatic tool for assessing the quality of sequencing data. Reference 7 in main manuscript.</td></tr><tr><td>FeatureCounts v.2.0.1</td><td></td><td></td><td>Bioinformatic tool to obtain read counts per genomic feature. Reference 11 in main manuscript.</td></tr><tr><td>Glycerol</td><td>Roth</td><td>7530</td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Roth</td><td>P749</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Serva</td><td>26899</td><td></td></tr><tr><td>KCl</td><td>Merck</td><td>4936</td><td></td></tr><tr><td>KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>Roth</td><td>3904</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Roth</td><td>PO27</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Roth</td><td>P030</td><td></td></tr><tr><td>NaCl</td><td>Merck</td><td>6404</td><td></td></tr><tr><td>NEBNext Multiplex Oligos for Illumina (Index primers set 1)</td><td>New England Biolabs</td><td>E7335S</td><td></td></tr><tr><td>NEBNext Ultra II DNA library prep kit for Illumina</td><td>New England Biolabs</td><td>E7645S</td><td></td></tr><tr><td>Peptone (soybean)</td><td>Roth</td><td>2365</td><td>For &lt;em&gt;Burkholderia gladioli&lt;/em&gt; Lv-StA KB-medium</td></tr><tr><td>peqGOLD &#039;Hot&#039; Taq- DNA Polymerase</td><td>VWR</td><td>PEQL01-1020</td><td>PCR for confirming success of conjugation</td></tr><tr><td>Petri plates - 145 x 20 mm</td><td>Roth</td><td>XH90.1</td><td>For selecting transconjugants</td></tr><tr><td>Petri plates - 90 x 16 mm</td><td>Roth</td><td>N221.2</td><td></td></tr><tr><td>Qiaxcel (StarSEQ GmbH, Germany)</td><td></td><td></td><td>Quality check after DNA library preparation</td></tr><tr><td>Streptavidin beads</td><td>Roth</td><td>HP57.1</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>VWR</td><td>01-1020</td><td></td></tr><tr><td>Trimmomatic v.0.36</td><td></td><td></td><td>Bioinformatic tool for trimming low quality reads and also adapter sequences. Reference 9 in main manuscript.</td></tr><tr><td>Tris -HCl</td><td>Roth</td><td>9090.1</td><td></td></tr><tr><td>Tryptone</td><td>Roth</td><td>2366</td><td>For &lt;em&gt;Escherichia coli&lt;/em&gt; WM3064+pRL27 LB medium</td></tr><tr><td>Ultrasonicator</td><td>Bandelin</td><td>GM 70 HD</td><td>For shearing</td></tr><tr><td>USER enzyme (uracil DNA glycosylase + DNA glycosylase- lyase Endonuclease VIII)</td><td>New England Biolabs</td><td>E7645S</td><td>Ligation step 6.5.2</td></tr><tr><td>Yeast extract</td><td>Roth</td><td>2363</td><td></td></tr></tbody></table>

transposon-insertion sequencing as a tool to elucidate bacterial colonization factors in a burkholderia gladioli symbiont of lagria villosa beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological processes. Advances in molecular microbiology have seen the emergence of diverse mutagenesis techniques for the manipulation of genes. Among them, transposon-insertion sequencing (Tn-seq) is a valuable tool to simultaneously assess the functionality of many candidate genes in an untargeted way. The technique has been key to identify&#160;molecular mechanisms for the colonization of eukaryotic hosts in several pathogenic microbes and a few beneficial symbionts.
Here, Tn-seq is established as a method to identify colonization factors in a mutualistic Burkholderia gladioli symbiont of the beetle Lagria villosa. By conjugation, Tn5 transposon-mediated insertion of an antibiotic-resistance cassette is&#160;carried out at random genomic locations in B. gladioli. To identify the effect of gene disruptions on the ability of the bacteria to colonize the beetle host, the generated B. gladioli transposon-mutant library is inoculated on the beetle eggs, while a control is grown in vitro in a liquid culture medium. After allowing sufficient time for colonization, DNA is extracted from the in vivo and in vitro grown libraries. Following a DNA library preparation protocol, the DNA samples are prepared for transposon-insertion sequencing. DNA fragments that contain the transposon-insert edge and flanking bacterial DNA are selected, and the mutation sites are determined by sequencing away from the transposon-insert edge. Finally, by analyzing and comparing the frequencies of each mutant between the in vivo and in vitro libraries, the importance of specific symbiont genes during beetle colonization can be predicted.

Host-associated bacteria can employ several factors to establish an association, including those mediating adhesion, motility, chemotaxis, stress responses, or specific transporters. While factors important for pathogen-host interactions have been reported for several bacteria13,14,15,16,17,18, including members of the genus Burkholderia19,20, fewer studies have explored the molecular mechanisms used by beneficial symbionts for colonization21,22,23. Using transposon insertion sequencing, the aim was to identify molecular factors that enable B. gladioli to&#160;colonize L. villosa beetles.
Transposon-mediated mutagenesis was performed using the pRL27 plasmid, which carries a Tn5 transposon and a kanamycin resistance cassette flanked by invert repeat sites. The plasmid was introduced into the target B. gladioli Lv-StA cells by conjugation with the plasmid donor E. coli WM3064 strain (as shown in Figure 1). After conjugation, the conjugation mix containing B. gladioli recipient and E. coli donor cells were plated on selective agar plates containing kanamycin. The absence of DAP on the plates eliminated the donor E. coli cells, and the presence of kanamycin selected for successful B. gladioli Lv-StA transconjugants. The pooled B. gladioli Lv-StA mutant library obtained from harvesting the 100,000 transconjugant colonies&#160;was prepared for sequencing using a modified DNA library preparation kit and custom primers. Figure 2 highlights the DNA library preparation steps. Sequencing yielded 4 Mio paired reads; 3,736 genes out of 7,468 genes in B. gladioli Lv-StA were disrupted.
To identify mutants that were colonization-defective in the host, the B. gladioli Lv-StA mutant library was infected on the beetle eggs and grown in vitro in KB medium as a control. The in vivo colonization bottleneck size was calculated before the experiment. A known number of B. gladioli Lv-StA cells was infected on beetle eggs, and the number of colonizing cells in freshly hatched first instar larvae was obtained by plating a suspension from each larva and counting colony-forming units per individual. These calculations were done to ensure that the number of colonizing cells is enough to assess all or a high percentage of the mutants in the library for their ability to colonize the host. Additionally, the growth time between in vitro and in vivo conditions was normalized based on the number of bacterial generations to make these samples comparable.
After the eggs hatched, 1,296 larvae were collected in 13 pools. The corresponding in vitro mutant cultures were grown and stored as glycerol stocks. DNA of the in vivo and in vitro grown mutant libraries was extracted and fragmented in an ultrasonicator. Figure 3 shows the size distribution of the sheared DNA, where the majority of the fragments span between 100 and 400 bp, as expected. This step was followed by the modified DNA library preparation protocol for sequencing. At each step of the protocol, the concentration of remaining DNA was checked to ensure that the steps were performed correctly and to track losses of DNA. A quality check (see the Table of Materials) before sequencing revealed that the DNA libraries contained unexpectedly large (&#62;800 bp) DNA fragments, and this was more pronounced in the in vivo libraries. Given the difficulty in optimizing the clustering of fragments in the sequencing lanes, it was necessary to increase the sequencing depth to 10 Mio paired reads in the in vivo libraries to attain the desired number of reads. The analysis of the sequencing results revealed that an average of 4 Mio reads in the in vivo libraries and 3.1 Mio reads in the in vitro libraries contained the Transposon edge in the 5&#39; end of Read-1 (Table 9), which was satisfactory for this experiment. The distribution of the 24,224 unique insertions across the B. gladioli genome in the original library is shown in Figure 4. An analysis carried out using DESeq2 revealed that the abundances of 271 mutants were significantly different between the in vivo and in vitro conditions.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62843/62843fig03.jpg" /> 
Figure 3: Agarose gels of a mutant and DNA libraries. (A) Agarose gel with unsheared DNA of a mutant in lane x and a 1 kbp ladder for scale. (B) Gel with sheared DNA library. The band sizes of the ladder in the first lane are indicated on the left side. The first three lanes a, b, and c contain sheared DNA fragments of the in vivo libraries. Lanes d, e, f, and g contain sheared DNA fragments of the in vitro libraries. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62843/62843fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62843/62843fig04.jpg" /> 
Figure 4:&#160;Location of unique insertion sites in the original library across the four replicons in the Burkholderia gladioli Lv-StA genome. Each bar along the x-axis is located at a site of insertion. The height of a bar along the y-axis corresponds to the number of reads associated with that site. Note that the two chromosomes and two plasmids are shown in full length and thus have different scales on the x-axis. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62843/62843fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">King&#8217;s B medium/ agar</td>
		</tr>
		<tr>
			<td>Peptone (soybean)</td>
			<td>20 g/L</td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>1.5 g/L</td>
		</tr>
		<tr>
			<td>MgSO4.7H2O</td>
			<td>1.5 g/L</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>15 g/L</td>
		</tr>
		<tr>
			<td colspan="2">Dissolved in distilled water</td>
		</tr>
		<tr>
			<td colspan="2">LB medium/agar</td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>10 g/L</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>5 g/L</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>10 g/L</td>
		</tr>
		<tr>
			<td colspan="2">Dissolved in distilled water</td>
		</tr>
	</tbody>
</table>
Table 1: Media components.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No.</td>
			<td>Primers</td>
			<td colspan="2">Sequence</td>
			<td>PCR annealing temp. (&#176;C)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>tpnRL17&#8211;1RC</td>
			<td colspan="2">5&#8217;-CGTTACATCCCTGGCTTGTT-3&#8217;</td>
			<td rowspan="2">58.2</td>
		</tr>
		<tr>
			<td>2</td>
			<td>tpnRL13&#8211;2RC</td>
			<td colspan="2">5&#8217;-TCGTGAAGAAGGTGTTGCTG-3&#8217;</td>
		</tr>
	</tbody>
</table>
Table 2: Primers to confirm the success of conjugation.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume (&#956;L)</td>
		</tr>
		<tr>
			<td>HPLC-purified water</td>
			<td>4.92</td>
		</tr>
		<tr>
			<td>10x Buffer S (high specificity)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>MgCl2 (25 mM)</td>
			<td>0.2</td>
		</tr>
		<tr>
			<td>dNTPs (2 mM)</td>
			<td>1.2</td>
		</tr>
		<tr>
			<td>Primer 1 (10 pmol/&#181;L)</td>
			<td>0.8</td>
		</tr>
		<tr>
			<td>Primer 2 (10 pmol/&#181;L)</td>
			<td>0.8</td>
		</tr>
		<tr>
			<td>Taq (5 U/&#181;L)</td>
			<td>0.08</td>
		</tr>
		<tr>
			<td>Mastermix total</td>
			<td>9</td>
		</tr>
		<tr>
			<td>Template</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 3: PCR master mix to confirm the success of conjugation. Abbreviations: HPLC = high-performance liquid chromatography; dNTPs = deoxynucleoside triphosphate.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature &#176;C</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>95</td>
			<td>3 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95</td>
			<td>40 s</td>
			<td></td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>58.2</td>
			<td>40 s</td>
			<td>30 to 35</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72</td>
			<td>1-2 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72</td>
			<td>4 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4</td>
			<td colspan="2">&#8734;</td>
		</tr>
	</tbody>
</table>
Table 4: PCR conditions to confirm the success of conjugation.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td colspan="2">Sequence</td>
			<td>Tm &#176;C</td>
			<td>Use</td>
			<td>Source</td>
		</tr>
		<tr>
			<td>Transposon-specific biotinylated primer</td>
			<td colspan="2">5&#8217;-Biotin-ACAGGAACACTTAACGGCTGACATG 
			-3&#8217;</td>
			<td>63.5</td>
			<td>6.7.1. PCR I</td>
			<td>Custom</td>
		</tr>
		<tr>
			<td>Modified Universal PCR primer</td>
			<td colspan="2">5&#8217;- AATGATACGGCGACCACCGAGATC 
			TACACTCTTTCCCTACACGACGCTC 
			TTCCGATCTGAATTCATCGATGAT 
			GGTTGAGATGTGT &#8211; 3&#8217;</td>
			<td>62</td>
			<td>6.10.1. PCR II</td>
			<td>Custom</td>
		</tr>
		<tr>
			<td>Index primer</td>
			<td colspan="3">Refer to the manufacturer&#8217;s manual</td>
			<td>6.7.1. PCR I &#38; 6.10.1. PCR II</td>
			<td>NEBNext Multiplex Oligos for Illumina (Index primers set 1)</td>
		</tr>
		<tr>
			<td>Adapter</td>
			<td colspan="3">Refer to the manufacturer&#8217;s manual</td>
			<td>6.5. Adapter ligation</td>
			<td>NEBNext Ultra II DNA library prep kit for Illumina</td>
		</tr>
	</tbody>
</table>
Table 5: Primers and adapter for PCR I and II during DNA library preparation. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR mix</td>
			<td>(&#181;L)</td>
		</tr>
		<tr>
			<td>Adapter-ligated DNA fragments</td>
			<td>15</td>
		</tr>
		<tr>
			<td>NEBNext Ultra II Q5 master mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Index primer (10 pmol/ &#181;L)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Transposon specific biotinylated primer (10 pmol/ &#181;L)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50</td>
		</tr>
	</tbody>
</table>
Table 6: DNA library preparation-PCR I master mix.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>98 &#176;C</td>
			<td>30 s</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>98 &#176;C</td>
			<td>10 s</td>
			<td rowspan="3">6 to 12</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>65 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72 &#176;C</td>
			<td>2 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>16 &#176;C</td>
			<td colspan="2">&#8734;</td>
		</tr>
	</tbody>
</table>
Table 7: DNA library preparation-PCR I and II conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR mix</td>
			<td>(&#181;L)</td>
		</tr>
		<tr>
			<td>Bead-selected DNA</td>
			<td>15</td>
		</tr>
		<tr>
			<td>NEBNext Ultra II Q5 master mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Index primer</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Modified universal PCR primer</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50</td>
		</tr>
	</tbody>
</table>
Table 8: DNA library preparation-PCR II master mix.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Libraries</td>
			<td>Invivo-1</td>
			<td>Invivo-2</td>
			<td>Invivo-3</td>
			<td>Invitro-1</td>
			<td>Invitro-2</td>
			<td>Invitro-3</td>
			<td>Original library</td>
		</tr>
		<tr>
			<td colspan="2">No. of reads (PE)</td>
			<td>56,57,710</td>
			<td>39,19,051</td>
			<td>30,65,849</td>
			<td>35,73,494</td>
			<td>28,83,440</td>
			<td>36,61,956</td>
			<td>46,09,410</td>
		</tr>
		<tr>
			<td colspan="2">No. of reads containing Tn &#8211; edge on 5&#8217; end of Read-1</td>
			<td>54,15,880</td>
			<td>37,31,169</td>
			<td>29,36,247</td>
			<td>33,00,499</td>
			<td>27,35,705</td>
			<td>33,50,402</td>
			<td>41,53,270</td>
		</tr>
		<tr>
			<td colspan="2">Bowtie2 overall alignment rate (%) (Read-1 only)</td>
			<td>95.53%</td>
			<td>83.71%</td>
			<td>89.87%</td>
			<td>80.79%</td>
			<td>78.00%</td>
			<td>73.06%</td>
			<td>74.92%</td>
		</tr>
		<tr>
			<td colspan="2">Number of unique insertions</td>
			<td>8,539</td>
			<td>4,134</td>
			<td>7,183</td>
			<td>18,930</td>
			<td>18,421</td>
			<td>20,438</td>
			<td>24,224</td>
		</tr>
		<tr>
			<td colspan="2">Number of genes hit</td>
			<td>1575</td>
			<td>993</td>
			<td>1450</td>
			<td>2793</td>
			<td>2597</td>
			<td>3037</td>
			<td>3736</td>
		</tr>
	</tbody>
</table>
Table 9: Summary of sequencing output and transposon insertion frequency per library. Abbreviation: PE = paired-end.

Watch this Scientific Journal Video about Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles at JoVE.co

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro.

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

transposon-insertion-sequencing-as-tool-to-elucidate-bacterial

Research

JoVE Journal

Biology

3.7K Views.  Johannes Gutenberg University. Dit protocol is nuttig voor het uitvoeren van genetische manipulatie op symbiotische bacteriën, in dit geval specifiek op Burkholderia, en het identificeren van de genen die essentieel zijn voor het koloniseren van een insectengastheer. Transposon insertion sequencing is een krachtig hulpmiddel voor het identificeren van een groot aantal voorwaardelijk essentiële genen tegelijkertijd in een enkel experiment. Begin met het inenten van een verse donorcultuur van E.coli-donor in 10 milliliter ...

Video: Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Genetics

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Immunology and Infection

Rhizobacterial Colonization Detection on Arabidopsis thaliana

Measuring Bacterial Colonization on Arabidopsis thaliana Roots in Hydroponic Condition

Measuring bacterial colonization on Arabidopsis thaliana root is one of the most frequent experiments in plant-microbe interaction studies. A standardized method for measuring bacterial colonization in the rhizosphere is necessary to improve reproducibility. We first cultured sterile A.thaliana in hydroponic conditions and then inoculated the bacterial cells in the rhizosphere at a final concentration of OD600 of 0.01. At 2 days post-inoculation, the root tissue was harvested and washed three times in sterile water to remove the uncolonized bacterial cells. The roots were then weighed, and the bacterial cells colonized on the root were collected by vortex. The cell suspension was diluted in a gradient with a phosphate-buffered saline (PBS) buffer, followed by plating onto a Luria-Bertani (LB) agar medium. The plates were incubated at 37 &#176;C for 10 h, and then, the single colonies on LB plates were counted and normalized to indicate the bacterial cells colonized on roots. This method is used to detect bacterial colonization in the rhizosphere in mono-interaction conditions, with good reproducibility.

Author Spotlight: Enhancing Rhizobacteria Colonization on Plant Roots for Improved Microbial Fertilizer Efficiency

Colonization of plant growth-promoting rhizobacteria (PGPR) in the rhizosphere is essential for its growth-promoting effect. It is necessary to standardize the method of detection of bacterial rhizosphere colonization. Here, we describe a reproducible method for quantifying bacterial colonization on the root surface.

Measuring bacterial colonization on Arabidopsis thaliana root is one of the most frequent experiments in plant-microbe interaction studies. A standardized ...

Environment

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

High-throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants During Golden Syrian Hamster Infection

In this manuscript, we describe a transposon sequencing (Tn-Seq) technique to identify and quantify Leptospira interrogans mutants altered in fitness during infection of Golden Syrian hamsters. Tn-Seq combines random transposon mutagenesis with the power of high-throughput sequencing technology. Animals are challenged with a pool of transposon mutants (input pool), followed by harvesting of blood and tissues a few days later to identify and quantify the number of mutants in each organ (output pools). The output pools are compared to the input pool to evaluate the in vivo fitness of each mutant. This approach enables screening of a large pool of mutants in a limited number of animals. With minor modifications, this protocol can be performed with any animal model of leptospirosis, reservoir host models such as rats and acute infection models such as hamsters, as well as in vitro studies. Tn-Seq provides a powerful tool to screen for mutants with in vivo and in vitro fitness defects.

High-throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants During Golden Syrian Hamster Infection

We describe here a technique that combines transposon mutagenesis with high-throughput sequencing to identify and quantify transposon leptospiral mutants in tissues after a challenge of hamsters. This protocol can be used to screen mutants for survival and dissemination in animals and can also be applied to in vitro studies.

In this manuscript, we describe a transposon sequencing (Tn-Seq) technique to identify and quantify Leptospira interrogans mutants altered in fitness ...

Visualizing Bacteria in Nematodes using Fluorescent Microscopy

Symbioses, the living together of two or more organisms, are widespread throughout all kingdoms of life. As two of the most ubiquitous organisms on earth, nematodes and bacteria form a wide array of symbiotic associations that range from beneficial to pathogenic 1-3. One such association is the mutually beneficial relationship between Xenorhabdus bacteria and Steinernema nematodes, which has emerged as a model system of symbiosis 4. Steinernema nematodes are entomopathogenic, using their bacterial symbiont to kill insects 5. For transmission between insect hosts, the bacteria colonize the intestine of the nematode's infective juvenile stage 6-8. Recently, several other nematode species have been shown to utilize bacteria to kill insects 9-13, and investigations have begun examining the interactions between the nematodes and bacteria in these systems 9.
We describe a method for visualization of a bacterial symbiont within or on a nematode host, taking advantage of the optical transparency of nematodes when viewed by microscopy. The bacteria are engineered to express a fluorescent protein, allowing their visualization by fluorescence microscopy. Many plasmids are available that carry genes encoding proteins that fluoresce at different wavelengths (i.e. green or red), and conjugation of plasmids from a donor Escherichia coli strain into a recipient bacterial symbiont is successful for a broad range of bacteria. The methods described were developed to investigate the association between Steinernema carpocapsae and Xenorhabdus nematophila 14. Similar methods have been used to investigate other nematode-bacterium associations 9,15-18and the approach therefore is generally applicable.
The method allows characterization of bacterial presence and localization within nematodes at different stages of development, providing insights into the nature of the association and the process of colonization 14,16,19. Microscopic analysis reveals both colonization frequency within a population and localization of bacteria to host tissues 14,16,19-21. This is an advantage over other methods of monitoring bacteria within nematode populations, such as sonication 22or grinding 23, which can provide average levels of colonization, but may not, for example, discriminate populations with a high frequency of low symbiont loads from populations with a low frequency of high symbiont loads. Discriminating the frequency and load of colonizing bacteria can be especially important when screening or characterizing bacterial mutants for colonization phenotypes 21,24. Indeed, fluorescence microscopy has been used in high throughput screening of bacterial mutants for defects in colonization 17,18, and is less laborious than other methods, including sonication 22,25-27and individual nematode dissection 28,29.

To study the mutualism between Xenorhabdus bacteria and Steinernema nematodes, methods were developed to monitor bacterial presence and location within nematodes. The experimental approach, which can be applied to other systems, entails engineering bacteria to express the green fluorescent protein and visualizing, using fluorescence microscopy bacteria within the transparent nematode.

 
Symbioses, the living together of two or more organisms, are widespread throughout all kingdoms of life. As two of the most ubiquitous organisms on ...

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to identify commensal or mutualistic bacteria species. The latter ones, have been observed to serve multiple functions to the insect, i.e. helping in insect reproduction1, boosting the immune response2, pheromone production3, as well as nutrition, including the synthesis of essential amino acids4, among others. &#160; &#160;
Due to the importance of these associations, many efforts have been made to characterize the communities down to the individual members. However, most of these efforts were either based on cultivation methods or relied on the generation of 16S rRNA gene fragments which were sequenced for final identification. Unfortunately, these approaches only identified the bacterial species present in the gut and provided no information on the metabolic activity of the microorganisms.
To characterize the metabolically active bacterial species in the gut of an insect, we used stable isotope probing (SIP) in vivo employing 13C-glucose as a universal substrate. This is a promising culture-free technique that allows the linkage of microbial phylogenies to their particular metabolic activity. This is possible by tracking stable, isotope labeled atoms from substrates into microbial biomarkers, such as DNA and RNA5. The incorporation of 13C isotopes into DNA increases the density of the labeled DNA compared to the unlabeled (12C) one. In the end, the 13C-labeled DNA or RNA is separated by density-gradient ultracentrifugation from the 12C-unlabeled similar one6. Subsequent molecular analysis of the separated nucleic acid isotopomers provides the connection between metabolic activity and identity of the species.
Here, we present the protocol used to characterize the metabolically active bacteria in the gut of a generalist insect (our model system), Spodoptera littoralis (Lepidoptera, Noctuidae). The phylogenetic analysis of the DNA was done using pyrosequencing, which allowed high resolution and precision in the identification of insect gut bacterial community. As main substrate, 13C-labeled glucose was used in the experiments. The substrate was fed to the insects using an artificial diet.

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

The active bacterial community associated with the gut of Spodoptera littoralis, was determined by stable-isotope-probing (SIP) coupled to pyrosequencing. Using this methodology, identification of the metabolically active bacteria species within the community was done with high resolution and precision.

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

Essential Components of Borreliella (Borrelia) burgdorferi In Vitro Transcription Assays

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between vertebrates and ticks and dramatically remodels its transcriptional profile to survive in disparate environments during infection. A focus of B. burgdorferi studies is to clearly understand how the bacteria responds to its environment through transcriptional changes. In vitro transcription assays allow for the basic mechanisms of transcriptional regulation to be biochemically dissected. Here, we present a detailed protocol describing B. burgdorferi RNA polymerase purification and storage, sigma factor purification, DNA template generation, and in vitro transcription assays. The protocol describes the use of RNA polymerase purified from B. burgdorferi 5A4 RpoC-His (5A4-RpoC). 5A4-RpoC is a previously published strain harboring a 10XHis-tag on the rpoC gene encoding the largest subunit of the RNA polymerase. In vitro transcription assays consist of the RNA polymerase purified from strain 5A4-RpoC, a recombinant version of the housekeeping sigma factor RpoD, and a PCR-generated double-stranded DNA template. While the protein purification techniques and approaches to assembling in vitro transcription assays are conceptually well understood and relatively common, handling considerations for RNA polymerases often differ from organism to organism. The protocol presented here is designed for enzymatic studies on the B. burgdorferi RNA polymerase. The method can be adapted to test the role of transcription factors, promoters, and post-translational modifications on the activity of the RNA polymerase.

Essential Components of Borreliella Borrelia burgdorferi In Vitro Transcription Assays

In vitro transcription assays can decipher the mechanisms of transcriptional regulation in Borreliella burgdorferi. This protocol describes the steps to purify B. burgdorferi RNA polymerase and perform in vitro transcription reactions. Experimental approaches using in vitro transcription assays require reliable purification and storage of active RNA polymerase.

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between ...

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This process has notably lower efficiencies in the Lyme disease spirochete relative to other, better-characterized Gram-negative bacteria. The rate of success of transformation is highly dependent upon having concentrated amounts of high-quality DNA from specific backgrounds and is subject to significant strain-to-strain variability. Alternative means for introducing foreign DNA (i.e., shuttle vectors, fluorescent reporters, and antibiotic-resistance markers) into B. burgdorferi could be an important addition to the armamentarium of useful tools for the genetic manipulation of the Lyme disease spirochete. Bacteriophage have been well-recognized as natural mechanisms for the movement of DNA among bacteria in a process called transduction. In this study, a method has been developed for using the ubiquitous borrelial phage &#966;BB-1 to transduce DNA between B. burgdorferi cells of both the same and different genetic backgrounds. The transduced DNA includes both borrelial DNA and heterologous DNA in the form of small shuttle vectors. This demonstration suggests a potential use of phage-mediated transduction as a complement to electroporation for the genetic manipulation of the Lyme disease spirochete. This report describes methods for the induction and purification of phage &#966;BB-1 from B. burgdorferi, the use of this phage in transduction assays, and the selection and screening of potential transductants.

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using &#966;BB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This ...

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Samenvatting

Meer video's verkennen